معلومة

10.9: خطوات النسخ - علم الأحياء


أهداف التعلم

افهم الخطوات الأساسية في نسخ الحمض النووي إلى الحمض النووي الريبي

عملية النسخ يحدث في السيتوبلازم في بدائيات النوى وفي النواة في حقيقيات النوى. يستخدم الحمض النووي كقالب لصنع جزيء RNA (mRNA). أثناء النسخ ، يتم صنع خيط من الرنا المرسال مكمل لشريط من الحمض النووي. يوضح الشكل 1 كيف يحدث هذا. في النهاية سيتم تحويل أجزاء من mRNA المنسوخة إلى بروتينات وظيفية.

يمكنك أيضًا مشاهدة مقطع الفيديو هذا الأكثر تفصيلاً حول النسخ.

خطوات النسخ

يتم النسخ في ثلاث خطوات: البدء والاستطالة والإنهاء. الخطوات موضحة في الشكل 2.

الخطوة 1: البدء

المبادرة هي بداية النسخ. يحدث عندما يكون الانزيم بوليميراز الحمض النووي الريبي يرتبط بمنطقة من الجين تسمى المروجين. يشير هذا إلى تفكك الحمض النووي حتى يتمكن الإنزيم من "قراءة" القواعد في أحد خيوط الحمض النووي. أصبح الإنزيم الآن جاهزًا لصنع خيط من الرنا المرسال مع سلسلة تكميلية من القواعد.

الخطوة الثانية: الاستطالة

استطالة هي إضافة النيوكليوتيدات إلى خيط الرنا المرسال. يقرأ بوليميراز الحمض النووي الريبي خيط الحمض النووي غير الملفوف ويبني جزيء الرنا المرسال باستخدام أزواج القواعد التكميلية. خلال هذه العملية ، يرتبط الأدينين (A) في الحمض النووي باليوراسيل (U) في الحمض النووي الريبي.

الخطوة 3: الإنهاء

نهاية هي نهاية النسخ ، وتحدث عندما يعبر RNA polymerase a وقف (إنهاء) التسلسل في الجين. اكتمل خيط الرنا المرسال ، وينفصل عن الحمض النووي.

يقدم هذا الفيديو مراجعة لهذه الخطوات. يمكنك التوقف عن مشاهدة الفيديو في الساعة 5:35. (بعد هذه النقطة ، فإنه يناقش الترجمة ، والتي سنناقشها في النتيجة التالية.)

تم استبعاد عنصر YouTube من هذا الإصدار من النص. يمكنك مشاهدته عبر الإنترنت هنا: pb.libretexts.org/bionm1/؟p=356

قم بزيارة هذه الرسوم المتحركة من BioStudio لمشاهدة عملية النسخ بدائية النواة.

تم استبعاد عنصر YouTube من هذا الإصدار من النص. يمكنك مشاهدته عبر الإنترنت هنا: pb.libretexts.org/bionm1/؟p=356


خطوات النسخ من DNA إلى RNA

  • كيمياء
    • الكيمياء الحيوية
    • الأساسيات
    • القوانين الكيميائية
    • جزيئات
    • الجدول الدوري
    • المشاريع والتجارب
    • طريقة علمية
    • الكيمياء الفيزيائية
    • الكيمياء الطبية
    • الكيمياء في الحياة اليومية
    • الكيميائيين المشهورين
    • أنشطة للأطفال
    • الاختصارات والمختصرات
    • دكتوراه في العلوم الطبية الحيوية ، جامعة تينيسي في نوكسفيل
    • بكالوريوس في الفيزياء والرياضيات من كلية هاستينغز

    الحمض النووي أو حمض الديوكسي ريبونوكلييك هو الجزيء الذي يقوم بترميز المعلومات الجينية. ومع ذلك ، لا يمكن للحمض النووي أن يأمر الخلية بشكل مباشر لصنع البروتينات. يجب أن يكون نسخت في الحمض النووي الريبي أو الحمض النووي الريبي. الحمض النووي الريبي ، بدوره ، هو مترجم عن طريق الآلات الخلوية لصنع الأحماض الأمينية ، والتي تتحد معًا لتكوين عديد الببتيدات والبروتينات


    عملية نسخ الحمض النووي الريبي | علم الوراثة

    تشارك الحمض الريبي النووي النقال ، و الرنا المرسال ، و الرنا الريباسي في عملية النسخ. ومع ذلك ، فإن إنزيم النسخ ، أي بوليميراز الحمض النووي الريبي المعتمد على الحمض النووي ، مطلوب لتخليق الحمض النووي الريبي باستخدام ثلاثي الفوسفات الريبونوكليوتيد ، أي ATP و GTP و CTP و UTP. تم وصف هيكل ووظيفة بوليميراز RNA طيه.

    1. بوليميراز الحمض النووي الريبي:

    على قالب DNA يتم تحفيز استطالة سلسلة RNA في كل خطوة بواسطة RNA polymerase. تم العثور على بوليميراز الحمض النووي الريبي في كل من بدائيات النوى وحقيقيات النوى ولكن تختلف البنية والوظيفة في هاتين المجموعتين من الكائنات الحية.

    في بدائيات النوى فقط إنزيم واحد ، يتحكم بوليميراز الحمض النووي الريبي في تركيب جميع الحمض النووي الريبي الخلوي ، بينما في حقيقيات النوى ، تشارك عدة أنواع من بوليميرات الحمض النووي الريبي في تخليق الحمض النووي الريبي الخلوي. على سبيل المثال ، يتم تصنيع mRNA و tRNA و rRNA في E. coli بواسطة نفس بوليميريز RNA.

    الإنزيم الهولندي عبارة عن بوليميريز RNA كامل يتكون من نواة وإنزيم وعامل سيغما (σ) ، ومن ثم فهو إنزيم معقد. يتكون الإنزيم الأساسي للإشريكية القولونية من خمس سلاسل متعددة الببتيد ، ووحدتان فرعيتان α ، وواحدة (β) ، ووحدة فرعية β & # 8217 ووحدة فرعية واحدة من أوميغا (ω) (الشكل 10.2). هناك سبع سلاسل متعددة الببتيد (مثل β αα δω1، ω2) في الإنزيم الأساسي للإشريكية القولونية. يرتبط الإنزيم الهولندي بالحمض النووي في مواقع محددة تسمى المحفزات وينسخ طولًا معينًا من الحمض النووي الريبي.

    وبالتالي فإن العامل o يلعب دورًا مهمًا في التعرف على المروج بواسطة بوليميريز RNA. يمكن بسهولة عزله عن holoenzyme. تتكون الوحدة الفرعية من موقع محفز لتخليق الحمض النووي الريبي ومواقع الربط للركائز والمنتجات أيضًا. تلعب الوحدة الفرعية دورًا في ربط بوليميريز الحمض النووي الريبي بقالب الحمض النووي.

    تقوم وحدتان فرعيتان بتجميع وحدتين فرعيتين أكبر في إنزيم أساسي (α2ββ & # 8217ω). وظيفة الوحدة الفرعية الصغيرة (ω) غير معروفة بالتفصيل ومع ذلك ، من المفترض أنها تشارك في الفك. يتم تلخيص الوحدات الفرعية لبوليميراز الحمض النووي والجينات الهيكلية ووظائفها في الجدول 10.1. يقوم بوليميراز E. coli RNA بتركيب RNA بمعدل 40 نيوكليوتيد في الدقيقة عند 37 درجة مئوية.

    (ط) أنواع بوليميراز الحمض النووي الريبي:

    هناك ثلاثة أنواع مختلفة من بلمرات الحمض النووي الريبي حقيقية النواة يتم نسخها بواسطة ثلاث مجموعات مختلفة من الجينات (الشكل 10.3).

    تتميز بحساسيتها للسموم الفطرية ، α-amanitin:

    (أ) بوليميراز RNA I (RNA Pol I):

    يقع في النواة ويقوم بتجميع سلائف معظم الرنا الريباسي. إنه حساس لـ α-amanitin.

    (ب) بوليميراز RNA II (RNA Pol II):

    وهو موجود في البلازما النووية ويقوم بتوليف سلائف الرنا المرسال وبعض الرنا النووي الصغير. إنه حساس للغاية لـ α-amanitin.

    (ج) بوليميراز RNA III (RNA Pol III):

    وهي تقع في النواة. يقوم بتوليف سلائف الحمض النووي الريبي ، و 5S rRNA وغيرها من الحمض النووي الريبي النووي الصغير والهيولي. إنه حساس بشكل معتدل لـ α-amanitin.

    بالإضافة إلى ذلك ، عادةً ما يمنع المضاد الحيوي ريفامبيسين النسخ عن طريق التداخل مع الوحدة الفرعية P لبوليميراز الحمض النووي الريبي بدائية النواة. قدم Ishihawa (1992) وجهة نظر حالية لبنية بوليميريز RNA وبعض مواقع الربط لكل وحدة فرعية (الشكل 10.4).

    الشكل 10.4: خريطة وظيفية للوحدات الفرعية لبوليميراز الحمض النووي الريبي.

    (2) موقع النسخ:

    يبدأ النسخ في موقع المروج ، أي الكسترون المترجم على جزيء الحمض النووي. من بين اثنين فقط يتم نسخ خيط واحد من dsDNA. وقد ثبت أيضًا أنه في ØX174 لأي كيسترون ، يتم نسخ خيط واحد فقط من الحمض النووي إلى الحمض النووي الريبي. بالإضافة إلى ذلك ، في Phage λ و phage T4 يتم نسخ كلا الخيطين ، حيث يعمل أحدهما كقالب لبعض الجينات.

    يتم نسخ باقي الجينات من الخيط الآخر. يُعرف خيط الحمض النووي الذي يعمل كقالب بالخيط المضاد للحساسية. متواليات النوكليوتيدات لنصوص الخيط المضاد للحاسة و mRNA مكملة. الخيط الآخر يسمى حبلا الحس. إن قواعد خيط الإحساس وقواعد الرنا المرسال متطابقة تمامًا.

    في بعض الفيروسات مثل SP8 ، ØX174 ، وما إلى ذلك ، من بين اثنين ، يتم نسخ حبلا واحد فقط. في SV40 ، يتم نسخ كلا الجدولين لجينات مختلفة. على النقيض من T حتى العاثيات ، والعاثية λ ، والإشريكية القولونية وحقيقيات النوى ، تعمل مناطق مختلفة من كل من خيط DNA كقالب لتخليق الحمض النووي الريبي.

    الجدول 10.1: الوحدات الفرعية لبوليميراز الحمض النووي الريبي وعوامل النسخ الأخرى.

    (3) عملية النسخ:

    تتم عملية النسخ في الخطوات الثلاث الرئيسية التالية: بدء السلسلة واستطالة السلسلة وإنهاء السلسلة. تم توضيح عملية النسخ الكاملة في الشكل 10.5.

    2. بدء السلسلة:

    أثناء عملية النسخ ، تكون المكونات المطلوبة لبدء سلسلة RNA هي السلائف المنشطة للقالب ، وأيونات المعادن ثنائية التكافؤ (Mg ++ أو Mn ++) ، وبوليميراز الحمض النووي الريبي والقالب.

    (ط) التعرف على المروج:

    يلعب إنزيم RNA polymerase دورًا رئيسيًا في التعرف على موقع البدء وربطه. قبل تكوين الإنزيم المعقد ، يتفاعل عامل سيجما مع الإنزيم الأساسي في موقع الوحدة الفرعية p. هذا مطلوب للتحقق من نسخ كل من الخيوط بواسطة الإنزيم الأساسي. ينسخ holoenzyme واحدًا فقط من خيطي DNA. يتعرف عامل سيغما في holoenzyme على منطقة المروج للحمض النووي (الشكل 10.6).

    يسمى التسلسل الأساسي المحدد (20-200 قاعدة طويلة) المروج. أظهر فحص عدد كبير من سلاسل المحفز لجينات مختلفة من بكتيريا مختلفة أن لديهم العديد من الميزات المشتركة. تتمركز تسلسلات المحفز عند -10 و -35 زوجًا أساسيًا من نقطة بداية النسخ وهي متورطة في وظيفة المروج العادية.

    تحتوي الإشريكية القولونية على المكونين السداسيين المتميزين التاليين للمحفز:

    يُطلق على التسلسل -10 اسم مربع Pribnow & # 8217s ، بينما يُطلق على المنطقة -35 اسم موقع التعرف. تم العثور على صندوق Pribnow & # 8217s كجزء من جميع مروجي بدائيات النوى. تقع المنطقة -35 حول 35 زوجًا أساسيًا في المنبع (بعيدًا عن اتجاه موقع النسخ). المروج هو المنبع من الجين الهيكلي.

    يتفاعل بوليميراز الحمض النووي الريبي مع المجموعات الموجودة في الأخدود الرئيسي ويتعرف على التسلسل المناسب المنبع (منطقة -35) من مربع Pribnow & # 8217s ، وبعد ذلك يشكل مجمعًا مستقرًا عن طريق الانتقال أفقيًا إلى المنطقة -10. وبالتالي ، فإن عامل سيجما يتعرف على كل من المناطق المذكورة أعلاه.

    (2) ربط RNA Polymerase بالمروج:

    تختلف قوة ارتباط بوليميريز الحمض النووي الريبي بمحفزات مختلفة. هناك بعض المحفزات التي لها مواقع ربط للبروتينات بدلاً من بوليميريز RNA.

    لذلك ، بالنسبة إلى هؤلاء المروجين ، يجب أن يشغل هذا البروتين هذا البروتين حتى يرتبط بوليميراز الحمض النووي الريبي بشكل صحيح. أحد أكثر مواقع الربط شيوعًا لهذا النوع هو الموقع الذي يربط مركبًا من بروتين مستقبلات AMP الدوري (CRP). يتحكم تركيز AMP في نشاط هؤلاء المروجين.

    (3) فك اللولب المزدوج للحمض النووي:

    قد تلعب الطبيعة الحلزونية الفائقة للكروموسوم دورًا في وظيفة المروج. بشكل عام ، يعتبر الكروموسوم الملفوف بشكل سلبي للغاية قالب نسخ أفضل من الكروموسوم المريح. إن الإجهاد الالتوائي الذي يفرضه اللف الفائق يجعل فصل منطقة معينة من الحمض النووي أسهل بواسطة بوليميراز الحمض النووي الريبي.

    ومن ثم ، فإن اللف الفائق يؤثر على تعبير بعض الجينات أكثر من الجينات الأخرى. يؤدي ارتباط عامل أوميغا (ω) لبوليميراز الحمض النووي الريبي إلى فك حلزون الحمض النووي. وبالتالي ، يتم فتح جزء قصير من الحمض النووي. ثم يسمح المجمع المفتوح بربط محكم لبوليميراز الحمض النووي الريبي مع البدء اللاحق في تخليق الحمض النووي الريبي.

    (4) توليف القاعدة الأولى لسلسلة RNA:

    تكون القاعدة الأولى من الحمض النووي الريبي المركب دائمًا في شكل البيورين ، أي إما ثلاثي الفوسفات الجوانين (pppG) أو الأدينين (pppA). تبدأ معظم السلاسل في الإشريكية القولونية بـ pppG ، بينما في Phage T7 و ØX174 تبدأ مع pppA. على عكس تكرار الحمض النووي ، لا يتطلب بدء تخليق الرنا المرسال البادئات. ينتهي البدء بعد تكوين أول رابطة بين النوكليوتيدات (5 & # 8217pppPupN) (الشكل 10.5).

    3. استطالة السلسلة:

    تحدث استطالة السلسلة بواسطة الإنزيم الأساسي الذي يتحرك على طول قالب الحمض النووي. بعد بدء الاستطالة ، يستمر النسخ بمعدل يتراوح بين 30 و 60 نيوكليوتيدًا في الثانية عند 37 درجة مئوية.

    بشكل عام ، يشمل تفاعل الاستطالة الخطوات:

    (ط) ربط النوكليوتيدات ثلاثي الفوسفات ،

    (2) تكوين الرابطة بين النيوكليوتيدات و 3 & # 8242-OH من سلسلة الحمض النووي الريبي الوليدة ،

    (3) إطلاق بيروفوسفات ، و

    (4) إزاحة البوليميراز على طول قالب الحمض النووي.

    تتم إضافة ثلاثي فوسفات الريبونوكليوتيد المنشط ، أي ATP و UTP و OTP و CTP وفقًا للنيوكليوتيدات الخاصة بشريط واحد من قالب الحمض النووي. يشكل النوكليوتيدات الواردة روابط هيدروجينية بقاعدة DNA. يحدث التفاعل بين النيوكليوتيدات عند 3 & # 8242 نهاية جزيء RNA و P في مجموعة ثلاثي الفوسفات مما يؤدي إلى إزالة الفوسفات (PPi). سرعان ما يتحلل PPi إلى فوسفات غير عضوي (Pi) (الشكل 10.7 أ).

    (أنا) الافراج عن عامل سيجما (σ):

    عندما يتم تكوين نسخة 8-9 من الرنا المرسال الطويل من النيوكليوتيدات ، يتم تحرير العامل σ فجأة من المجمع. وبالتالي يؤدي هذا إلى انخفاض في ألفة σ من معقد RNA بوليميريز الحمض النووي الريبي الوليدي. يمكن أن يتحد إطلاق مع أي إنزيم أساسي وبالتالي يتم إعادة استخدامه لبدء سلسلة جديدة (الشكل 10.5).

    (ثانيا) اتجاه النسخ:

    تعلق ثلاثي فوسفات الريبونوكليوتيد بالنيوكليوتيدات الأولى للقالب ويحدث نمو السلسلة في اتجاه 5 & # 8242 → 3 & # 8242. تستعيد منطقة القالب التي تم نسخها شكلها الحلزوني المزدوج خلف الفقاعة ، وتستعيد المنطقة التالية من الحمض النووي التي سيتم نسخها.

    لا يطول نص RNA بشكل موحد على طول القالب. يرجع ذلك إلى وجود مواقع متوقفة مؤقتًا في مناطق معينة في القالب. لقد وجد أن تسلسل الإيقاف المؤقت يحتوي بشكل عام على مناطق غنية من GC بحوالي 16-20 نقطة أساس ، أعلى من 3 & # 8242-OH نهاية النص المتوقف مؤقتًا. أيضًا ، توجد منطقة التناظر الثنائي 16-20 نقطة أساس عند المنبع 3 & # 8242-نهاية أسباب توقف مؤقت. ومع ذلك ، فإن آلية التوقف المؤقت غير واضحة.

    علاوة على ذلك ، يُعتقد أنه بعد إطلاق عامل سيجما ، تصبح بروتينات NusA و NusG مرتبطة بالإنزيم الأساسي وتعديل معدل الاستطالة. في بعض المواقع ، تعمل هذه البروتينات على تعزيز التوقف.

    من المثير للاهتمام أن نلاحظ أن نسخة RNA التي تم تشكيلها حديثًا تتكون من مجموعة ثلاثي الفوسفات في 5 & # 8242 ومجموعة حرة -OH في نهاية 3 & # 8242 (الشكل 10.7 ب). علاوة على ذلك ، فإن نسخة الحمض النووي الريبي أكبر من الجين البنيوي. تحتوي معظم الرسائل على مروج ، أي المنطقة القريبة من mRNA والتي تسمى تسلسل القائد ، أي المنطقة غير المترجمة قبل بداية الترجمة.

    (3) إثبات قراءة mRNA:

    يمتلك بوليميراز RNA نشاط قراءة إثبات مشابه لنشاط نوكلياز خارجي 3 & # 8242 → 5 & # 8242 لبوليميراز DNA. يعمل البروتينان ، GreA و GreB ، على تمكين بوليميريز الحمض النووي الريبي (الذي يتم إيقافه نسبيًا) لعمل نسخة احتياطية وشق 2-3 نيوكليوتيدات من نهاية الرسالة الوليدة 3 & # 8242. ينتج عن هذا إطلاق بوليميريز الحمض النووي الريبي الذي يتحرك بدوره عبر نقطة التوقف عند نهاية الجين 3 & # 8242.

    (4) تفاعل البروتين والبروتين مع RNA Polymerase:

    هناك العديد من العوامل التنظيمية التي تتصل مباشرة ببوليميراز الحمض النووي الريبي في منطقة المروج للقالب. يمكن تقسيم هذه العوامل التنظيمية (البروتينات) إلى فئتين ، الأولى والثانية.

    تعمل بروتينات الفئة الأولى كمنشط للنسخ. هذه تربط المنبع من المروج (مثل CRP و AraC و Fnr و OmpR). تتداخل عوامل النسخ من الفئة الثانية مع منطقة المروج ، حيث يقوم عدد قليل من هذه المنظمات بالاتصال بنهاية الطرف C للوحدة الفرعية α (الشكل 10.4).

    4. إنهاء السلسلة:

    تنتهي عملية إنهاء سلسلة RNA بالأحداث:

    (ط) وقف الاستطالة ،

    (2) إصدار نسخة من مجمع التعليم العالي ، و

    (3) تفكك البوليميراز من قالب الحمض النووي.

    هناك نوعان من الآليات التي تؤدي إلى الإنهاء: عمليات الإنهاء المستقلة عن rho وتعتمد على rho.

    (ط) إنهاء Rho المستقل:

    يتم التعرف على إشارة الإنهاء المستقلة عن طريق الحمض النووي بواسطة الحمض النووي نفسه. يتكون من منطقة غنية GC مع تناظر ثنائي. يقرأ بوليميراز الحمض النووي الريبي ويوسع تسلسل بولي أ على قالب الحمض النووي (الشكل 108 أ). يقوم بتوليف RNA trans & shyscript الذي يصبح مطويًا لتشكيل بنية جذعية وحلقة من حوالي 20 قاعدة من المنبع 3 & # 8242-OH مع امتداد طرفي من 4-8 بولي U resi & shydues (الشكل 10.8 ب).

    يتسبب هيكل حلقة جذعية RNA في توقف بوليميريز RNA وتعطيل هجين RNA-DNA عند نهاية 5 & # 8242. توجد بقايا Poly U في نهاية 3 & # 8242 للجزيء الهجين RNA-DNA. أزواج القاعدة الهجينة U-A غير مستقرة نسبيًا ، لذا فهي تتسبب في كسر 3 & # 8242 نهاية الهجين وتحرير سلسلة mRNA.

    (2) الإنهاء المعتمد على Rho:

    أعطى Richardson (1983) نموذجًا لإنهاء سلسلة RNA المعتمد على rho (الشكل 10.9). يتطلب الإنهاء المعتمد على Rho بروتين (عامل) Rho المشفر بواسطة جين rho. عامل rho هو شكل سداسي.

    عندما يكون موقع الإيقاف المؤقت القوي موجودًا على ما يبدو على مسافة محددة من منطقة المروج ، يحدث الإنهاء المرتبط بعامل rho. ومع ذلك ، يجب أن يكون واضحًا أن موقع الإيقاف المؤقت القوي الموجود بالقرب من المروج لن يعمل كموقع للإنهاء. يتطلب Rho وجود ssRNA كمنطقة ربط (الشكل 10.9 أ).

    شكل .10.9: نموذج لإطلاق RNA بوساطة عامل Rh.

    يتحرك عامل Rh على طول RNA من موقع ارتباطه إلى إنزيم RNA polymerase. يتم تسهيل الحركة من خلال التحلل المائي لـ ATP الذي يوفر الطاقة. نأمل أن يلتف ssRNA حول الجزء الخارجي من عامل rho في موقع الربط الكبير. تسبق هذه الخطوة وصول بوليميراز الحمض النووي الريبي في موقع الإنهاء (ب).

    يتم لف بوليميراز الحمض النووي الريبي جزئيًا حول الجزء الخارجي من عامل Rh. وبالتالي يأتي بروتين Rho في اتصال مع إنزيم البلمرة الأساسي. يتم تسهيل هذا الاتصال عن طريق بروتينات NusA أو NusG. تعتمد هذه الخطوة على التحلل المائي للنيوكليوتيدات ثلاثي الفوسفات (C).

    تستمر عملية الالتفاف باستمرار وتعطل الروابط غير التساهمية التي تمسك الحمض النووي الريبي المتشكل حديثًا ببوليميراز DNA و RNA. يؤدي تنشيط نشاط هليكاز RNA / DNA إلى فصل سلسلة mRNA وبوليميراز RNA الأساسي عن قالب DNA. وبالتالي ، يتم تحرير معقد Rho-protein-RNA من مركب RNA polymerase- DNA (D).

    أخيرًا ، يتم إطلاق بوليميريز الحمض النووي الريبي الأساسي ويتفاعل مع عامل سيغما المستخدم لبدء الجولة الثانية من النسخ. تم أيضًا وصف إشارة إنهاء النسخ المعتمدة على rho في العاثية F.1 بواسطة Mose and Model (1984).

    5. دوران الحمض النووي الريبي:

    على أساس معدلات الانحلال ، يمكن تصنيف الحمض النووي الريبي المنسوخ بهذه الطريقة في الجسم الحي إلى جزئين: جزيئات RNA مستقرة وغير مستقرة. تتكون جزيئات الحمض النووي الريبي المستقرة من الحمض الريبي النووي الريبوزي (الحمض النووي الريبي) والرنا الريباسي (الرنا الريباسي) ، في حين أن الرنا المرسال غير مستقر. في E. coli ، يكون إجمالي عدد سكان tRNA و rRNA 15-25٪ و 70-80٪ ، على التوالي.

    إن mRNA موجود فقط بكميات قليلة (3-5٪). تتمثل أسباب الاستقرار في ارتباط الرنا الريباسي في مجمعات البروتين النووي الريبوسوم (الريبوسوم) وتحويل الحمض الريبي النووي الريبي والـ rRNA إلى البنية الثانوية.

    يحمي هذا التحويل الحمض النووي الريبي المستقر عند الطرف 3 & # 8242 من انحلال الريبونوكلياز. تعمل نوكليازات الخلايا الخارجية على تحلل الرنا المرسال في اتجاه 3 '→ 5'. ومع ذلك ، فإن وجود بنية الحلقة الجذعية قد يمنع ارتباط نوكليازات داخلية.


    10.9: خطوات النسخ - علم الأحياء

    النسخ هو العملية التي يتم من خلالها تصنيع الحمض النووي الريبي أحادي السلسلة من الحمض النووي. بطريقة أخرى ، يُسمى نقل المعلومات الجينية من الحمض النووي إلى الحمض النووي الريبي النسخ. في هذه العملية ، يؤدي خيط واحد من الحمض النووي يسمى DNA النموذجي إلى ظهور خيط جديد من الحمض النووي الريبي. ويسمى أيضًا تخليق الحمض النووي الريبي.

    المتطلبات الأساسية للنسخ:

    1) قالب DNA-يعمل خيط واحد من الحمض النووي كقالب لتوجيه تكوين الحمض النووي الريبي التكميلي أثناء النسخ. في تخليق الحمض النووي الريبي ، تقوم خيط واحد فقط من الحمض النووي بنسخ الحمض النووي الريبي.

    2) ركائز-ركائز تخليق الحمض النووي الريبي هي رباعي الفوسفات الريبونوكليوزيد - أدينوسين ثلاثي الفوسفات (rATP) ، غوانوزين ثلاثي الفوسفات (rGTP) ، سيتيدين ثلاثي الفوسفات (eCTP) ، ويوريدين ثلاثي الفوسفات (rUTP). يوفر انقسام رابطة الفوسفات عالية الطاقة بين & ألفا والفوسفات الطاقة لإضافة النيوكليوتيدات إلى سلسلة الحمض النووي الريبي المتنامية.

    3) الإنزيمات-في حقيقيات النوى ، هناك ثلاثة أنواع من بوليميراز الحمض النووي الريبي المسؤولة عن تخليق جميع الأنواع الثلاثة من الحمض النووي الريبي (mRNA ، و rRNA ، و tRNA). في بدائيات النوى ، يقوم بوليميراز واحد فقط من RNA بتجميع الأنواع الثلاثة من الحمض النووي الريبي.

    أ) بوليميريز RNA - المسؤول عن تخليق الرنا الريباسي.

    ب) RNA polymerase II- المسؤول عن تخليق mRNA.

    ج) RNA polymerase III - المسؤول عن تخليق الحمض الريبي النووي النقال.

    4) المروج-تسلسل المروج مسؤولة عن توجيه بوليميراز الحمض النووي الريبي لبدء النسخ عند نقطة معينة. يتعرف عامل سيجما (وسيغما) على إشارة البداية أو منطقة المحفز للحمض النووي. وبالمثل ، مطلوب عامل إنهاء يسمى عامل Rho (& rho) لإنهاء منطقة المنهي.

    عملية النسخ:

    تشبه عملية النسخ عملية تكرار الحمض النووي. يتطلب منطقة مروج ومنطقة فاصل. يكتمل في ثلاث خطوات:

    1)المبادرة:

    إنها بداية تخليق حبلا الحمض النووي الريبي. تتضمن هذه العملية:

    & bull أثناء النسخ المتماثل ، يرتبط بوليميراز الحمض النووي الريبي بمنطقة معينة من الحمض النووي تُعرف بمنطقة المروج. في بدائيات النوى ، يتطلب الأمر عامل سيجما (& سيجما) الذي يتعرف على إشارة البداية أو منطقة المحفز للحمض النووي. يرتبط مجمع RNA polymerase- sigma بمنطقة المروج ويبدأ النسخ.

    وبتأثير مركب RNA polymerase- sigma ، ينفصل شريطا DNA أو ينفصلان عند نقطة معينة. (لا يلزم وجود برايمر لتوليف الحمض النووي الريبي.)

    المصدر: www.mun.ca شكل: النسخ

    2) استطالة:

    إنها خطوة تشكيل حبلا الحمض النووي الريبي. انها مشتركة:

    & bull نظرًا لأن خيط الحمض النووي ينفصل ، يتم فصل كل من خيوط الحمض النووي. من بين اثنين من خيوط الحمض النووي ، يعمل الخيط 3'-5 'نموذجًا أو خيطًا رئيسيًا لتشكيل الحمض النووي الريبي ، بينما تظل خصلة أخرى (5'-3') نائمة أو لا تشارك ، ومن ثم تسمى الشريط المضاد للحس.

    & bullTemplate أو Master strand له مروج أو موقع بدء وموقع فاصل. يبدأ تخليق الحمض النووي الريبي في موقع المروج وينتهي عند موقع الإنهاء.

    & bullFormation من عائدات سلسلة جديدة ريبونوكليوتيد بإضافة قواعد جديدة. يحدث الاقتران الأساسي على أساس خصوصيتها [أزواج A مع U و C مع G] على خيط DNA النموذجي. تظل هذه القواعد متاحة في البلازما النووية في شكل ATP و CTP و UTP و GTP. يتم تحفيز عملية البلمرة هذه بواسطة إنزيم يُعرف باسم بوليميراز الحمض النووي الريبي المعتمد على الحمض النووي.

    يتحرك بوليميراز الحمض النووي الريبي تدريجيًا للأمام ويتقدم في تكوين حبلا الحمض النووي الريبي. عندما يصل RNA polymerase إلى موقع الإنهاء ، فإنه يؤدي إلى نهاية النسخ.

    3) الإنهاء:

    إنها الخطوة الأخيرة من النسخ. يدل على نهاية النسخ. انها مشتركة:

    يتم إنهاء تخليق RNA بمجرد وصول RNA polymerase إلى موقع الإنهاء.

    & bull مع انتهاء النسخ ، تعيد خيوط الحمض النووي إلى الوراء. يسمى الحمض النووي الريبي المشكل حديثًا النسخ وتسمى العملية النسخ.

    & bullRNA لا يظلان متصلين بقالب الحمض النووي ، ولكن ينفصلان كخيط واحد وينتقلان من النواة عبر المسام النووي إلى السيتوبلازم.

    يتم تحرير نسخ عديدة من نصوص الحمض النووي الريبي من كل قالب DNA.

    وهكذا ، فإن عملية تخليق الحمض النووي الريبي قد اكتملت.

    كيشاري ، أرفيند ك. وكمال ك. أديكاري. كتاب نصي لعلم الأحياء الثانوي العالي (الفصل الثاني عشر). الأول. كاتماندو: Vidyarthi Pustak Bhandar ، 2015.

    ميهتا ، كريشنا رام. مبدأ علم الأحياء. الطبعة الثانية. كاتماندو: أسميتا ، 20682069.

    جوردن ، س. مبدأ علم الأحياء. الطبعة الثانية . كاتماندو: منشورات كتاب أسميتا ، 2068.2069.

    تكاليف شاحنة الغذاء SpaceTeam يونيكورن يعطل دمج البرمجة الزوجية الفيروسية لبيانات كبيرة على سطح السفينة نموذج أولي بديهي للظل الطويل. استجابة قراصنة بديهية

    جاكوب سيمز

    نموذج أولي بديهي لقائد الفكر ، شخصيات بارالاكس بارادايم ، ظل طويل يشرك يونيكورن نموذج صندوق SpaceTeam.

    كيلي ديويت

    الشلال المستجيب الذي يحركه المخترقون الحدسي هو حتى عام 2000 ورأس المال الاستثماري المتأخر من كورتادو. تعمل شاحنة الطعام على دمج البرمجة الزوجية البديهية لتصميم ستيف جوبز المفكر والصانع والفاعل الذي يركز على الإنسان.

    تكاليف شاحنة الغذاء SpaceTeam وحيد القرن يعطل دمج البرمجة الزوجية الفيروسية لخط عرض البيانات الكبيرة على سطح السفينة نموذج أولي بديهي للظل الطويل. متسلل مستجيب بديهي

    لوك سميث

    Unicorn disrupt تكامل البرمجة الزوجية الفيروسية لخط عرض البيانات الضخمة على سطح الملعب بنموذج أولي بديهي طويل الظل. استجابة قراصنة بديهية

    اترك تعليقا :
    أشياء للذكرى
    • يُطلق على نقل المعلومات الجينية من الحمض النووي إلى الحمض النووي الريبي اسم النسخ.
    • المتطلبات المختلفة ضرورية لتوليف الحمض النووي الريبي.
    • تشبه عملية النسخ عملية تكرار الحمض النووي. يتطلب منطقة مروج ومنطقة فاصل. يتم إكماله في ثلاث خطوات: البدء والاستطالة والإنهاء.
    • وتشمل كل علاقة أقيمت بين الناس.
    • يمكن أن يكون هناك أكثر من مجتمع واحد في المجتمع. المجتمع أصغر من المجتمع.
    • إنها شبكة من العلاقات الاجتماعية لا يمكن رؤيتها أو لمسها.
    • المصالح المشتركة والأهداف المشتركة ليست ضرورية للمجتمع.

    ابق على اتصال مع Kullabs. يمكنك أن تجدنا في كل منصات التواصل الاجتماعي تقريبًا.


    الكيمياء الحيوية لمعدلات الكروماتين

    كشفت دراستان بيوكيميائيتان أنيقتان كيف تؤثر قراءة النيوكليوسومات المتعددة على الكروماتين. استخدم كل من Bing Li (UT Southwestern ، الولايات المتحدة الأمريكية) و Geeta Narlikar (جامعة كاليفورنيا في سان فرانسيسكو ، الولايات المتحدة الأمريكية) ركائز ثنائية النواة لاستكشاف كيفية تأثير حالة تعديل أحد النواة على تعديل آخر. قدم Bing Li نموذجًا مثيرًا للفضول حيث يساهم التعرف على ثنائي النواة وتباعده في التحكم في Rpd3 deacetylase في الخميرة. قدم Narlikar آلية رائعة لكيفية تعاون العديد من الكرومودومات التي تحتوي على بروتينات لتكوين أو الحفاظ على أو توسيع الهيتروكروماتين القمعي باستخدام عوامل مختلفة (HP1 و Suv39 / Clr4). وأظهرت أنه على الرغم من التعرف على نفس المخلفات الميثيلية على النيوكليوسومات (هيستون 3 ليسين 9 H3K9) ، فإن التفضيلات التفاضلية لـ di- على عكس حالات ثلاثي الميثيل سمحت للعوامل بالتعاون بدلاً من التنافس. من المحتمل أن المزيد من التفاعلات بين النيوكليوسومات المعدلة بشكل مختلف والبروتينات الملحقة ستكشف عن مستوى من تنظيم النسخ محيرًا في كل من الدقة والتعقيد.


    صف عملية النسخ

    النسخ هو عملية النسخ رمز الحمض النووي إلى نوع آخر من التعليمات البرمجية أو الرسائل - mRNA (messenger RNA).

    انزيم يسمى بوليميراز الحمض النووي الريبي يرتبط بجزء معين من تسلسل الحمض النووي يسمى المروجين (هذا بمثابة إشارة للخلية لبدء النسخ). ثم يجب أن يفك الحمض النووي ويفكك لكشف خيطي الحمض النووي.

    خيط واحد ، يحتوي على قواعد مكملة لتلك الخاصة بالجين الذي يحتاج إلى نسخ ، يعمل باعتباره a نموذج - من خلال الاقتران الأساسي التكميلي ، تتماشى النيوكليوتيدات جنبًا إلى جنب مع حبلا القالب (A مع U ، G مع C) ، لتشكيل جزيء mRNA أحادي السلسلة.

    عندما يتعرف RNA polymerase على أنه وصل إلى تسلسل المنهي أو وقف الكودون (نهاية تسلسل ترميز ذلك الجين المحدد) ، ينفصل الرنا المرسال عن الحمض النووي. يقوم الحمض النووي بإعادة الالتفاف خلف بوليميراز الحمض النووي الريبي حيث ينتقل (يتحرك على طول) عبر حبلا الحمض النووي.

    ينتقل جزيء mRNA بعد ذلك من النواة ، عبر مسام نووي ، إلى السيتوبلازم - جاهزًا للترجمة إلى بروتين في موقع الريبوسوم.


    1) مقدمة

    كما تعلم فإن الحمض النووي هو المادة الجينية لكل كائن حي تقريبًا. كانت تخزن المعلومات الجينية في شكل متواليات النيوكليوتيدات.

    تصبح هذه المعلومات المخزنة مفيدة فقط عندما يتم التعبير عنها في إنتاج الحمض النووي الريبي والبروتينات (يمكنك قول ذلك النسخ والترجمة).

    يمكنك اعتبار أن الوظيفة الرئيسية للحمض النووي هي تخزين المعلومات الجينية لفترة طويلة. لكن الحمض النووي الريبي هو الجزيء الوحيد الذي يعمل كتخزين ونقل المعلومات في النشاط التحفيزي. لأن بعض فيروسات RNA تحتوي على RNA كمادة وراثية.


    النسخ والترجمة البيولوجية

    تعريف الترجمة. تقدم البيولوجيا الجزيئية وعلم الوراثة البيولوجية التعريف التالي للترجمة في علم الأحياء. الترجمة تعني عملية ترجمة تسلسل mRNA (messenger RNA) إلى أحماض أمينية. نظرًا لأن معظم الخلايا تتكون من البروتين ، فإن ترجمة الحمض النووي هي عملية أساسية لتكوين الخلايا.

    مراحل الترجمة

    يدعي بعض الناس أن هناك أربع مراحل للترجمة: البدء والاستطالة والانتقال والإنهاء. ومع ذلك ، يعتقد معظم العلماء أن هناك ثلاث خطوات فقط للترجمة في علم الأحياء. يتم استخدام نفس المفاهيم في عملية النسخ لوصف عملية صنع سلسلة mRNA. الفرق هو أنه في الترجمة يتم إنشاء سلسلة البولي ببتيد. دعونا نلقي نظرة فاحصة على هذه الخطوات.

    في هذه المرحلة ، يتم دمج الحمض النووي الريبي (tRNA) ، و mRNA ، والحمض الأميني في الريبوسوم. يرتبط الحمض النووي الريبي (tRNA) بكودون البداية ، وهو مجموعة من ثلاثة نيوكليوتيدات تبدأ التسلسل المشفر للجين وتحدد الحمض الأميني ميثيونين. يدخل الميثيونين إلى الريبوسوم عن طريق ربطه بالـ tRNA بمضاد الكودون الصحيح. كود البدء هو AUG. UAC هو أنتيكودون لها. إذا كنت لا تعرف ذلك ، فيجب عليك الانتباه إلى قواعد الاقتران الأساسي التكميلي. عندما يرتبط الحمض النووي الريبي (tRNA) بالكودون AUG ، يتم توصيل الميثيونين بـ tRNA.

    عندما يتم إنشاء روابط الببتيد ، يظهر المزيد من الأحماض الأمينية. تصبح سلسلتهم أطول. وهكذا ، يتم تشكيل عديد ببتيد. يدخل الحمض الريبي النووي النقال والحمض الأميني الريبوسوم. إذا تطابق anticodon مع كودون mRNA ، سيربط الريبوسوم اثنين من الأحماض الأمينية معًا. إذا لم يتم & rsquot ، فسيتم رفض الأحماض الأمينية الخاطئة. من خلال ربط الأحماض الأمينية معًا ، يحركها الريبوسوم إلى الأمام. يتكرر الإجراء عندما يدخل الزوج التالي على الحمض الريبي النووي النقال والحمض الأميني الريبوسوم.

    إذا وصل الريبوسوم إلى واحد من ثلاثة أكواد توقف ، فسيحصل على & rsquot الحمض الريبي النووي النقال المقابل. وبالتالي ، ستحفز البروتينات إطلاق سلسلة البولي ببتيد. تتعرف عوامل إطلاق البروتين على أكواد الإيقاف فقط عندما تظهر في الموقع A. يسمى الموقع A بذلك لأنه يرتبط فقط بـ aminoacyl-tRNA الوارد (الحمض النووي الريبي الذي يجلب الحمض الأميني التالي). يطلق الريبوسوم من الرنا المرسال. تنفصل وحداتها الفرعية. سوف تتصل الصغيرة بالتركيبات الجديدة من الحمض الريبي النووي النقال والميثيونين. ستبدأ ترجمة جديدة.

    وبالتالي ، يمكننا أن نستنتج أن هناك خطوتين للتعبير الجيني: النسخ والترجمة. النسخ هو ترميز معلومات الحمض النووي في جزيئات الحمض النووي الريبي. الترجمة هي ترميز معلومات نيوكليوتيدات الرنا المرسال إلى سلسلة من الأحماض الأمينية في البروتين.

    بالنسبة لحقيقيات النوى ، يتم فصل النسخ والترجمة في الوقت المناسب. كما أنها تحدث في أماكن مختلفة. تتم عملية نسخ الحمض النووي إلى الحمض النووي الريبي في النواة. تحدث عملية ترجمة mRNA إلى polypeptides في polysomes في السيتوبلازم. نظرًا لعدم وجود نواة للبكتيريا و rsquot ، تحدث عمليتا الترجمة والنسخ في وقت واحد.

    لفهم المعلومات بشكل أفضل ، تحقق من المصادر التالية:

    تأكد من أنه يمكنك الإجابة على الأسئلة التالية. إذا لم يكن الأمر كذلك ، فاقرأ هذه المعلومات مرة أخرى أو احصل على بعض المساعدة المهنية من أفضل معلمي الأحياء.


    علم الأحياء 171

    بنهاية هذا القسم ، ستكون قادرًا على القيام بما يلي:

    • قائمة الخطوات المختلفة في النسخ بدائية النواة
    • ناقش دور المروجين في النسخ بدائية النواة
    • صف كيف ومتى يتم إنهاء النسخ

    بدائيات النوى ، والتي تشمل البكتيريا والعتائق ، هي في الغالب كائنات وحيدة الخلية تفتقر ، بحكم التعريف ، إلى نوى مرتبطة بالغشاء وعضيات أخرى. الكروموسوم البكتيري عبارة عن دائرة مغلقة ، على عكس الكروموسومات حقيقية النواة ، لا يتم تنظيمها حول بروتينات هيستون. تسمى المنطقة المركزية للخلية التي يتواجد فيها DNA بدائية النواة بالمنطقة النووية. بالإضافة إلى ذلك ، غالبًا ما تحتوي بدائيات النوى على بلازميدات وفيرة ، وهي عبارة عن جزيئات DNA دائرية أقصر قد تحتوي على جين واحد أو عدد قليل من الجينات. يمكن نقل البلازميدات بشكل مستقل عن الكروموسوم البكتيري أثناء انقسام الخلية وغالبًا ما تحمل سمات مثل تلك المرتبطة بمقاومة المضادات الحيوية.

    يتطلب النسخ في بدائيات النوى (وفي حقيقيات النوى) أن يزيل الحلزون المزدوج للحمض النووي جزئيًا في منطقة تخليق الرنا المرسال. تسمى منطقة الفك فقاعة النسخ. دائمًا ما يتم النسخ من نفس خيط الحمض النووي لكل جين ، وهو ما يسمى بضفيرة القالب. يُعد منتج mRNA مكملًا لقالب القالب وهو مطابق تقريبًا لشريط الحمض النووي الآخر ، الذي يُطلق عليه اسم الخيط غير القوالب ، أو خيط الترميز. الاختلاف الوحيد في النوكليوتيدات هو أنه في mRNA ، يتم استبدال جميع النيوكليوتيدات T بالنيوكليوتيدات U ((الشكل)). In an RNA double helix, A can bind U via two hydrogen bonds, just as in A–T pairing in a DNA double helix.


    The nucleotide pair in the DNA double helix that corresponds to the site from which the first 5′ mRNA nucleotide is transcribed is called the +1 site, or the initiation site . Nucleotides preceding the initiation site are denoted with a “-” and are designated upstream nucleotides. Conversely, nucleotides following the initiation site are denoted with “+” numbering and are called downstream nucleotides.

    Initiation of Transcription in Prokaryotes

    Prokaryotes do not have membrane-enclosed nuclei. Therefore, the processes of transcription, translation, and mRNA degradation can all occur simultaneously. The intracellular level of a bacterial protein can quickly be amplified by multiple transcription and translation events that occur concurrently on the same DNA template. Prokaryotic genomes are very compact, and prokaryotic transcripts often cover more than one gene or cistron (a coding sequence for a single protein). Polycistronic mRNAs are then translated to produce more than one kind of protein.

    Our discussion here will exemplify transcription by describing this process in الإشريكية القولونية, a well-studied eubacterial species. Although some differences exist between transcription in بكتريا قولونية and transcription in archaea, an understanding of بكتريا قولونية transcription can be applied to virtually all bacterial species.

    Prokaryotic RNA Polymerase

    Prokaryotes use the same RNA polymerase to transcribe all of their genes. في بكتريا قولونية, the polymerase is composed of five polypeptide subunits, two of which are identical. Four of these subunits, denoted α, α, β، و β‘, comprise the polymerase core enzyme . These subunits assemble every time a gene is transcribed, and they disassemble once transcription is complete. Each subunit has a unique role the two α-subunits are necessary to assemble the polymerase on the DNA the β-subunit binds to the ribonucleoside triphosphate that will become part of the nascent mRNA molecule and the β‘ subunit binds the DNA template strand. The fifth subunit, σ, is involved only in transcription initiation. It confers transcriptional specificity such that the polymerase begins to synthesize mRNA from an appropriate initiation site. Without σ, the core enzyme would transcribe from random sites and would produce mRNA molecules that specified protein gibberish. The polymerase comprised of all five subunits is called the holoenzyme .

    Prokaryotic Promoters

    A promoter is a DNA sequence onto which the transcription machinery, including RNA polymerase, binds and initiates transcription. In most cases, promoters exist upstream of the genes they regulate. The specific sequence of a promoter is very important because it determines whether the corresponding gene is transcribed all the time, some of the time, or infrequently. Although promoters vary among prokaryotic genomes, a few elements are evolutionarily conserved in many species. At the -10 and -35 regions upstream of the initiation site, there are two promoter consensus sequences, or regions that are similar across all promoters and across various bacterial species ((Figure)). The -10 sequence, called the -10 region, has the consensus sequence TATAAT. The -35 sequence has the consensus sequence TTGACA. These consensus sequences are recognized and bound by σ. Once this interaction is made, the subunits of the core enzyme bind to the site. The A–T-rich -10 region facilitates unwinding of the DNA template, and several phosphodiester bonds are made. The transcription initiation phase ends with the production of abortive transcripts, which are polymers of approximately 10 nucleotides that are made and released.


    View Transcription (video – Walter & Eliza Hall) to see the first part of transcription and the base sequence repetition of the TATA box.

    Elongation and Termination in Prokaryotes

    The transcription elongation phase begins with the release of the σ subunit from the polymerase. The dissociation of σ allows the core enzyme to proceed along the DNA template, synthesizing mRNA in the 5′ to 3′ direction at a rate of approximately 40 nucleotides per second. As elongation proceeds, the DNA is continuously unwound ahead of the core enzyme and rewound behind it. The base pairing between DNA and RNA is not stable enough to maintain the stability of the mRNA synthesis components. Instead, the RNA polymerase acts as a stable linker between the DNA template and the nascent RNA strands to ensure that elongation is not interrupted prematurely.

    Prokaryotic Termination Signals

    Once a gene is transcribed, the prokaryotic polymerase needs to be instructed to dissociate from the DNA template and liberate the newly made mRNA. Depending on the gene being transcribed, there are two kinds of termination signals. One is protein-based and the other is RNA-based. Rho-dependent termination is controlled by the rho protein, which tracks along behind the polymerase on the growing mRNA chain. Near the end of the gene, the polymerase encounters a run of G nucleotides on the DNA template and it stalls. As a result, the rho protein collides with the polymerase. The interaction with rho releases the mRNA from the transcription bubble.

    Rho-independent termination is controlled by specific sequences in the DNA template strand. As the polymerase nears the end of the gene being transcribed, it encounters a region rich in C–G nucleotides. The mRNA folds back on itself, and the complementary C–G nucleotides bind together. The result is a stable hairpin that causes the polymerase to stall as soon as it begins to transcribe a region rich in A–T nucleotides. The complementary U–A region of the mRNA transcript forms only a weak interaction with the template DNA. This, coupled with the stalled polymerase, induces enough instability for the core enzyme to break away and liberate the new mRNA transcript.

    Upon termination, the process of transcription is complete. By the time termination occurs, the prokaryotic transcript would already have been used to begin synthesis of numerous copies of the encoded protein because these processes can occur concurrently. The unification of transcription, translation, and even mRNA degradation is possible because all of these processes occur in the same 5′ to 3′ direction, and because there is no membranous compartmentalization in the prokaryotic cell ((Figure)). In contrast, the presence of a nucleus in eukaryotic cells precludes simultaneous transcription and translation.


    View Transcription (video – ndsuvirtualcell) to see the process of prokaryotic transcription.

    ملخص القسم

    In prokaryotes, mRNA synthesis is initiated at a promoter sequence on the DNA template comprising two consensus sequences that recruit RNA polymerase. The prokaryotic polymerase consists of a core enzyme of four protein subunits and a σ protein that assists only with initiation. Elongation synthesizes mRNA in the 5′ to 3′ direction at a rate of 40 nucleotides per second. Termination liberates the mRNA and occurs either by rho protein interaction or by the formation of an mRNA hairpin.

    Free Response

    If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?

    DNA is different from RNA in that T nucleotides in DNA are replaced with U nucleotides in RNA. Therefore, they could never be identical in base sequence.

    In your own words, describe the difference between rho-dependent and rho-independent termination of transcription in prokaryotes.

    Rho-dependent termination is controlled by the rho protein, which tracks along behind the polymerase on the growing mRNA chain. Near the end of the gene, the polymerase stalls at a run of G nucleotides on the DNA template. The rho protein collides with the polymerase and releases mRNA from the transcription bubble. Rho-independent termination is controlled by specific sequences in the DNA template strand. As the polymerase nears the end of the gene being transcribed, it encounters a region rich in C–G nucleotides. This creates an mRNA hairpin that causes the polymerase to stall right as it begins to transcribe a region rich in A–T nucleotides. Because A–U bonds are less thermostable, the core enzyme falls away.

    A fragment of bacterial DNA reads:

    3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’

    Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

    By examining the DNA sequence, we can see that there is a -10 consensus sequence near the 3’ end of the fragment. If we then count downstream, the +1 initiation site is the T immediately following the sequence AAT. This means the DNA fragment that will serve as the template for transcription has the sequence TGATAGAAGCACTCTAC. The mRNA made from this template will have complimentary base pairing with uracil (U) instead of thymine (T). This gives us ACUAUCUUCGUGAGAUG as the transcribed mRNA sequence.

    قائمة المصطلحات


    شاهد الفيديو: نسخ mRNA الأولي ومعالجته (كانون الثاني 2022).