معلومة

Multiplex PCR ، أمبليكون أقصر يمنع أمبليكون أطول؟


أريد تشغيل PCRs متعدد الإرسال من أجل التنميط الجيني الخاص بي ، مع زوج تمهيدي يستهدف البنية الخاصة بي وزوج تمهيدي يستهدف بعض جينات التدبير المنزلي (نوع من عنصر تحكم مدمج).

لقد صممت أمبليكون التحكم ليكون قصيرًا جدًا (اختبرت 3 أزواج من التمهيدي مع أمبليكون 120 و 85 و 50 نقطة أساس على التوالي). الأساس المنطقي وراء هذا هو أن الأمبليكونات الخاصة بي عادة ما تكون 200-400 نقطة في البوصة ، وأريد شيئًا يمكن تمييزه بوضوح ، ولكن أقصر بدلاً من أطول (أريد أن أبقي خياراتي مفتوحة لأمبليونات مستهدفة أطول).

على أي حال ، بغض النظر عن زوج التحكم التمهيدي الذي أستخدمه ، كلما حاولت مضاعفة الإرسال ، ينتهي بي الأمر برؤية amplicon الأقصر. انظر إلى الصورة الهلامية أدناه للحصول على مثال (الممرات: 1-سلم ، 2،3-هدف + تحكم ، 4،5-تحكم ، 5،6- هدف).

أرى أن الممرات 2،3 تحتوي على لطخة إضافية باهتة جدًا مقارنة بـ 4،5 ، لكنني أريد نطاقًا لمضخم الصوت المستهدف. أيضًا ، نطاقاتي القصيرة غير واضحة تمامًا.

أيضًا ، للإشارة فقط ، لا تتداخل أمبليكونات على الإطلاق.

لذا أعتقد أن أسئلتي هي:

  • لماذا يختفي النطاق الأطول؟
  • لماذا الفرقة الأقصر ضبابية للغاية؟
  • ما الذي يمكنني فعله لمنع حدوث هذا النموذج؟

اتضح أن $ T_m $ كان في الواقع هو المشكلة ، أو بالأحرى ، أن خوارزمية الحساب بالغت في تقدير $ T_m $ للزوج التمهيدي لـ amplicon الأطول (أو قللت من قيمة الخيار الأقصر). على أي حال ، يبدو أنه عند درجة حرارة 60 درجة مئوية ، تختطف البادئات الأمبليكون الأقصر آلية البلمرة.

أدى ضبط درجة حرارة مرحلة التلدين على 55 درجة مئوية إلى حل مشكلتي ، والآن أحصل على نتائج أفضل باستمرار:


Multiplex PCR ، أمبليكون أقصر يمنع أمبليكون أطول؟ - مادة الاحياء

Multiplex PCR هي تقنية بيولوجيا جزيئية واسعة الانتشار لتضخيم أهداف متعددة في تجربة PCR واحدة. في اختبار تعدد الإرسال ، يمكن تضخيم أكثر من تسلسل مستهدف واحد باستخدام أزواج متعددة من البادئة في خليط تفاعل. كامتداد للاستخدام العملي لـ PCR ، فإن هذه التقنية لديها القدرة على تحقيق وفورات كبيرة في الوقت والجهد داخل المختبر دون المساومة على فائدة التجربة.


Multiplex PCR إلى جانب تسلسل amplicon المباشر للكشف المتزامن عن العديد من مسببات الأمراض المنقولة بالمياه

تستخدم مناهج مراقبة وتنظيم جودة المياه الحالية بكتيريا مؤشر البراز (FIB) لتقييم المخاطر الصحية بشكل غير مباشر من مسببات الأمراض البرازية. من المتوقع أن يوفر الاكتشاف المباشر لمسببات الأمراض المنقولة بالمياه تقييمًا أكثر دقة وشمولاً للمخاطر ، والذي أعاقه عدم وجود طرق للكشف المتزامن عن العديد من مسببات الأمراض المنقولة بالمياه. هدفت هذه الدراسة إلى تطوير نهج mPCR-NGS الذي يستخدم عمق التسلسل العالي لـ NGS والكشف القائم على التسلسل لزيادة مستوى تعدد الإرسال لـ mPCR للكشف المباشر عن مسببات الأمراض في الماء. تم تصميم بادئات PCR الفردية لـ 16 جينًا محددًا مستهدفًا من تسعة مسببات أمراض بكتيرية مختلفة ، وتم تحديد مزيج مثالي من البادئات مع أقل عدد من التكميلات الأولية لإعداد تعدد الإرسال. باستخدام عينة اختبار اصطناعية ، تم تحسين نظام mPCR لدرجة حرارة التلدين وتركيز التمهيدي ، وتم تطوير إجراءات المعلومات الحيوية للكشف المباشر عن أمبليكونات جين العلامة المستهدفة في قراءات تسلسل NGS ، والتي أظهرت اكتشافًا متزامنًا لـ 14 جينًا مستهدفًا مختلفًا في تفاعل واحد. تم إثبات فعالية نهج mPCR-NGS المطور لاحقًا على مستخلصات الحمض النووي من عينات مياه التيار ونظيراتها التي تم دفعها باستخدام العديد من مسببات الأمراض المستهدفة ، وتم اكتشاف جميع الجينات المستهدفة في عينات المياه البيئية بنجاح. كما تم تحديد ومناقشة العديد من القضايا الرئيسية لزيادة تحسين نهج mPCR-NGS.

هذه معاينة لمحتوى الاشتراك ، والوصول عبر مؤسستك.


أساليب

عينة

تم اختيار المشاركين من قاعدة بيانات مركز أبحاث الصحة العقلية (MHRC) في موسكو. كان هناك 83 مريضا بالفصام من MHRC أو مستشفى الطب النفسي موسكو رقم 1 و 71 من الضوابط الصحية. قدم جميع المشاركين موافقة خطية مستنيرة وتبرعوا بعينات دم لاستخراج الحمض النووي. تم تقييم التدخين من خلال المقابلات الشفوية ، وتم فحص حالة التدخين للمرضى مع الأطباء النفسيين. شارك في هذه الدراسة المدخنون الحاليون والذين لم يدخنوا مطلقًا ، يشار إليهم فيما يلي باسم المدخنين وغير المدخنين ، على التوالي. تكونت العينة من 50 مدخنًا (متوسط ​​العمر 28.0 ± 7.5 سنوات ، 40٪ نساء ، 54٪ مرضى) و 104 من غير المدخنين (متوسط ​​العمر 26.0 ± 5.9 سنة ، 54٪ نساء ، 54٪ مرضى).

استخراج الحمض النووي وتحويل بيسلفيت

تم استخراج الحمض النووي الجيني باستخدام DNeasy Blood and Tissue Kit (Qiagen ، الولايات المتحدة الأمريكية) وفقًا لتعليمات الشركة المصنعة. تم الحصول على عينات الحمض النووي المحولة من بيسلفيت باستخدام مجموعة تعديل DNA EpiGentek Methylamp (Epigentek Group Inc. ، الولايات المتحدة الأمريكية) بالاتفاق مع بروتوكول الشركة المصنعة. لقد دعمنا Yang et al الأصلي. [26] استنتاج مفاده أن هذه المجموعة بالذات عملت بشكل أفضل مع ثنائي سلفيت PCR الطويل مقارنة بمجموعة Epitect Fast DNA Bisulfite Kit (Qiagen ، الولايات المتحدة الأمريكية).

تصميم التمهيدي بيسلفيت

تم تصميم الاشعال باستخدام برنامج primer3 [33] لتضخيم ما يقرب من 1.3 Kbp من منتجات PCR لتسلسلات الجينوم المحولة. تم تصميم البادئات لتكون بطول 25-35 زوج قاعدي ، Tm = 60 درجة مئوية ولا يُسمح باستخدام CpGs. يتم سرد تسلسلات التمهيدي المصممة في الملف الإضافي 1: الجدول S1. تم العثور على المعلومات الموجزة المحيطة أمبليكونس في الجدول 1.

بيسلفيت PCR

بالنسبة لـ PCR ثنائي السلفيت ، استخدمنا 20 نانوغرام من الحمض النووي المحول ، 1 ميكرومتر من "التمهيدي" 5′-phosphorylated التمهيدي "U1" GCAGTCGAACATGTAGCTGACTCAGGTCAC ، 5 نانومتر لكل من التمهيدي المحدد مع تسلسل U1 المتطابق في نهاية 5 ′ و 200 نانومتر dNTP ، 1 مجم / مل BSA ، 2.5 U HotTaq بوليميريز مع المخزن المؤقت المقابل (Sileks ، روسيا) بحجم إجمالي يبلغ 12.5 ميكرولتر. يعد اختيار البوليميراز أمرًا مهمًا - يجب أن يكون البوليميراز عبارة عن بوليميراز بسيط يبدأ على الساخن والذي ، على عكس البوليميرات المتخصصة عالية الدقة ، غير قادر على التغلب على تأثير الكبت. لقد تحققنا بشكل روتيني من حركية تفاعل البوليميراز المتسلسل باستخدام صبغة تقاطع 20 × EVA Green DNA (Biotium Inc. ، الولايات المتحدة الأمريكية) ، والتي على ما يبدو لم تؤثر على التفاعل. كان برنامج PCR على النحو التالي: (1) تمسخ أولي ، 94 درجة مئوية ، 10 دقائق (2) 5 دورات من PCR محدد (94 درجة مئوية ، 20 ثانية 55 درجة مئوية ، 1 دقيقة 64 درجة مئوية ، 4 دقائق) (3) 37 دورة من تفاعل البوليميراز المتسلسل (94 درجة مئوية ، 20 ثانية و 64 درجة مئوية ، 2 دقيقة) و (4) حضانة نهائية ، 64 درجة مئوية ، 10 دقائق.

الباركود

لإنشاء المحولات Y ، استخدمنا 96 توليفة فريدة من مجموعتين من الأوليغنوكليوتيدات: المجموعة الأولى من ثمانية أليغنوكليوتيدات CGAGTAGTGTTC- تسلسل فريد من 5 أحرف- CAAGGCACACAGGGGATAGG ومجموعة ثانية من 12 قليل النوكليوتيدات 5′-CCATCTCATCCCTGCGT5- فريد من نوعه تسلسل الحروف- CTACACTACTCGT. يمكن استخدام مزيج من اثنين من قليل النوكليوتيدات من كلا المجموعتين لإنشاء 96 محولًا فريدًا من النوع Y. كانت oligonucleotides من المجموعة الأولى 5′-phosphorylated. تم العثور على تسلسل قليل النيوكليوتيدات الحاملة للرموز الشريطية الجزيئية في الملف الإضافي 1: الجدول S2. تم تشكيل كل محول Y عن طريق إقران 10 نانومتر من أليغنوكليوتيد واحد من كل مجموعة من هاتين المجموعتين في تفاعل صلب خلال 25 ميكرولتر من المخزن المؤقت للتلدين AB (10 ملي مولار تريس- HCl (درجة الحموضة 8.0) ، 50 ملي كلوريد الصوديوم ، 0.1 ملي مولار EDTA ). تم ضبط تفاعلات التلدين في جهاز التدوير الحراري PCR باستخدام البرنامج التالي: الحضانة 98 درجة مئوية ، تبريد لمدة دقيقة إلى 70 درجة مئوية (1.6 درجة مئوية / ثانية) والتبريد إلى 10 درجة مئوية (0.1 درجة مئوية / ثانية). تم بعد ذلك تخفيف التفاعلات بخمسة أضعاف باستخدام AB ، وتخزينها عند -20 درجة مئوية واستخدامها كمحلول مخزون. مباشرة قبل الربط ، تم تخفيف هذه المخزونات 10 أضعاف مع 1 × T4 ligase عازلة مع 5٪ PEG 4000. تم ضبط تفاعلات الربط في 10 ميكرولتر: 2 ميكرولتر من محلول محولات Y المخفف ، 2 ميكرولتر من منتجات PCR و 6 ميكرولتر من مزيج الربط الرئيسي (1.33 × T4 ligase buffer مع 6.67٪ PEG 4000 ، 1.2 wu T4 DNA ligase ، Thermo ، الولايات المتحدة الأمريكية). تم إجراء تفاعلات الربط عند 20 درجة مئوية لمدة 2.5 ساعة تليها الحضانة عند 65 درجة مئوية لمدة 10 دقائق. بعد ذلك ، تم خلط ردود الفعل في المكتبات (مكتبتان ، حتى 96 عينة لكل مكتبة). تم غسل المكتبات (500 ميكرولتر) مرتين باستخدام 10 ملي مولار من Tris-HCl (درجة الحموضة 8.0) وتركيزها حتى 50 ميكرولتر بواسطة أعمدة جهاز Amicon Ultra-0.5 30K (Merck ، الولايات المتحدة الأمريكية). بعد ذلك ، تم غسل المكتبات مرتين للتخلص من البادئات ، ومحولات Y غير الموصلة ، وما إلى ذلك ، مع 0.7 حجم من حبات مغناطيس AMPure XP (Beckman Coulter Inc. ، الولايات المتحدة الأمريكية). تم استخدام محلول الحمض النووي المنقى لتضخيم المكتبات باستخدام PCR إضافي. تم إجراء PCR باستخدام 250 نانومتر بادئات ، خاصة بنهاية محولات Y: "emPCR_A" 5′-CCATCTCATCCCTGCGTGTC و "emPCR_B" 5′-CCTATCCCCTGTGTGCCTTG مع HiFi HotStart Uracil + 2 × مزيج رئيسي (Kapa South Biosystems ، Republic of Republic of أفريقيا). تم إجراء PCR باستخدام البرنامج التالي: التمسخ الأولي 95 درجة مئوية ، 5 دقائق و 20 دورة: 98 درجة مئوية ، 20 ثانية 60 درجة مئوية ، 15 ثانية و 72 درجة مئوية ، دقيقتان. تم بعد ذلك اختيار منتج تفاعل البوليميراز المتسلسل (PCR) لفترة طويلة من خلال الرحلان الكهربائي للأغاروز وتنقيته باستخدام QIAquick Gel Extraction Kit (Qiagen ، الولايات المتحدة الأمريكية).

إعداد وتسلسل مكتبة CCS

تم إجراء إعداد مكتبة CCS (ربط محولات "SMRTBell" مع SMRTbell Template Prep Kit ، Pacbio ، الولايات المتحدة الأمريكية) والتسلسل باستخدام Pacbio RSII (كيمياء P6 / C4) في منشأة خدمات التسلسل في جامعة واشنطن Pacbio. الحجم النهائي للبيانات الخام المستخدمة في هذه الورقة يساوي تقريبًا خلية SMRT واحدة لجهاز Pacbio RSII.

إعداد البيانات بعد التسلسل

تم استخدام القراءات التي حصلت على نقاط جودة لا تقل عن Q30 (متوسط ​​نقاط الجودة Q40) في التحليل التالي. بعد قطع المهايئ ، حصلنا على 56581 قراءة مع المحولات الصحيحة وتسلسلات التمهيدي. تم فك تعدد القراءات مع عدم السماح بأية أخطاء في تسلسل الباركود ، وتجاهل 11٪ من القراءات. كان متوسط ​​عدد القراءات لكل رمز شريطي 202 (Q1: 128 ، Q3: 315). تم إجراء تشذيب المحول وإزالة تعدد إرسال الباركود باستخدام برنامج cutadapt [34]. تم الحصول على محاذاة القراءات المفلترة مع الجينوم البشري المرجعي (hg19) باستخدام برنامج bismark بكفاءة تخطيط 88٪ [35] (مع ربطة القوس 2 [36]). تم إجراء ترشيح الحمض النووي غير المحول (عتبة CpH & lt 5 ٪ ، H = A / C / T) وإزالة الازدواج باستخدام البرنامج النصي perl (انظر الملف الإضافي 1: الملاحظة التكميلية 2 حول إجراء إزالة الازدواجية). كان معدل التحويل النهائي لا يقل عن 0.98 لكل هدف من الأهداف التي تم تحليلها. يتم عرض عدد القراءات لكل هدف مع المراحل المختلفة لإعداد البيانات في ملف إضافي 1: الجدول S5.

بيانات ASM

تم فرز كل قراءة في البيانات (ملفات بتنسيق SAM) باستخدام برنامج نصي بيرل استنادًا إلى تحليل سلسلة CIGAR بواسطة أليلات من الأشكال المتعددة التي يمكن التعرف عليها بسهولة في كل هدف. يتم عرض قائمة الأشكال المتعددة المستخدمة في ملف إضافي 1: الجدول S3. تم تحديد معدل مثيلة CpGs الفردية لكل نمط فرداني لكل عينة بواسطة برنامج bismark. تم استخدام العينات ذات الحد الأدنى من عمق القراءة 5 × لكل نمط فرداني ، مما أدى إلى التخلص من CACNA1D الهدف بسبب عدم كفاية كميات البيانات. القيم المفقودة تعني احتسابها. لم يتم استخدام إشارات المثيلة في مواقع CpG-SNPs المعروفة في التحليل التالي. تم تحويل معدل المثيلة لكل من CpGs وفقًا للمعادلة: (M = log left (^ < hbox <'>> / 1-^ < hbox <'>> right) ) ( ^ < hbox <'>> = left (m left (n-1 right) +0.5 right) / n ) ، حيث م هو معدل المثيلة الخام ، ن هو حجم العينة.

تحليل احصائي

تم اختبار ثلاثة نماذج تنبؤية لحالة التدخين على مجموعة بيانات ASM المعدة ، المشار إليها فيما يلي باسم "index" و "boruta" و "boruta.adjusted". تم تراجع العمر والجنس والتشخيص للتحليل اللاحق. تم استخدام بقايا الانحدار للتحليل اللاحق. بالنسبة لنموذج "boruta.adjusted" ، تم استخدام معلومات النمط الفرداني أيضًا. تم استخدام خوارزمية Boruta لتحديد CpGs الهامة ("الهامة" بمعنى خوارزمية Boruta) داخل كل من الأهداف لنماذج "boruta" و "boruta.adjusted". تم اختيار CpGs الأصلية من EWAS للتدخين لنموذج "الفهرس" (الجدول 1). تم تقسيم مجموعة البيانات بشكل عشوائي 1: 1 في مجموعة القطار والاختبار. تم تدريب النموذج اللوجستي مع CpGs المختارة على مجموعة القطار. تم بناء النموذج اللوجستي المشترك للتنبؤ على قمة قيم التنبؤ لنماذج الهدف الفردية. في حالة العينات غير المتجانسة ، تم حساب متوسط ​​قيم التنبؤ. تم تقييم أداء النماذج المدمجة في مجموعة الاختبار. تم إجراء التحليل باستخدام البرنامج الإحصائي R مع حزمة "Boruta" [37].


نتائج

اختبار تسلسل تعدد الإرسال PCR و Nanopore على المواد المرجعية للحمض النووي الريبي

تم إنشاء Amplicons من عينات DENV RNA الأربعة باستخدام نهج PCR متعدد الإرسال وتسلسلها على Nanopore MinION. أنتج تشغيل التسلسل 8604-16654 قراءة لكل عينة اجتياز مرشحات الجودة (درجة Q ≥ 7) (الجدول 1).

أظهرت محاذاة القراءات مع جينوم RefSeq المناسب أن التغطية الكاملة لمنطقة الترميز قد تحققت لجميع الأنماط المصلية الأربعة (الجدول 2). كانت تسلسلات الإجماع الناتجة متطابقة في المتوسط ​​بنسبة 99.49 ٪ لتسلسلات الإجماع الناتجة عن Illumina والمستخدمة كمراجع.

ومع ذلك ، كان عمق تغطية التسلسل غير متساوٍ ، حيث تمت تغطية 87.56-96.51٪ فقط من جينومات DENV1–4 بـ 20 قراءة أو أكثر. تزامنت هذه المناطق ذات التغطية المنخفضة مع انخفاض في دقة تسلسل الإجماع (الشكل 1). أدى إخفاء مناطق الجينوم ذات عمق التغطية الأقل من 20X إلى تحسين الدقة الإجمالية لتسلسل الإجماع في 3/4 حالات ، مما زاد متوسط ​​هوية الإجماع إلى 99.78٪. ومع ذلك ، أدى إخفاء هذه المناطق أيضًا إلى فقدان تغطية الجينوم ( ( overline ) = 9.01٪) (الجدول 2).

تغطية التسلسل النانوي لعينات الحمض النووي الريبي للتحكم في DENV ، باستخدام نهج تعدد الإرسال (400 نقطة أساس أمبليكون). يتم رسم عمق تغطية تسلسل النانو لعينات الحمض النووي الريبي للتحكم في فيروس حمى الضنك ، باستخدام نهج تعدد الإرسال PCR باللون الأسود مقابل المحور الصادي الأيسر ، مع حد عمق القراءة البالغ 20X المشار إليه بالخط المنقط. عمق التغطية محدد بحد أقصى 1000X. يظهر تشابه النوكليوتيدات للتسلسل الناتج عن Nanopore مع التسلسل المرجعي الذي تم إنشاؤه بواسطة Illumina باللون الأحمر مقابل المحور y الأيمن. تحدد المناطق المظللة المناطق التي انخفض فيها عمق التغطية عن عتبة التغطية المنخفضة البالغة 20X ، للسماح بالمقارنة مع مخطط التشابه

تم استخدام Nanopore MinION أيضًا لتسلسل الأمبليكونات التي تم إنشاؤها باستخدام نهج PCR أحادي plex. أنتجت القراءات الناتجة تسلسلات إجماع 99.93-99.99٪ مطابقة لمراجع Illumina ( ( overline ) = 99.97٪) ، وتحتوي على متوسط ​​4 حالات عدم تطابق (النطاق = 1-7) (الجدول 3). كانت متواليات الإجماع هذه في المتوسط ​​أكثر دقة بنسبة 0.48٪ من نظيراتها المتولدة من تعدد الإرسال.

الاختبار على العينات الإكلينيكية الإندونيسية

تم اختبار نهج تعدد إرسال تفاعل البوليميراز المتسلسل بعد ذلك على مجموعة من العينات السريرية من إندونيسيا (ن = 10). تضمنت هذه العينات ممثلين عن كل من الأنماط المصلية الأربعة لـ DENV عبر مجموعة من الأحمال الفيروسية (قيم Ct 15.2 - 37.9). أنتجت جميع العينات منتجات PCR بالحجم المتوقع (

400 نقطة أساس) وتم تسلسل الأمبليكون الناتج على Nanopore MinION ، مما أدى إلى إنتاج 33908-882891 قراءة ( ( overline= mathrm <57،948> كبير) ).

كان متوسط ​​تغطية منطقة الترميز عند عمق قراءة 1X 99.80٪ عبر العينات العشر (الجدول 4) ، وتم تحقيق تغطية كاملة لثمانية من 10. عند عمق قراءة 20X ، انخفض متوسط ​​التغطية إلى 95.84٪. كان الانخفاض في التغطية التي تقل عن 20X أكثر تواترًا في العينات ذات القيم Ct الأعلى (الشكل 2). تلك التي لها قيمة قيراط بقيمة 25 أو أقل (ن = 3) أنتجت تغطية بنسبة 100٪ في المتوسط. انخفض متوسط ​​التغطية إلى 98.55٪ للعينات ذات القيمة Ct بين 25 و 30 (ن = 4) ، وتم تخفيضه إلى 88.06٪ لمن لديهم قيم Ct أكبر من 30 (ن = 3).

تغطية التسلسل النانوي للعزلات الإندونيسية السريرية باستخدام منهج Multiplex PCR. تم استخدام نهج تعدد إرسال تفاعل البوليميراز المتسلسل لتضخيم DENV1-4 من 10 عينات سريرية من إندونيسيا. تم اختيار هذه العينات لتغطية مجموعة من الأحمال الفيروسية ، وفقًا لتقدير قيم Ct من qRT-PCR التشخيصي. تم تسلسل الأمبليكون الناتج على Nanopore MinION. يتم رسم عمق التغطية لكل عينة ، مع الإشارة إلى حد عمق القراءة البالغ 20X بالخط المنقط. عمق التغطية محدد بحد أقصى 1000X

تم أيضًا تضخيم نفس العينات العشر باستخدام نهج PCR أحادي plex كمقارنة (الجدول 4). في المتوسط ​​، أنتج النهج 2.6 فقط من 5 أمبليكونات المطلوبة لتغطية منطقة تشفير DENV. كما هو الحال مع نهج تعدد الإرسال ، كانت العينات ذات أقل قيم Ct (& lt 20) هي الأكثر نجاحًا ، حيث أنتجت 93 ٪ من الأمبليكون (14/15) ، في حين أن العينات التي تحتوي على قيم Ct أكبر من 25 أنتجت 34 ٪ فقط (12/35).

الاختبار على عينات سريرية غير إندونيسية

تم تطبيق طريقة الإرسال المتعدد بعد ذلك على أربع عينات سريرية من مرضى مصابين بـ DENV من الفلبين ، من أجل اختبار كيفية أداء الطريقة عند العمل مع سلالات فيروسية من دول خارج إندونيسيا. أنتجت جميع العينات منتجات PCR بالحجم المتوقع (

400 نقطة أساس) وتم تسلسل الأمبليكون الناتج على Nanopore MinION ، مما أدى إلى إنتاج 6852-12972 قراءة ( ( overline= mathrm <8،048> كبير) ).

كان متوسط ​​تغطية منطقة التشفير عند عمق قراءة 1X 99.90 ٪ عبر العينات الأربع (الجدول 5). عند عمق قراءة يبلغ 20 ضعفًا ، انخفض متوسط ​​التغطية إلى 88.40٪. أنتج DENV-1 العديد من القطرات الكبيرة بشكل خاص في عمق التغطية مقارنة بالعزلات الأخرى (الشكل 3) ، مما أدى إلى تغطية 79.22٪ فقط من منطقة التشفير بعمق قراءة 20X. تم إنشاء تسلسلات الإجماع مرة أخرى ومقارنتها بالتسلسلات المرجعية التي تم إنشاؤها بواسطة Illumina عن طريق المحاذاة الزوجية للنيوكليوتيدات (الجدول 5). تم العثور على تسلسل الإجماع الذي تم إنتاجه باستخدام جميع المناطق التي تمت تغطيتها بواسطة قراءة واحدة أو أكثر لتكون 99.17-99.80٪ متطابقة مع التسلسل الناتج عن Illumina ( ( overline= 99.45 ٪ كبير) ). إخفاء المناطق بعمق قراءة أقل من 20X يحسن دقة تسلسل الإجماع إلى 99.70-99.92٪ ( ( overline= 99.80 ٪ كبير) ) على حساب التغطية.

تغطية تسلسل Nanopore للعزلات السريرية Pilipino باستخدام منهج Multiplex PCR. تم استخدام نهج تعدد إرسال تفاعل البوليميراز المتسلسل لتضخيم DENV1-4 من 4 عينات سريرية من الفلبين. تم تسلسل الأمبليكون الناتج على Nanopore MinION. يتم رسم عمق التغطية لكل عينة ، مع حد عمق القراءة البالغ 20X المشار إليه بالخط المنقط. عمق التغطية محدد بحد أقصى 250X

تم استخدام نهج PCR أحادي plex مرة أخرى لإنتاج المنتج المضخم لتسلسل Illumina ، ومع ذلك فشلت 3 من العينات الأربعة في إنشاء أحد المنتجات المتوقعة (الجدول 5). وبالتالي تم تحقيق التغطية الكاملة لـ DENV-1 و 2 من خلال استبدال مجموعات التمهيدي المنشورة بأجهزة أولية مأخوذة من مجموعة الإرسال المتعدد. بعد عدة محاولات ، يمكن فقط إنتاج نسخة مبتورة من أكثر 3-DENV-4 amplicon ، وبالتالي يمكن تقييم دقة الإجماع الناتج عن Nanopore لـ 10117 من 10163 من قواعد الترميز فقط.

تقييم متواليات الإجماع الناتجة عن Nanopore عن طريق تحليل النشوء والتطور

تم إنشاء سلالات التطور باستخدام متواليات منطقة الترميز التي تم إنشاؤها بواسطة Nanopore و Illumina ومجموعة من التسلسلات المرجعية لكل نمط مصلي DENV. شيدت سلالات منفصلة باستخدام متواليات توافق الآراء Nanopore مقنعة تحت عمق تغطية 20x (الشكل 4) وأعماق تغطية 1x (الشكل 5). تم إنشاء متواليات إجماع Nanopore من عمق 20 × جميع المجموعات أحادية اللون مع نظيراتها المولدة من Illumina. شكلت التسلسلات المولدة من Nanopore لـ DENV-1-3 عند عمق 1x أيضًا كتل أحادية النواة مع نظيراتها المولدة من Illumina ، ومع ذلك تم فصل تسلسل DENV4 عن نظيره من Illumina بواسطة GQ868594 ، وهو تسلسل تم إنشاؤه من نفس العزلة الفيروسية. بلغ متوسط ​​المسافة التطورية الزوجية بين تلميحات التسلسل المولدة من Nanopore و Illumina 0.001975 لتلك التي تم إنشاؤها باستخدام مناطق تغطية & gt20X ، و 0.005685 لتلك التي تم إنشاؤها باستخدام تغطية 1X (الجدول 6).

التحليل الوراثي لتسلسلات الإجماع الناتجة عن Illumina- و Nanopore. تم إنشاء سلالات Bootstrap لمناطق ترميز DENV الكاملة باستخدام متواليات توافق Nanopore و Illumina ومجموعة مختارة من التسلسلات المرجعية للنمط الجيني. تم إنشاء تسلسل إجماع Nanopore لجميع العينات باستخدام نهج amplicon القصير ، مع إخفاء المناطق التي تقل عن عمق تغطية 20X. تم إنشاء تسلسل إجماع Illumina لمعايير RNA وعينات Pilipino باستخدام نهج amplicon الطويل. يتم تلوين أسماء التسلسلات للإشارة إلى الأصل الجغرافي ، ويتم تلوين العقد الداخلية للشجرة لإظهار قيم التمهيد (الأزرق = 100٪ ، والأخضر = 90-99٪ والأحمر = & lt 90٪). يتم تسليط الضوء على clades Monophyletic المكونة من متواليات توافق الآراء المتولدة من Nanopore و Illumina باللون الأصفر لعينات RNA القياسية ، والأحمر للعينات السريرية Pilipino

ولَّد التحليل الوراثي لتسلسل توافق الآراء المتولدة عن نانوبور (1x) و Illumina. تم إنشاء سلالات التمهيد لمناطق ترميز DENV الكاملة باستخدام متواليات توافق الآراء Nanopore و Illumina ومجموعة مختارة من التسلسلات المرجعية للنمط الجيني. تم إنشاء تسلسل إجماع Nanopore لجميع العينات باستخدام نهج amplicon القصير مع مناطق فقط أقل من عمق تغطية 1X مقنعة. تم إنشاء تسلسل إجماع Illumina لمعايير RNA وعينات Pilipino باستخدام نهج amplicon الطويل. يتم تلوين أسماء التسلسلات للإشارة إلى الأصل الجغرافي ، ويتم تلوين العقد الداخلية للشجرة لإظهار قيم التمهيد (الأزرق = 100٪ ، والأخضر = 90-99٪ والأحمر = & lt 90٪). يتم تمييز التكوينات المتكونة من متواليات الإجماع الناتجة عن Nanopore و Illumina باللون الأصفر للعينات المرجعية ، والأحمر بالنسبة لعينات Pilipino

شكلت التسلسلات من العينات الإندونيسية كليدًا متميزًا تحتوي على غالبية التسلسلات المرجعية من إندونيسيا (ملصقات خضراء). كانت الكتل الإندونيسية لـ DENV-3 و DENV-4 مؤلفة حصريًا من متواليات إندونيسية ، بينما احتوى كليد DENV-1 الإندونيسي أيضًا على تسلسل واحد من البلد المجاور لسنغافورة (FJ469907). تضمن كليد DENV-2 الإندونيسي تسلسلات من عدة دول مجاورة في جنوب شرق آسيا بما في ذلك بروناي (EU179859) وسنغافورة (EU081177 و EU081179 و EU081180 و KM279597) والفلبين (110394). تم تجميع تسلسل الإجماع الإندونيسي أيضًا حسب المنطقة كلما تم تضمين عينات متعددة من نفس المنطقة من إندونيسيا. تم تجميع عينات DENV-1 و DENV-3 من Banjarmasin (BJM) في وسط إندونيسيا ، بينما تم تجميع عينات من Batam (BTM) في الغرب ، و Ambon (AMB) في الشرق ، بشكل منفصل.


التقاط قالب الفحص عن طريق تعدد الإرسال PCR للأمبليكونات الطويلة للتنميط الجيني SNPs و InDels باستخدام مطياف الكتلة MALDI-TOF

قد يؤدي التهيئة الخاطئة المرتبطة بتعدد أشكال النوكليوتيدات المفردة غير المميزة (SNPs) إلى فشل PCR في التنميط الجيني. هذا أمر مزعج بشكل خاص في تطبيقات التنميط الجيني SNP عالية الإنتاجية التي تعتمد على تعدد الإرسال PCR (2–40-plex) التي تولد العديد من الأمبليكونات القصيرة (80-120 نقطة أساس) ذات الحجم المماثل ، وهو الأسلوب الأنسب لعمليات مسح الجينوم الكامل. ومع ذلك ، إذا تم تجميع SNPs المستهدفة داخل عدد قليل من الجينات المستهدفة ، فإن أحد الخيارات لتحسين ذلك هو زيادة طول amplicon ، مما يقلل بشكل فعال من إمكانية تفاعلات التمهيدي / القالب والتهيئة الخاطئة. اختبرنا هذا النهج في مجموعة متنوعة من 372 أوكالبتوس بيلولاريس الأفراد (π = 8.11 × 10 −3 ، ح ه = 0.75) باستخدام مقايسة الذهب Sequenom iPLEX المعدلة. تم تضخيم أربعة جينات مرشحة (MYB1 و MYB2 و CAD و CCR) في التقاط PCR واحد طويل المدى متعدد الإرسال ، مما أدى إلى توليد 6 أمبليكونات طويلة تتراوح في الحجم من 907 إلى 2225 زوجًا أساسًا. هذا يتناقض مع النهج القياسي الذي كان سيتطلب تضخيم 98 أمبليكون قصير في 4 تفاعلات متعددة الإرسال. قدمت هذه الأمبليكونات الستة الطويلة قالب الفحص لـ 98 اختبارًا (87 SNP و 11 InDel) ضمن الجينات الأربعة المرشحة. أشارت نتائج التفاعل إلى أن الأمبليكونات الأطول يمكن أن توفر نموذجًا مناسبًا لفحوصات التنميط الجيني ، مع 90.8٪ من المقايسات وظيفية و 84.3٪ من المقايسات مناسبة لتحليل المصب. كانت المزايا الإضافية لهذا النهج هي القدرة على استكشاف الأخطاء وإصلاحها باستخدام الرحلان الكهربائي للهلام وتوفير 94 ٪ في تكاليف توليف التمهيدي. سيكون لهذا النهج أكبر أهمية لنهج الجينات المرشحة لاختبار الارتباط في مجموعات غير مميزة من الكائنات الحية ذات تنوع التسلسل العالي.

هذه معاينة لمحتوى الاشتراك ، والوصول عبر مؤسستك.


مقدمة

تم استخدام تسلسل الجينوم للفيروسات لدراسة انتشار المرض في حالات تفشي المرض 1. تعد المراقبة الجينية في الوقت الفعلي مهمة في إدارة تفشي الفيروسات ، حيث يمكنها توفير رؤى حول كيفية انتقال الفيروسات وانتشارها وتطورها 1،2،3،4. يعتمد هذا العمل على التسلسل السريع للمادة الفيروسية مباشرة من العينات السريرية - أي دون الحاجة إلى عزل الفيروس في مزرعة نقية. خلال وباء فيروس الإيبولا في 2013-2016 ، كان تسلسل الجينوم الفيروسي المحتمل قادرًا على توفير معلومات مهمة عن تطور الفيروس والمساعدة في التحقيقات الوبائية 3،4،5،6. يعتبر التسلسل مباشرة من العينات السريرية أسرع وأقل مجهودًا وأكثر قابلية للعمل بالقرب من المريض من الأساليب المستندة إلى الثقافة التي تستغرق وقتًا طويلاً. تم تطبيق Metagenomics ، عملية تسلسل إجمالي محتوى الحمض النووي في عينة (عادةً cDNA أو DNA) ، بنجاح على كل من اكتشاف الفيروسات والتشخيصات 7،8،9. شهدت مناهج Metagenomic اعتمادًا سريعًا على مدار العقد الماضي ، مدعومًا بتحسينات لا هوادة فيها في عائد أدوات التسلسل عالية الإنتاجية 5،10،11،12. كان تسلسل الجينوم الكامل لفيروس الإيبولا مباشرة من العينات السريرية دون تضخيم ممكنًا بسبب أعداد نسخ الفيروس العالية للغاية الموجودة في الحالات الحادة 13 ، 14 ، 15. ومع ذلك ، فإن التسلسل الميتاجينومي المباشر من العينات السريرية يطرح تحديات فيما يتعلق بالحساسية: قد تكون تغطية الجينوم منخفضة أو غائبة عند محاولة تسلسل الفيروسات الموجودة بكثرة منخفضة في عينة ذات مستويات عالية من خلفية الحمض النووي المضيف.

تطوير البروتوكول

خلال العمل الأخير على وباء فيروس زيكا 16 ، وجدنا أنه من الصعب إنشاء تسلسل الجينوم الكامل مباشرة من العينات السريرية باستخدام الأساليب الميتاجينومية (الجدول 1). كان لهذه العينات قيم عتبة الدورة (Ct) بين 33.9 و 35.9 (ما يعادل 10-48 نسخة جينوم لكل ميكروليتر). قبل التسلسل ، تم استنفاد هذه العينات من الرنا الريباسي البشري وتم تحضيرها للتسلسل الميتاجينومي على منصة Illumina MiSeq كما هو موضح سابقًا 2،17. في هذه الحالات ، شكلت التسلسلات من فيروس زيكا & lt0.01٪ من مجموعة البيانات ، مما أدى إلى تغطية غير كاملة. تعد التغطية والعمق الأكبر أمرًا بالغ الأهمية لإعادة بناء الجينوم الدقيق والاستدلال النشئي اللاحق. بالإضافة إلى ذلك ، هناك تكاليف كبيرة للتسلسل والتحليل والتخزين مرتبطة بتوليد مجموعات كبيرة من بيانات التسلسل ، وبالتالي ، فإن الأساليب الميتاجينومية حاليًا لا تصلح للاستخدام الفعال من حيث التكلفة لأجهزة التسلسل المحمولة منخفضة الإنتاجية مثل Oxford Nanopore MinION.

لتوليد تغطية كاملة للجينوم الفيروسي من العينات السريرية بطريقة اقتصادية ، غالبًا ما يكون التخصيب المستهدف مطلوبًا 18. يمكن تحقيق التخصيب بشكل مباشر من خلال العزل في المزرعة أو استخدام مجسات الطعم قليل النوكليوتيد التي تستهدف الفيروس المعني ، أو بشكل غير مباشر عن طريق استنفاد الحمض النووي للمضيف. قد يكون التضخيم مطلوبًا أيضًا لتوليد مادة كافية للتسلسل (& gt5 ng لبروتوكولات Illumina النموذجية و 100-1000 نانوغرام لـ MinION). يمكن أن يوفر PCR كلاً من التخصيب والتضخيم المستهدفين في خطوة واحدة ، وهو رخيص نسبيًا ومتوفر وسريع مقارنة بالطرق الأخرى. لإنشاء تغطية كاملة لتسلسل الترميز ، يتم استخدام مخطط amplicon التبليط بشكل شائع 19،20،21. خلال عملنا مع فيروس الإيبولا ، تمكنا من استرداد 95٪ من الجينوم بشكل موثوق به عن طريق تسلسل 11 أمبليكونًا طويلًا (طولها من 1 إلى 2.5 كيلو بايت) على جهاز MinION 5.

ومع ذلك ، فإن احتمال وجود شظايا طويلة في العينة يقل مع انخفاض وفرة الفيروس. لذلك ، توقعنا أنه بالنسبة لفيروسات مثل زيكا الموجودة بكثرة منخفضة في العينات السريرية ، فمن المرجح أن نقوم بتضخيم شظايا أقصر. كمثال متطرف لهذا النهج ، تم استخدام نهج حديث يسمى "ثقب الصخور" لتضخيم عينات HIV-1 المتدهورة المخزنة لمدة 40 عامًا ، استخدم هذا النهج 200-300 nt amplicons للمساعدة في تعظيم استعادة التسلسل 22. يتطلب استخدام أمبليكون أقصر عددًا أكبر من المنتجات لإنشاء مسار تبليط عبر الجينوم المستهدف. يتطلب القيام بذلك في التفاعلات الفردية عددًا كبيرًا من خطوات سحب العينات اليدوية ، وبالتالي يزيد من احتمالية حدوث أخطاء ، مع زيادة مخاطر التلوث المتبادل ، فضلاً عن تكلفة أكبر في الوقت والمواد الاستهلاكية. لحل هذه المشكلات ، صممنا اختبارًا متعدد الإرسال لإجراء عشرات التفاعلات في أنبوب فردي. تم استخدام هذه الطريقة لاحقًا لإجراء تسلسل زيكا من أجل فهم انتشار فيروس زيكا في الأمريكتين. يسمح بروتوكولنا الناتج خطوة بخطوة ، الموصوف هنا ، لأي باحث بتضخيم وتسلسل الفيروسات ذات الوفرة المنخفضة بنجاح مباشرة من العينات السريرية. لهذه الطريقة أيضًا استخدامات محتملة أخرى غير موضحة هنا. أحد التطبيقات المحتملة هو أساليب الكتابة التسلسلية متعددة البؤرة ، والتي يمكن تنفيذها عن طريق تضخيم الجينات المحفوظة من البكتيريا والفطريات والخمائر. في نفس الوقت ، يمكن أيضًا استهداف الجينات المحددة لمقاومة المضادات الحيوية أو جينات الفوعة الرئيسية في نفس الاختبار. يمكن أيضًا استخدام المخطط لتسلسل جينومات البلاستيدات الخضراء والميتوكوندريا.

مقارنة مع الأساليب الأخرى

الأساليب الثلاثة الأكثر شيوعًا لتسلسل الفيروسات هي التسلسل الميتاجينومي ، وتسلسل أمبليكون PCR وتسلسل التخصيب المستهدف ، والذي تمت مراجعته مؤخرًا بالتفصيل بواسطة Houldcroft وآخرون. 27. الفوائد الرئيسية للنهج القائم على PCR الموصوفة هنا هي التكلفة والحساسية. من الناحية النظرية ، يتطلب كل من تفاعل البوليميراز المتسلسل (PCR) وثقافة الخلية نسخة فيروسية واحدة فقط ، مما يجعلها حساسة بشكل رائع. ومع ذلك ، من الناحية العملية ، لا تسمح ظروف التفاعل بتضخيم الجينوم الفردي ، وعادةً ما تكون جزيئات البداية المتعددة مطلوبة. يتمتع PCR أيضًا بحساسية محدودة في الحالات التي يكون فيها تسلسل القالب متشعبًا عن المتوقع بسبب حركيات الربط التمهيدي. ومع ذلك ، في حالة الفاشية التي ترتبط فيها العزلات ارتباطًا وثيقًا ، وتتطلب تكلفة منخفضة لكل عينة ووقت تسليم سريع ، يكون تفاعل البوليميراز المتسلسل مناسبًا بشكل خاص. يعد التسلسل أمبليكونس على أكسفورد نانوبور مينيون طريقة شائعة لتحديد الجينوم الفيروسي وقد تم استخدامه لفيروسات متنوعة ، بما في ذلك الإيبولا والإنفلونزا وفيروس الجدري ، باستخدام إما تفاعلات زوجية أولية تولد أمبليكون طويلة (& gt1 كيلو بايت) أو تفاعلات متعددة تم تجميعها من قبل sequencing 5,28,29,30 . However, these approaches are laborious to scale up when many small amplicons are required (because of low viral copy numbers), or when multiple samples are sequenced on a single sequencing run, as in this protocol.

The most similar alternative approach to the one described here is AmpliSeq (Life Technologies), which was previously used for Ebola sequencing on the Ion Torrent PGM 6 . However, this method is specific to the Ion Torrent platform, and primer schemes must be ordered directly from the manufacturer thus, it may consequently be more expensive per sample. Alternative software packages for designing primer schemes are available, some of which cater specifically to multiplex or tiling amplicon schemes 20,21,31,32 , and these may perform better when dealing with divergent genomes because of an increased emphasis on oligonucleotide degeneracy. Primers generated with such software may also be compatible with this protocol, although PCR conditions may require optimization, as the Primal Scheme software used in this protocol is designed with an emphasis on monitoring short-term evolution of known lineages, and primer conditions have been optimized for multiplex PCR amplification efficiency.

Propagation in cell culture is another method that has been widely used for virus enrichment 33,34,35 . This process is time-consuming, and requires specialist expertise and high containment laboratories for especially dangerous pathogens. There is also concern that viral passage can introduce mutations that are not present in the original clinical sample, potentially confounding analysis 36,37 .

Oligonucleotide bait probes have also shown promise as an alternative to metagenomics and amplicon sequencing 38,39,40,41,42 . These isolate viral nucleic acid sequences by hybridizing target-specific biotinylated probes to the DNA/RNA sample and then separating them using magnetic streptavidin-coated beads. Such methods, however, are limited by the efficiency of the capture step because of the kinetics of nucleic acid hybridization in complex samples such as those containing the human genome. The complete hybridization of all probes to targets can take hours (typical protocols suggest a 24-h incubation, although shorter times may be possible) and may never be achieved because of competitive binding by the host DNA. These methods suffer from a coverage bias, which worsens at lower viral abundances, resulting in increasingly incomplete genomes, as demonstrated by recent work on the Zika virus 43 . They work best on samples with higher viral abundances and may not have the sensitivity to generate near-complete genomes for the majority of isolates in an outbreak. Probes for hybridization capture are also more expensive than PCR primers because they are usually designed in a fully overlapping 75-nt scheme, which can run to hundreds of probes per virus and thousands for panels of viruses.

Direct sequencing of RNA has been recently demonstrated on the Oxford Nanopore MinION 44,45 . This method is attractive because it eliminates the need for reverse transcription, and so potentially may reduce biases resulting from nonrandom priming and copying errors introduced by reverse transcriptase. However, this method currently requires 500 ng of RNA as starting material and would suffer from the same sensitivity issues associated with cDNA metagenomics approaches when applied to samples containing very low viral copy numbers.

Limitations of tiling amplicon sequencing

Our method is not suitable for the discovery of new viruses or for sequencing highly diverse or recombinant viruses because primer schemes are virus-genome-specific. This protocol has not been validated for discovery of intra-host nucleotide variants, and we expect that minor allele frequencies will not be reliably recovered when amplifying from very small amounts of starting virus, as shown by Metsky وآخرون. 25. We expect that this method will work for larger virus genomes, but we have not tested this protocol with viral genomes longer than 12 kb. The protocol is designed for infections resulting from single clones, and may not perform well with mixed infections of diverse viruses. We have not tested performance of the method in chronic infections in which large amounts of diversity may have evolved within a patient (for example, viral quasispecies during HIV infection). Amplicon sequencing is prone to coverage dropouts that may result in incomplete genome coverage, especially at lower abundances, and the loss of both 5′ and 3′ regions that fall in regions not covered by primer pairs. Sequencing of complete 5′- and 3′-UTR regions may require alternative techniques such as RACE 46 . Targeted methods are also highly sensitive to amplicon contamination from previous experiments. Extreme caution should be taken to keep pre-PCR areas, reagents and equipment free of contaminating amplicons.

تصميم تجريبي

Description of the protocol. We describe a fully integrated end-to-end protocol for rapid sequencing of viral genomes directly from clinical samples. The protocol proceeds in four stages: (i) multiplex primer pool design, (ii) multiplex PCR, (iii) sequencing on MinION or Illumina instruments and (iv) bioinformatic analysis and quality control (QC) (Fig. 1).

Workflow for tiling amplicon sequencing on MinION/Illumina platforms, with associated Procedure step numbers indicated.

Primer design. We developed a web-based primer design tool called Primal Scheme (http://primal.zibraproject.org), which provides a complete pipeline for the development of efficient multiplex primer schemes. Each scheme is a set of oligonucleotide primer pairs that generate overlapping products, the size of which is determined by the target genome length, amplicon length and overlap required, as discussed below. For Zika, we use 35 primer pairs, amplifying products of ∼ 400-nt length with a 100-nt overlap for the ∼ 11-kb viral genome. Together, the amplicons generated by the pairs span the target genome or region of interest (Fig. 2).

(أ) Submission box for online primer design tool. (ب) Primer table of results. (ج) Schematic showing expected amplicon products for each pool in genomic context for the ZikaAsian and ChikAsianECSA schemes.

As input, Primal Scheme requires a FASTA file containing one or more reference genomes. The user specifies a desired PCR amplicon length (default = 400 nt, suggested values between 200 and 2,000 nt) and the desired length of overlap between neighboring amplicons (default = 75 nt). Using a shorter amplicon length may be useful for samples in which longer products fail to amplify (e.g., when the virus nucleic acid is highly degraded). However, if amplicon lengths become too short (e.g., <300 nt), it may not be possible to find suitable primer pairs reducing the overlap parameter may help with this.

The Primal Scheme software performs the following processes:

Generation of candidate primers: The first sequence listed in the FASTA file should be the most representative genome, with further sequences spanning the expected interhost diversity. Primal Scheme uses the Primer3 software to generate candidate primer pairs (five, by default) 47 . It selects primers based on thermodynamic modeling, which takes into account length, annealing temperature, %GC, 3′ stability, estimated secondary structure and likelihood of primer–dimer formation, maximizing the chance of a successful PCR reaction. Primers are designed with a high annealing temperature within a narrow range (65–68 °C) that allows PCR to be performed as a 2-step protocol (95 °C denaturation, 65 °C combined annealing and extension) for highly specific amplification from clinical samples without the need for nested primers.

Testing of candidate primers: Subsequent reference genomes in the file are used to help choose primer pairs that maximize the likelihood of successful amplification of known virus diversity. A semi-global alignment score between each candidate primer and all supplied references is calculated to ensure that the most 'universal' candidate primers are picked for the scheme. Mismatches at the 3′ end are severely penalized, as they have a disproportionate effect on the likelihood of successful extension 48,49 . The alignment scores are summed, and the single best-scoring pair for each region is selected. If no candidates are returned by Primer3 for a region, most likely because all primers had insufficient annealing temperature, an error message prompting you to adjust the amplicon length or the overlap parameter will appear.

Output of primer pairs: Output files include a table of primer sequences to be ordered, a BED file of primer locations that can be used subsequently for primer trimming and a diagram of the primer scheme.

Choice of amplicon length. The choice of amplicon length when designing primer pools for sequencing is important. There is an inverse relationship between amplicon length and the number of primer pairs. It is believed that increasing the number of primer pairs reduces the likelihood of successful amplification of each region, owing to interaction between primers 18 . It is plausible that as the number of primer pairs increases, competitive inhibition may decrease PCR efficiency, although the high annealing temperature used in this protocol should reduce this risk. Longer amplicons are preferred, as they mean fewer primer pairs are needed per reaction. They also increase the amount of linkage information that can be recovered as haplotypes, which is of importance for investigation of within-host diversity. On the Illumina platform, 600 bases is the maximum size of amplicon that can be obtained using this protocol without an additional fragmentation step (using 600 cycle kits in paired-end mode—i.e., paired 300 nucleotides without any overlap), although read accuracy may degrade during the last 50 cycles. On the Oxford Nanopore MinION, there is no limit to the maximum amplicon length that can be sequenced the maximum length is effectively limited by the performance of the reverse transcription and PCR (practically to ∼ 5 kb). However, longer amplicons are less likely to amplify successfully when viral copy number is low or there is sample degradation (e.g., because of inadequate storage).

Optimization of primer schemes. The majority of primers are expected to work even when pooled in equimolar amounts, meaning largely complete genomes can be recovered without optimization. For example, the chikungunya virus data shown in Table 2 were generated without any optimization. However, to achieve coding-sequence-complete genomes, problem primers causing inefficient amplification of certain regions may need to be replaced or their concentrations adjusted relative to other primers in an iterative manner. Complete coverage of the genome covered by the scheme—i.e., all amplicons successfully amplified—should be achievable for the majority of samples using this protocol however, coverage is still expected to correlate with viral abundance (Table 3).

Multiplex PCR Protocol. Next, we developed a multiplex PCR protocol using novel reaction conditions: specifically low individual primer concentrations, high primer annealing temperatures (>65 °C) and long annealing times, which allows amplification of products covering the whole genome in two reactions (Fig. 3). In comparison with single-plex methods, this markedly reduces the cost of reagents and minimizes potential sources of laboratory error. We assign alternate target genome regions to one of two primer pools, so that neighboring amplicons do not overlap within the same pool (which would result in a short overlap product being generated preferentially). By screening reaction conditions based on the concentration of cleaned-up PCR products and specificity as determined by gel electrophoresis, we determined that lower primer concentrations and a longer annealing/extension time were optimal. Given the low cost of the assay, this step could also be performed alongside standard diagnostic quantitative PCR as a quality control measure to help reveal potential false positives 50 .

(أ) Schematic showing the regions amplified in pools 1 (upper track) and 2 (lower track), and the intended overlap between pools (as determined in Step 1). (ب) Products generated by PCR in Step 9 from pools 1 (left tube) and 2 (right tube) for the hypothetical scheme shown in أ. (ج) In Step 12A(ii), the input amount is normalized based on the number of samples and the scheme length pool 1 and 2 products can be pooled at this stage (shown) or kept separate if you wish to barcode them individually. In Step 12A(iv), products for each sample are then barcoded by ligation of a unique barcode. In Step 12A(vi), all barcoded products are pooled together before sequencing adaptor ligation, yielding a sequenceable library.

Sequencing protocol optimizations. Optimized library preparation methods for both the MinION and Illumina MiSeq platforms are provided and should be readily adaptable to other sequencing platforms, if required. The MinION system is preferred when portability and ease of setup in harsh environments are important 5 . The Illumina platform is more suited to sequencing very large number of samples, because of greater sequence yields, and the ability to barcode and accurately demultiplex hundreds of samples. Both platforms use ligation-based methods to add the required sequencing adaptors and barcodes.

For the MinION, we used the native barcoding kit (Oxford Nanopore Technologies) to allow up to 12 samples to be sequenced per flow cell. As the manufacturer's protocol is designed for 6–8 kb of fragmented genomic DNA, we have adjusted the input mass to achieve an equivalent number of moles of DNA ends this improves the efficiency of barcode/adaptor ligation and improves run yields. In the development of the protocol, we used R9 or R9.4 flow cells (FLO-MIN105/FLO-MIN106) and the 2D barcoded library preparation kit (EXP-NBD002/SQK-LSK208). The protocol is also compatible with the current 1D barcoded library preparation kit (EXP-NBD103/SQK-LSK108). Because of the regular revisions of the kits, we have avoided including any specific component names or volumes be sure to follow the appropriate protocol for your chosen kit version. Depending on the number of reads required, the number of samples multiplexed and the performance of the flow cell, sequencing on the MinION can take from a few minutes up to 72 h. Typically, 2–4 h of sequencing is sufficient for 12 samples. For the MiSeq platform, we used the Agilent SureSelect xt2 adaptors and the KAPA Hyper library preparation kit, allowing up to 96 samples to be sequenced per MiSeq run. Other library prep kits (e.g., Illumina TruSeq) and dual-indexed adaptors could also be used on the MiSeq. For the MiSeq, we recommend using the 2 × 250-nt read-length for 400-nt amplicons, which takes 48 h to complete.

Bioinformatics workflow MinION pipeline. We developed bioinformatic pipelines consisting of primer trimming, alignment, variant calling and consensus generation for both the Oxford Nanopore and Illumina platforms. The MinION pipeline was developed by building upon tools previously developed for Ebola virus sequencing in Guinea and is freely available with components developed under the permissive MIT open source license at https://github.com/zibraproject/zika-pipeline. The pipeline runs under the Linux operating system and is available as a Docker image, which means that it can also be run on Mac and Windows operating systems. The MinION version of the pipeline can process the data from basecalled reads to consensus sequences on the instrument laptop, given the correct primer scheme (a BED file).

FAST5 reads containing raw nanopore signal data may be basecalled in real time using MinKNOW (accessible via the MinION Community Portal for registered users at http://community.nanoporetech.com) or off-line using Albacore. Albacore is a recurrent neural network (RNN) basecaller developed by Oxford Nanopore Technologies and also made available through the MinION Community Portal. Reads are extracted into a FASTA file using the poretools fasta command. This FASTA file may be demultiplexed by a script, demultiplex.py, into separate FASTA files for each barcode, as specified in a config file. By default, these are set to the barcodes NB01–12 from the native barcoding kit. Alternatively, the Metrichor online service (https://www.metrichor.com) and versions of Albacore 1.0.1 or later may be used to basecall read files and demultiplex samples. Each file is then mapped to the reference genome using bwa mem using the -x ont2d flag and converted to BAM format using samtools view . Alignments are preprocessed using a script ( align_trim.py ) that performs primer trimming and coverage normalization. Primer trimming is performed by reference to the expected coordinates of sequenced amplicons, and therefore requires no knowledge of the sequencing adaptor (Fig. 3). Signal-level events are aligned and variants are called using nanopolish variants . Low-quality or low-coverage variants are filtered out and consensus sequences are generated using a script, margin_cons.py . Variant calls and frequencies can be visualized using vcfextract.py and pdf_tree.py .

Bioinformatics workflow Illumina pipeline. First, we use Trimmomatic 51 to remove primer sequences (first 22 nt from the 5′ end of the reads) and bases at both ends with Phred quality scores <20. Reads are aligned to the genome of a Zika virus isolate from the Dominican Republic, 2016 (GenBank: KU853012), using Novoalign v3.04.04 (http://www.novocraft.com/support/download/). SAMtools is used to sort the aligned BAM files and to generate alignment statistics 52 . The code and reference indexes for the pipeline can be found at https://github.com/andersen-lab/zika-pipeline. Snakemake is used as the workflow management system 53 .

Alignment-based consensus generation. We have used an alignment-based consensus approach to generate genomes as opposed to من جديد الجمعية العامة. بالرغم ان من جديد assembly could in theory be used with this protocol, the use of a tiling amplicon scheme already assumes that the viral genome is present in a particular fixed order. This assumption may be violated in the presence of large-scale recombination. بعض من جديد assemblers, such as SPAdes, use a frequency-based error correction preprocessing stage, and this may result in primer sequences being artificially introduced into the reference if primer sequences are not removed in advance 54 . Importantly, when we compared alignment with من جديد-based analysis methods for our generated Zika virus genomes, we found that we always obtained the same consensus sequences.

Preparing sequencing controls. We recommend that positive sample controls be included in each sequencing run. To check that the protocol is generating the expected results, we recommend choosing a positive sample with an established, trusted reference sequence. For the Zika virus, we used the previously sequenced World Health Organization reference strain PF13/251013-18 (GenBank accession: KX369547), which can be obtained on request from the Paul-Ehrlich-Institut 55,56 . Sample archives such as the National Collection of Pathogenic Viruses in the United Kingdom can provide high-quality reference materials for other viruses. Positive controls should have viral copy numbers similar to those of the clinical samples on the same run. This may require the positive control to be heavily diluted until the Ct values are comparable. Negative sequencing controls should be processed in a manner as similar as possible to that used for clinical samples and should not be simply water controls for example, if samples are collected by swabs, then the same type of unused swab should be subjected to RNA extraction and PCR. Additional negative water controls may be added at each step (e.g., reverse transcription, PCR and library preparation) to detect the sources of contaminants. Even if amplification is not detected (e.g., by gel electrophoresis) or DNA quantity is low or undetectable by fluorimetry, a sequencing library should still be prepared as normal using the total available amount, as contamination may still be detectable by sequencing.

Contamination. Cross-contamination is a serious potential problem when working with amplicon sequencing. Contamination risk is minimized by maintaining physical separation between pre- and post-PCR areas, and performing regular decontamination of work surfaces and equipment—e.g., by UV exposure or with 1% (vol/vol) sodium hypochlorite solution. Contamination becomes harder to mitigate with decreasing viral copy numbers. Processing high-viral-count samples can lead to overamplification during PCR (e.g., generation of unnecessarily high numbers of amplicons), which can increase the risk of amplicon contamination in subsequently processed samples with low viral counts. Such 'between-sample amplification' can occur during sequencing library preparation, or may result from barcode misidentification or 'barcode hopping' (incorporation of incorrect barcode sequences during sequence library preparation) during sequencing. When determining how many PCR cycles to use, begin with a lower number and increase gradually to minimize this contamination risk.

The best safeguard for helping to detect contamination is the use of negative controls. These controls should be sequenced even if no DNA is detected by quantification or no visible band is present on a gel. Negative control samples should be analyzed through the same software pipeline as is used for the other samples, and you should assume that any contaminating amplicons in the negative control will also be present in your other samples. The relative number of reads as compared with positive samples gives a simple guide to the extent of contamination, and inspection of coverage plots can help identify any specific region involved.


الانتماءات

Life Science Research and Foundation, QIAGEN Sciences, Inc., Frederick, Maryland, USA

Quan Peng, Ravi Vijaya Satya, Marcus Lewis, Pranay Randad & Yexun Wang

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

المؤلف المراسل


Multiplex PCR, shorter amplicon inhibiting longer amplicon? - مادة الاحياء

The 64-bit Mac version should work on most modern Macs (OS X 10.7 or newer).

FreeBSD users may simply type pkg install pooler

For all other systems (GNU/Linux, older Mac, Solaris. ) please compile from source (below).

Example primers file

Source code

  • a C compiler (GCC or Clang) and basic Unix tools,
  • MingW compiler(s) if you want to cross-compile for Windows.

إستعمال

  • If you opt to use Score when your primers and/or tags are very long, you will be asked if you are really sure you don't want to use deltaG instead.
  • If you opt for deltaG, the following questions will be asked: Temperature: Enter a number (decimal fractions are allowed). You can enter it in Celsius, Kelvin, Fahrenheit or Rankine. Do not enter the suffix C or K or F or R---Primer Pooler will determine for itself which unit was meant, and ask you to confirm. (Recent versions of Primer Pooler offer 5 additional obscure temperature scales if you decline all of the more probable ones.) Magnesium concentration in mM (0 for no correction): Enter your concentration of magnesium in nanomoles per cubic metre (decimal fractions are allowed). Enter 0 if you don't mind the deltaG figures not being corrected for magnesium concentration. Monovalent cation (e.g. sodium) concentration in mM: Enter your concentration of sodium etc in nanomoles per cubic metre (decimal fractions are allowed). If in doubt, try 50. dNTP concentration in mM (0 for no correction): Enter your concentration of deoxynucleotide (dNTP) in nanomoles per cubic metre (decimal fractions are allowed). Enter 0 if you don't mind the deltaG figures not being corrected for dNTP concentration.
  • If you answered yes to this question, the summary will be displayed on screen, and you will be asked if you also want to save it to a file. If you answer yes to this, you will be asked for a filename.
  • These up-front counts will include self-interactions (a primer interacting with itself), and interactions between the pair of primers in any given set. Self-interactions and in-set interactions are ليس counted when summarizing the counts of each pool (below).
  1. Go to http:// hgdownload. cse. ucsc. edu/ downloads. لغة البرمجة
  2. Choose a species (e.g. Human)
  3. Choose "Genome sequence files"
  4. If you're under hg38, choose "Standard genome sequence files"
  5. Scroll down to the links, and choose the one that ends .2bit (e.g. hg38.2bit)
  • After the overlap scan is complete, Primer Pooler will then have enough data to write an input file for MultiPLX if you wish to run that software as well for comparison. If you decline this, it will ask if you want it to write a simple text file with the locations of all amplicons, which you may accept or decline.
  • اذا فعلت ليس opt to check for overlaps in the genome, then Primer Pooler will ليس take overlaps into account when generating its pools. This is rarely useful unless you have بالفعل ensured there are no overlaps in the set of amplicons under consideration. Even then, I would recommend performing a scan anyway, just to double-check: an early version found 11 overlaps in a supposedly overlap-free batch drawn up by an experienced academic---we all make mistakes. But bypassing the overlap check might be useful لو you are sure there are no overlaps and you don't want to download a very large genome file to the workstation you're using.

You will not be allowed to set the maximum size of each pool lower than the average size of each pool, since that would make it logically impossible to fit all primer-sets into all pools. It is not advisable to set it just above the average either, since being overly strict about the evenness of the pools could hinder Primer Pooler from finding a solution with lower dimer formation. You might want to experiment with different maxima---you will be able to come back to this question and try again. Do you want to give me a time limit? (y/n): If you answer ذ, you will be asked to set a time limit in minutes. Normally 1 or 2 is enough, although you may wish to let it run a long time to see if it can find better solutions. أنت لا تفعل لديك to set a time limit: you may manually interrupt the pooling process at any time and have it give the best solution it has found so far, whether a time limit is in place or not. Additionally, Primer Pooler will stop automatically when it detects better solutions are unlikely to be found. Do you want my "random" choices to be 100% reproducible for demonstrations? (y/n): If you answer ذ, Primer Pooler's random choices will be generated in a way that merely بحث random but are in fact completely reproducible. This is useful for demonstration purposes---you'll know how long it will take to find the solution you want. Otherwise, the random choices will be less predictable, as a different sequence will be chosen depending on the exact time at which the pooling was started. Pooling display While pooling is in progress, Primer Pooler will periodically display a brief summary of the best solution found so far, showing the pool sizes, and the counts of interactions (by deltaG range or score) within each pool. As instructed on screen, you may press Ctrl-C (i.e. hold down Ctrl while pressing and releasing C, then release Ctrl) to cancel further exploration and use the best solution found so far. Do you want to see the statistics of each pool? (y/n): After the pooling is complete, or after you have interrupted it (by pressing Ctrl-C as instructed on screen), you will be asked if you wish to see the interaction counts of كل pool (rather than a simple summary of الكل pools as appeared during pooling). If you want this, you will also be asked if you wish to save them to a file, and, if so, what file name. Do you want to see the highest bonds of these pools? (y/n): If you answer Yes, you will be asked for a deltaG or score threshold, and all interactions worse than that threshold will be displayed on-screen with bonds diagrams such as:and you will then be asked if you wish to save it to a file, and, if so, what file name. You will then be asked if you would like to try another threshold. Shall I write each pool to a different result file? (y/n): If you answer ذ to this, you will be asked for a prefix, which will be used to name the individual results files. Otherwise, you will be asked if you wish to save all results to a single file. If you decline saving all results to a single file, the results will not be saved at all---this is for when you weren't happy with the solution and want to go back to try a different number of pools or a different maximum pool size. Do you want to try a different number of pools? (y/n): This question is self-explanatory. You can go back as many times as you like, trying different numbers of pools. But many researchers have a pretty good idea of how many pools they want to use, or else are happy with the computer's initial suggestion. Would you like another go? (y/n): If you answered No to trying a different number of pools, or if you didn't want the program to do pooling at all, then you will be asked if you want to start the program again. Answering No to this question will exit.

Command-line usage

الوحيد mandatory argument (if not running interactively) is a filename for the primers file. This should be a text file in multiple-sequence FASTA format, such as:(this example does not represent real primers). Degenerate bases are allowed using the normal letters, and both upper and lower case is allowed. Names of amplicons' primers should end with F or R, and otherwise match. Optionally include tags (tails, barcoding) to apply to all primers: >tagF and >tagR (tags can also be changed part-way through the file).

Processing options should be placed before this filename. Options are as follows: --help or /help or /? Show a brief help message and exit. --counts Show score or deltaG-range pair counts for the whole input. deltaG will be used if the --dg option is set (see below). This option produces a fast summary of how many primer pairs (in the entire collection, before pooling) have what range of interaction strengths. This could be used for example to check a pool that you have already chosen manually, or if you want a rough idea of the worst-case scenario that pooling aims to avoid. --self-omit Causes the --counts option to avoid counting self-interactions(a primer interacting with itself), and interactions between the pair of primers in any given set. --print-bonds=THRESHOLD Similar to --counts , this can be useful for checking a manual selection or for a rough idea. All interactions worse than the given threshold (deltaG if --dg is in use, otherwise score) will be written to standard output, with bonds diagrams. --dg[= temperature[, mg[, cation[, dNTP]]]] Set this option to use deltaG instead of score. Optional parameters are the temperature (default is human blood heat), the concentration of magnesium (default 0), the concentration of monovalent cation (e.g. sodium, default 50), and the concentration of deoxynucleotide (dNTP, default 0). Decimal fractions are allowed in all of these. Temperature is specified in kelvin, and all concentrations are specified in nanomoles per cubic metre. --suggest-pools Outputs a suggested number of pools. This is the approximate lowest number of pools needed to achieve no worse than a deltaG of -7 (or a score of 7) in each. --pools[= NUM[, MINS[, PREFIX]]] Splits the primers into pools. Optional parameters are the number of pools (if omitted or set to ? then the suggested number will be calculated and used), a time limit in minutes, and a prefix for the filenames of each pool (set this to - to write all to standard output). --max-count=NUM Set the maximum number of pairs per pool. This is optional but can make the pools more even. A maximum lower than the average is not allowed, and it's usually best to allow a generous margin above the average. --genome=PATH Check the amplicons for overlaps in the genome, and avoid these overlaps during pooling. The genome file may be in .2bit format as supplied by UCSC, or in .fa (FASTA) format. --scan-variants When searching for amplicons in a genome file, scan variant sequences in that file too, i.e. sequences with _ and - in their names. By default such sequences are omitted as they're not normally needed if using hg38. --amp-max=LENGTH Sets maximum amplicon length for the overlap check. The default is 220. --multiplx=FILE Write a MultiPLX input file after the --genome stage, to assist comparisons with MultiPLX's pooling etc. --seedless Don't seed the random number generator --version Just show the program version number and exit.

التغييرات

Defects fixed

  1. an error in incremental-update logic sometimes had the effect of generating suboptimal solutions (in particular, pools could be unnecessarily empty, and/or full beyond any limit that was set)
  2. an error in the user-interface loop meant that if you use tags, run interactively, and answer "yes" to the question "Do you want to try a different number of pools", the second run will have been done without the tags, and its results will have been de-tagged twice, removing some bases from the output moreover, the resulting truncated versions of your primers will have made it into the interaction calculations for any third run.

Versions prior to 1.17 also had a display bug: the concentrations for the deltaG calculation are in millimoles per litre, not nanomoles as stated on-screen in interactive mode (please ignore the on-screen instruction and enter millimoles, or upgrade to the latest version which fixes that instruction).

Versions prior to 1.34 would round down any decimal fraction you type when in interactive mode (for deltaG temperature, concentration and threshold settings). Internal calculation and command-line use was not affected by this bug.

Versions prior to 1.37 did not ignore whitespace characters after FASTA labels and the label) -->.

Notable additions

Version 1.2 added the MultiPLX output option, and Version 1.33 fixed a bug when MultiPLX output was used with tags and multiple chromosomes. Version 1.3 added genome reading from FASTA (not just 2bit), auto-open browser, and suggest number of pools.

Version 1.36 clarified the use of Taq probes, and allowed these to be in the input file during the overlap check. It's consequently stricter about the requirement that reverse primers must end with R or B : previous versions would accept any letter other than F for these.

Version 1.4 allows tags to be changed part-way through a FASTA file. For example, if there are two >tagF sequences, the first >tagF will set the tags for all F primers between the beginning of the file and the point at which the second >tagF is given the second >tagF will set the tags for all F primers from that point forward. You can change tags as often as you like.

Version 1.5 allows primer sets to be "fixed" to predetermined pools by specifying these as primer name prefixes , e.g. [email protected]:myPrimer-F fixes myPrimer-F to pool 2.

Version 1.6 detects and warns about alternative products of non-unique PCR. It was followed within hours by Version 1.61 which fixed a regression in the amplicon overlap check.

Version 1.7 makes the ignoring of variant sequences in the genome optional, and warns if primers not being found might be due to variant sequences having been ignored.


Amplification-Based Methods

Marina N. Nikiforova , . Yuri E. Nikiforov , in Clinical Genomics , 2015

Primer Design for Multiplex PCR

Multiplex PCR is a commonly used approach for amplification-based target enrichment. There are several strong advantages of targeted amplification-based sequencing as compared with whole genome and exome sequencing, or targeted sequencing by a hybrid capture approach. It requires a small amount of DNA (10–200 ng) as the starting template, can be performed on specimens with a suboptimal DNA quality, it is time- and cost-effective, and provides high depth of sequencing and straightforward data analysis.

PCR assays are a mainstay of molecular pathology and represent the most convenient and cost-effective method for target selection and amplification using specimens with limited DNA and low abundance targets. However, critical performance issues arise with pooling (multiplexing) of progressively larger numbers of PCR primers and reactions. Specifically, (i) amplification artifacts are introduced due to polymerase editing mistakes during annealed oligomer extension, and (ii) thermal damage to genomic targets takes place during high temperature cycling resulting in modification of the native nucleic acid sequence [7] . In addition, reaction biases emerge associated with primer–dimer formation, substrate competition, and sequence-dependent differences in PCR efficiency [8] . The maximum achievable pooling using conventional PCR is estimated to be 10 targets [9] , however, for next-gen sequencing approaches a significantly larger number of primers are necessary in multiplex reaction in order to achieve sequencing of large genomic regions. Therefore, one of the main factors that are crucial for successful amplification-based target enrichment is primer design for multiplex PCR.

PCR amplification includes repetitive cycles of DNA denaturation, primer annealing, and sequence extension. The oligonucleotide primers are designed to be complementary to a known genomic sequence of interest. When designing amplification primers for multiplex PCR, several factors must be considered including length of primers (18–25 nucleotides), melting temperature (تيm) of the primers that should be either identical or within 1–2°C, appropriate GC content (50–55%), and lack of primer cross-complementarity. In addition, regions with repetitive sequences, known germ line single nucleotide polymorphisms (SNPs), and regions with high homology should be avoided because they may affect efficiency of PCR amplification and create amplification bias.

The most common type of amplification bias arises from unequal amplification of alleles due to sequence variation in the primer binding site [10] . Therefore, designed primers should be checked against SNP databases (dbSNP at www.ncbi.nlm.nih.gov/SNP ) or the 1000 genomes project ( www.1000genomes.org ) to assure that primer binding sides do not contain highly variable SNPs. If binding site sequence variation is impossible to avoid, primers should be modified to include several possible nucleotide variations in the primer design. In addition, primers also need to be checked against sequence databases ( http://blast.ncbi.nlm.nih.gov/ ) for evaluation of the primer specificity to the region of interest. This will avoid amplification of pseudogenes and other regions with high sequence homology that may result in erroneous sequence alignment and generation of false positive calls [11,12] . There are a number of software programs available for assisting with primer design (e.g., Primer3: http://frodo.wi.mit.edu/cgibin/primer3/primer3_www.cgi and PrimerBLAST: http://www.ncbi.nlm.nih.gov/tools/primer-blast ).

Highly multiplexed PCR permits amplification of thousands of short genomic sequences in a single tube and does not require a large amount of DNA. Depending on a platform, as low as 5–10 ng of DNA is sufficient for producing a high complexity library. Therefore, this approach has been successfully used in samples when only limited amount of DNA is available (i.e., from small tumor biopsies or FNA samples). However, it is necessary to understand that a very small tissue sample and correspondingly low amount of DNA (picograms) may misrepresent the cell composition in the specimen and affect library complexity by producing biased amplification of one cell population versus another (e.g., nonneoplastic vs. neoplastic cells). In addition, low DNA input can produce bias toward propagation of incorporated errors during early cycles of the PCR, mostly because no excess of DNA is available to compete with the erroneous sequence. Replication errors can be reduced through the use of polymerases with 3′–5′ exonucleolytic proofreading and mismatch repair capabilities, but at the cost of slower extension rates and lower thermostability. For example, Pfu polymerase (from Pyrococcus furiosus) exhibits <2% of the errors of Taq polymerase (from ثيرموس أكواتيكوس) but has a much lower elongation rate (

20 nt/s vs. 80 nt/s, respectively, at 72°C) increasing exposure time for thermal damage [7] . Thermal modifications associated with PCR are characteristically reflected in depurination (A or G), deamination (C>U), and oxidation of G to 8-oxoG. Users should be aware of the potential for overrepresentation of these PCR-specific artifacts which can be miscalled as genetic variants. At a minimum, failure to control for these errors during amplicon sequencing results in overestimation of sample diversity while reducing sensitivity for detection of true genetic variants [13] .

Another advantage of multiplex PCR is in amplification of relatively short genomic regions (80–150 base pairs) that allows for a successful sequencing of DNA and RNA of suboptimal quality such as from FFPE tissue samples. However, sequencing of large consecutive genomic regions by multiplex PCR can create a cross-reaction between primer pairs due to primer overlap and, therefore, may require separation of closely located primers into several multiplex pools (and consideration of whether a capture-based method is more well suited to the analysis).

Similarly to other amplification-based methods, targeted amplification-based MPS requires incorporation of strict measures to avoid sample contamination with amplification products. Laboratories should implement physical separation of preamplification area for specimen processing and nucleic acid extraction and postamplification areas, develop a unidirectional workflow process, and assure decontamination of work surfaces.


شاهد الفيديو: Multiplex PCR (كانون الثاني 2022).