معلومة

أين يمكنني الحصول على تسلسل طليعة E. coli ribosomal RNA؟


لقد وجدت تسلسلات منفصلة لـ 16S rRNA (من الوحدة الفرعية الصغيرة) و 23S rRNA و 5S rRNA (من الوحدة الفرعية الكبيرة). أحتاج إلى تسلسل الحمض الريبي النووي الريبي السلائف الكامل ، والذي لا يمكنني العثور عليه.

ومع ذلك ، فإن التسلسل الكامل المشروح لجينوم الملف E.

https://www.ncbi.nlm.nih.gov/nuccore/U00096.3؟report=fasta

هل يعطيني تغيير T إلى U لهذا التسلسل تسلسل الرنا الريباسي الكامل؟


بشكل عام ، تمتلك معظم الكائنات الحية نسخًا متعددة من الجينات / مناطق ترميز الحمض النووي الريبي (RNA) (نظرًا لأنه يحتاج إلى الكثير جدًا). بالإضافة إلى ذلك ، يمكن أن تكون هذه المناطق متكررة أو مشابهة للتسلسل أو المكان بشكل صحيح في الجينوم ، لذلك من الصعب بشكل عام العثور على تسلسلات جينومية جيدة للرنا الريباسي مقارنة بالجينات الأخرى.

بناءً على الرابط الخاص بك ، يبدو أنك تبحث عن الرنا الريباسي للإشريكية القولونية ؛ يحتوي إدخال GeneBank المقابل لملف fasta الذي قمت بربطه على شرح للجينوم الكامل ويحتوي على 7 إدخالات لمجموعات من RNA الريبوسوم (يُسمى rr [slf] [A-H] *).
إذا أخذت أيًا من التسلسلات التي تمتد عبر إحدى هذه المناطق ، يجب أن تحصل على تسلسل السلائف الكاملة. ومع ذلك ، هناك أشياء يجب أن تكون على دراية بها:

  • من المحتمل أن تكون هناك اختلافات طفيفة في التسلسل بين جميع المناطق السبع
  • من الواضح أن معظم أوبرات الرنا الريباسي e.coli تحتوي أيضًا على جينات الحمض الريبي النووي النقال مختلطة معها (هذه مختلفة لجميع الأوبونات السبعة)
  • استبدال الجينوم T بـ U سيجعل التسلسل يبدو مثل RNA ، ومع ذلك غالبًا ما يتم تحرير RNA الريبوسومي أيضًا بعد النسخ ، لذلك قد لا يتطابق التسلسل الذي تحصل عليه تمامًا مع تسلسل الرنا الريباسي الناضج.

موقع آخر يوفر نظرة أفضل على عوامل الرنا الريباسي في e.coli هو هذا ، ويحتوي أيضًا على روابط مصدر ويبدو أنه يتطابق مع إدخال بنك الجينات مما يمكنني رؤيته.

مثال على كيفية العثور على منطقة الرنا الريباسي من إدخال بنك الجينات:

هذا جزء (مختصر) من التعليق التوضيحي لمدخل GeneBank ، والذي يُظهر جينات الريبوسوم "أ":

جين 4035531… 4037072 / جين = "rrsA" rRNA 4035531… 4037072 / جين = جين "rrsA" 4037141… 4037217 / جين = "ileT" tRNA 4037141… 4037217 / جين = "ileT" جين 4037260… 4037335 / جين tRNA 4037260… 4037335 / gene = "alaT" جين 4037519… 4040423 / gene = "rrlA" rRNA 4037519… 4040423 / gene = "rrlA" gene 4040517… 4040636 / gene = "rrfA" rRNA 404036 / ... "406

كما ترون الجينات في المنطقة / أوفروكور بالترتيب rrsA، ileT،> alaT، rrlA، rrF (حقيقة أن هذا أوبرون لا يمكن استنتاجه من إدخال GeneBank) وإذا أخذت المنطقة المقابلة من Fasta تسلسل (نيوكليوتيدات / أحرف 4035531 إلى 4040636) ستحصل (معظم) على تسلسل النص الأساسي.
نظرًا لعدم وجود تعليقات توضيحية في GeneBank (أو أي / معظم مجموعات الجينوم الأخرى) ، لا يمكنك بسهولة الحصول على التسلسل قبل الجين الأول وبعده. قد يكون أحد المصادر المحتملة لهذه المصادر هو المصدر الآخر الذي قمت بربطه ، والذي يسرد بعض المصادر لمواقع إنهاء.

* هذا يعبر عن جميع الأسماء على أنها regex. على سبيل المثال ، بالنسبة إلى مشغل الرنا الريباسي A هناك rrlA و rrsA و rrfA ؛ نفس الشيء بالنسبة لـ B ، C ، ...


هيكل Cryo-EM الخاص بـ بكتريا قولونية ترجمة الريبوسوم في مركب مع SRP ومستقبلاته

نُبلغ عن التشكل "المبكر" لـ الإشريكية القولونية جسيم التعرف على الإشارة (SRP) ومستقبله FtsY مرتبطان بالريبوسوم المترجم ، كما هو محدد بواسطة cryo-EM. يرتبط FtsY بالحلقة الرباعية لـ SRP RNA ، بينما تتفاعل مجالات NG لبروتين SRP و FtsY بشكل ضعيف في هذا التشكل. تشير نتائجنا إلى أن الوضع الأمثل لـ SRP RNA tetraloop ومجال Ffh NG يؤدي إلى توظيف FtsY.


& ltp> يقدم هذا القسم أي معلومات مفيدة حول البروتين ، ومعظمها معلومات بيولوجية. & ltp> & lta href = '/ help / function_section' target = '_ top'> المزيد. & lt / a> & lt / p> الوظيفة i

متنوع

& ltp> The & lta href = "http://www.geneontology.org/"> مشروع علم الوجود الجيني (GO) & lt / a> يوفر مجموعة من المفردات الهرمية المحكومة مقسمة إلى 3 فئات: & ltp> & lta href = '/ help / gene_ontology 'target =' _ top '> المزيد. & lt / a> & lt / p> GO - الوظيفة الجزيئية i

    المصدر: CAFA & # xd & ltp> مستنتج من الفحص المباشر & lt / p> & # xd & # xd & ltp> يُستخدم للإشارة إلى فحص مباشر للوظيفة أو العملية أو المكون الذي يشير إليه مصطلح GO. & lt / p> & # xd & #xd & ltp> مزيد من المعلومات في & lta href = "http://geneontology.org/page/guide-go-evidence-codes#ida"> دليل كود دليل GO & lt / a> & lt / p> & # xd مستنتج من مباشر فحص أنا

      GO - العملية البيولوجية i

        المصدر: EcoCyc & # xd & ltp> مستنتج من النمط الظاهري المتحولة & lt / p> & # xd & # xd & ltp> يصف التعليقات التوضيحية التي تم استنتاجها من النظر إلى الاختلافات أو التغييرات في منتج الجينات مثل الطفرات أو المستويات غير الطبيعية وتتضمن تقنيات مثل الضربات القاضية والتعبير الزائد والتجارب المضادة للحس واستخدام مثبطات بروتين معينة. & lt / p> & # xd & # xd & ltp> مزيد من المعلومات في & lta href = "http://geneontology.org/page/guide-go-evidence- رموز # imp "> دليل كود دليل GO & lt / a> & lt / p> & # xd مستدل من النمط الظاهري المتحور i

          & ltp> الكلمات الرئيسية لـ UniProtKB تشكل & lta href = "http://www.uniprot.org/keywords"> مفردات مضبوطة & lt / a> ببنية هرمية. تلخص الكلمات الرئيسية محتوى إدخال UniProtKB وتسهل البحث عن البروتينات المهمة. & ltp> & lta href = '/ help / keywords' target = '_ top'> المزيد. & lt / a> & lt / p> الكلمات الرئيسية i

          قواعد بيانات الإنزيم والمسار

          مجموعة BioCyc لقواعد بيانات المسار / الجينوم


          & ltp> يوفر هذا القسم معلومات حول اسم (أسماء) البروتين والجينات والمرادفات (المرادفات) وحول الكائن الحي الذي يمثل مصدر تسلسل البروتين. & ltp> & lta href = '/ help / names_and_taxonomy_section' target = '_ top'> أكثر. & lt / a> & lt / p> الأسماء وتصنيف أمبير i

          & # xd & ltp> معلومات منظمة يدويًا تستند إلى عبارات في مقالات علمية لا يوجد لها دعم تجريبي. & lt / p> & # xd & # xd & ltp> & lta href = "/ manual / Evidences # ECO: 0000303"> أكثر. & lt / a> & lt / p> & # xd تأكيد يدوي استنادًا إلى الرأي في i

            & ltp> A UniProt & lta href = "http://www.uniprot.org/manual/proteomes٪5Fmanual"> يمكن أن يتكون البروتين lt / a> من عدة مكونات. & ltbr> & lt / br> يشير اسم المكون إلى ترميز المكون الجينومي مجموعة من البروتينات. & ltp> & lta href = '/ help / proteinome_component' target = '_ top'> المزيد. & lt / a> & lt / p> المكون الأول: مكون الكروموسوم الأول: الكروموسوم

          تشاو ، ل. J. جزيء. بيول. 113, 611–621 (1977).

          Deonier، R. & amp Hadley، R. طبيعة سجية 264, 191–193 (1976).

          Saedler، H. & amp Heiss، B. جزيء. الجنرال. جينيه. 122, 266–277 (1973).

          Ohtsubo ، H. & amp Ohtsubo ، E. بروك. ناتن. أكاد. علوم. الولايات المتحدة الأمريكية. 75, 615–620 (1978).

          غوسال ، د. ، سومر ، هـ. وأمب سايدلر ، هـ. الدقة الأحماض النووية. 6, 111–122 (1979).

          Starlinger، P. & amp Saedler، H. بالعملة. موضوعات ميكروبيول. مناعة. 75, 111–152 (1976).

          البخاري ، أ. ، شابيرو ، ج. & أمبير أديا ، أ. (محرران) عناصر إدخال الحمض النووي والبلازميدات والحبيبات (مختبر كولد سبرينج هاربور ، نيويورك ، 1977).

          ألوين ، جي سي ، كيمب ، دي وأمبير ستارك ، جي. بروك. ناتن. أكاد. علوم. الولايات المتحدة الأمريكية. 74, 5350–5354 (1977).

          Nisen، P.، Prucker، M. & amp Shapiro، L. (قيد الإعداد).

          راك ، ب. جزيء. الجنرال. جينيه. 149, 135–140 (1976).

          De Crombrugghe، B.، Adhya، S.، Gottesman، M. & amp Pastan، I. طبيعة بيول الجديدة. 241 260–264 (1973).

          Brosius، J.، Palmer، M. L.، Kennery، P.J & amp Noller، H. F. بروك. ناتن. أكاد. علوم. الولايات المتحدة الأمريكية. 75, 4801–4805 (1978).

          كورن ، إل جيه ، كوين ، سي إل آند ويجمان ، إم إن. بروك. ناتن. أكاد. علوم. الولايات المتحدة الأمريكية. 74, 4401–4405 (1977).

          ساتكليف ، ج. الدقة الأحماض النووية. 5, 2721–2728 (1978).

          فيرس ، و. وآخرون. طبيعة سجية 273, 113–130 (1978).

          Sures، I. Lowry، J. & amp Kedes، L. H. زنزانة 15, 1033–1044 (1978).

          سانجر ، ف. وآخرون. J. جزيء. بيول. 125, 225–246 (1978).

          Post ، L. ، Strycharz ، G. ، Nomura ، M. ، Lewis ، H. & amp Dennis ، P. بروك. ناتن. أكاد. علوم. الولايات المتحدة الأمريكية. 76, 1697–1701 (1979).

          كون ، إس ، فريتز ، إتش جيه ، أمبير ستارلينجر ، ب. جزيء. الجنرال. جينيه. 167, 235–241 (1979).

          Rigby ، B. ، Dieckmann ، M. ، Rhodes ، C. & amp Berg ، P. J. جزيء. بيول. 113, 237–251 (1977).


          توافر البيانات

          تم إيداع بيانات التسلسل في NCBI's Gene Expression Omnibus (105) ويمكن الوصول إليها من خلال رقم الانضمام إلى سلسلة GEO GSE152974 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi؟acc=GSE152974) . تم إيداع بيانات بروتينات قياس الطيف الكتلي في ProteomeXchange Consortium (106) عبر مستودع شريك PRIDE (107) مع معرف مجموعة البيانات PXD019900 (https://www.ebi.ac.uk/pride/archive/projects/PXD019900). تم إيداع البرنامج المستخدم والملفات الناتجة في Zenodo (https://doi.org/10.5281/zenodo.3876866 و https://doi.org/10.5281/zenodo.3955585).


          المواد والأساليب

          تم إجراء بحث التنادد باستخدام BLAST (Altschul et & # xa0al. ، 1990) ، باستخدام قاعدة بيانات الكائنات الحية النموذجية. تم استخدام التوزيع النشئي الناتج عن نتائج بلاست لاستنتاج ما إذا كان يمكن العثور على أي بروتينات متعامدة خارج Enterobacteriales و gamma Proteobacteria و Proteobacteria و Bacteria ، وما إذا كان يمكن العثور على أي أخصائي تقويم في Eukarya و Archaea. تم استخدام الفحص البصري لنتائج البحث لتصفية البروتينات المتعامدة بدلاً من البروتينات المتعامدة. في الحالات المشكوك فيها ، تم إجراء بحث BLAST متبادل ، باستخدام بروتين تقويمي مفترض تم تحديده في البحث الأصلي ، للتحقق مما إذا كان البروتين المستخدم كطعم للبحث الأولي سيتم العثور عليه باعتباره أقرب تجانس له بين بروتينات بكتريا قولونية.

          في جميع التجارب ، السلالات & # x394rsmG (JW3718) ، & # x394rsmD (JW3430) ، & # x394rsmB (JW3250) ، & # x394rsmC (JW4333) ، & # x394rsmH (JW0080) ، & # x394rsmF (JW5301rs) ، & # x394rs) # x394rsmJ (JW5672) ، & # x394rsmA (ksgA) (JW0050) ، & # x394rlmA (JW1811) ، & # x394rlmC (JW2756) ، & # x394rlmF (JW5107) ، & # x394rlm0) (JW5107) ، & # x394rlmD (JW0843) ، & # x394rlmI (JW5898) ، & # x394rlmJ (JW3466) ، & # x394rlmK / L (JW0931) ، & # x394rlmB (JW4138) ، & # x394Wrlm1 (JW4138) ، & # x394Wrlm1 (JW4138) ) و & # x394rlmE (JW3146) من مجموعة Keio (Baba et & # xa0al. ، 2006) تم استخدامها ومقارنتها بالسلالة الأبوية من النوع البري BW25113 (Datsenko and Wanner ، 2000).

          لتحليل تعبير rRNA MT ، تم تخفيف ثقافة ليلية من النوع البري E. coli في ثلاث نسخ في وسط LB طازج إلى A260 0.01 ونمت عند 37 & # xb0C في شاكر. تمت إزالة قسامات من الخلايا في 1 و 2 و 3 و 4 و 5 و 6 و 7 و 56 ساعة واستخدمت لتنقية الحمض النووي الريبي الكلي باستخدام كاشف Trizol (Invitrogen) ، متبوعًا بتوليف cDNA مع إما Maxima First Strand cDNA Synthesis Kit من أجل RT-qPCR (Thermo) مع التمهيدي العشوائي السداسي أو النسخ العكسي العكسي (Invitrogen). تم إجراء PCR الكمي بواسطة بوليميريز DNA Maxima Hot Start (Thermo) في وجود SYBR الأخضر. تم استخدام الاشعال التالية لتضخيم mRNAs المشار إليها: rsmA (ksgA) (CCCTTTTGCGGGTTAATGGC و ACGCTTCGGGCAAAACTTTC) ، rsmB (CTATGCCACCTGTTCGGTGT و CTGTTTCGCAAAGTTCGCAG) ، rsmD (CGCAAAAAGGTACACCGCAT و CAGCCAGCCGTTATCTTCCA) ، rsmE (TGAGCAGTGTGTCGTAACCand ACCGTAACGCAACGTATT) ، rsmF(CCGATTTTCTCGGTTGGGGA و ATACCACTCCTCCGCTTCCT) ، rsmG (GGACGCACGATAGAGTGGand TTCGTCCGCGATCCTAATG) ، rsmH (CTCACGTCTGATCCTCTCGC و CAATAGTCTTCGCAACGGCG) ، rsmJ (AATTCCAGATGTTCCGGCGT و TGCCTTATCTGTTCTGGCGG) ، rlmA (AAATCAGCCCCTTCAGCTCC و CCGATACCAGTATGGACGCC) ، rlmB (GCCAGGACGTCAGTATCAGG و AGGATCAGCAGGAACGGTG) ، rlmC (GGGCTTTGGTTTACACTGCG و AAACTGAGTGAGTCCAGCG) ، rlmD (TCGACAATGTCACTGGAGCC و GATGTTCCCTGGGGCTATCG) ، rlmE (AGGTCGACAACCGTCATTCC و AAAGGGTTACGTTCCCGTG) ، rlmF (CATCACAGCCGCTACGATCT و AAGTCTACGCTTTGCTCCCC) ، rlmG (AATGCCAGTGTTTTCGCAC و ACGGATTGATGAGTCGAGC) ، rlmH (TGCTCACCCTCTTTGTCGAG و TTTACCGAGTACCTGCGTCG) ، rlm أنا (ATCGCGATAAGTACGCAGCA و GAAGCGCTGATTGCACG) ، rlmJ (CAGTTAGGCAGCGAACATGC و CTGACCGCTACGTTGAAGT) ، rlmKL (TTTGAAACGTCTGCTGCGTG و CAGGCCGTCGAGATCCATAC) ، rlmM (CTTCAACACGCAGTTCACCG و CATTGCCGCCAGAAGAAGATCG) ، rlmN (أتجتكجاتجكتكاكككتج وتاتكجاتجكتجككتجتجتك) ، أوبا (AATCGTTCTTGAACGCAGC و GATCAACGTGAACTTCGTCC) ، ميت ك (AGGCTGAAGTGCGTAAAAAC و GGGCAGAATTGGCTTGATG) ، نان (ججتجتجتكاكاتككاجك وكاجاجاتتكجتكجتااككج) ، gatY (TTTGCCATCGCTTTGATGTC و TGGCATACATCCCATGAGC) ، غواب (AAGACTTCCAGAAAGCGGAA و TTCACGATACGTGCAGTA) ، mdaB (CAGCGACTACGATGTCAAG و TTTTCGACGATCTTTGCG) ، نعم (CAGGCGTTACCTGAGCTG و TTTGCCCAGTTCTTCATACAGT) ، astC (ATTGACGACTCTACCTGTGC و TCACGCCGTAGTGCATATAG) ، أكس (GCAGTATTCCGCTGAAGAAA و GATCTTCGCGTTCATCTCT) ، وزارة الدفاع (GCCTGCGGATCTGTTTATTT و TTCAGCAGTGAAGTCCAGTT) ، psp (ATCGATGTTCGTGTTCCAGA و CCCATCTCGCTAAGGATCTC) ، ugpB (جكتجاتككاكتججاآاك وتكاتككتتاكجاككجاكج) ، argT (TACCGATAAACGTCAGCAGG و CCTTTACTACGCCAGGTCTC) ، sra (AATCGAACCGTCAGGCAC و TTTTCAGCGGGGCGTTT) ، سير (TGAGCAAGGCGAGGAGC و TGGTGCAGATGAACTTCAGG) ، rfp (GCTGATCAAGGAGAACATGC و AGGATGTCGAAGGCGAAGG). تم إجراء القياس الكمي للتعبير بواسطة طريقة & # x394 & # x394Ct باستخدام 16S rRNA كمرجع (gAgAATgTgCCTTCgggAAC و CCgCTggCAACAAAgATAA لتحليل التعبير الجيني MT أو CATTGACGTTACCCGCAGAAGAAG و CTACGAGACTCAAGCTT. لتقدير نسبة معالجة الرنا الريباسي 17S ، تم استخدام نهج RT qPCR الوسيط. تم استخدام تسلسل التمهيدي التالي لـ 16S rRNA (GAAGAGTTTGATCATGGCTCAG و CCACTCGTCAGCAAAGAAG) وللمعالجة الوسيطة 17S rRNA (TCATTACGAAGTTTAATTCTTGAGCG و GAAGAGTTTGATCATGGCTCAG). تم حساب النسبة 17S / (16S & # x2009 + & # x200917S) من خلال تطبيع مستويات نسخة 17S الممتدة 5 & # x2032-end-end إلى المبلغ الإجمالي لنصوص 16S و 17S.

          لتقييم تراكم وسيطة التجميع ، خلايا سلالات خروج المغلوب من rRNA MT وسلالة BW25113 (WT) ونمت في 500 مل من وسط LB عند 37 & # xb0C أو 20 & # xb0C إلى A600 0.6 ، تم تبريده ببطء على الجليد ، وحصده بالطرد المركزي. تم تعليق كريات الخلايا في محلول تحلل (20 ملي مولار HEPES-KOH درجة الحموضة 7.5 ، 4.5 ملي ملغ (OAc)2، 150 ملم NH4Cl ، 4 ملي مولار & # x3b2-مركابتوإيثانول ، 0.05 ملي سبيرمين ، 2 ملي سبيرميدين عازلة) و lysed عن طريق الموجات فوق الصوتية. بعد إزالة حطام الخلية ، تم تطبيق المحلولات التي تحتوي على ما يقرب من 1200 pmol من الريبوسومات إما على تدرج سكروز بنسبة 10٪ إلى 30٪ في محلول عازل 20 ملي مولار HEPES-KOH درجة الحموضة 7.5 ، 1 ملي ميكروغرام (OAc)2، 200 ملم NH4Cl ، 4 ملي مولار & # x3b2-مركابتوإيثانول ، أو 10٪ إلى 40٪ تدرج سكروز في مخزن مؤقت 20 مم HEPES-KOH الأس الهيدروجيني 7.5 ، 10 ملي Mg (OAc)2، 200 ملم NH4Cl ، 4 ملي مولار & # x3b2-مركابتوإيثانول. تم إجراء تنبيذ فائق بواسطة دوار SW41Ti عند 19000 دورة في الدقيقة لمدة 19 ساعة متبوعًا بمراقبة الكثافة الضوئية عند 260 نانومتر.

          لإنشاء بنية pRFPCERtet ، تم هضم بلازميد pRFPCER (Osterman et & # xa0al. ، 2013) باستخدام HindIII و SacII وربطها بزوج من oligonucleotides التكميلية الملدنة مسبقًا (TetR F 5 & # x2032 AGCTTGGGAAATCATAAAAATTAGATTAGTATTAGAT x2032-GGCTATTATAACTCTATCAATGATAGTAAGCAAATAATTTTTTATGATTTCCCA-3 & # x2032) ، تحتوي على مروج T5 مع موقع ربط TetR. تم هضم البلازميد الناتج باستخدام إنزيمات تقييد SacII و NdeI وربطها بزوج من قليل النوكليوتيدات التكميلية الملدنة مسبقًا (5 & # x2032-CACACAACAAAGGAGGTAC و 5 & # x2032-TAGTACCTCCTTTGTTGTGTGGC) ، التي تحتوي على موقع ربط ريبوزومي عالي الكفاءة. تم استخدام البلازميد الناتج لمزيد من الدراسة مثل pRFPCERtet.

          لمراقبة معدلات النمو عند الإفراط في التعبير الجيني الخارجي ، ولتقييم كفاءة تخليق البروتين ، تم تحويل خلايا سلالات خروج المغلوب من rRNA MT وسلالة BW25113 (WT) باستخدام pRFPCERtet البلازميد. تم تخفيف الثقافات الليلية للمحولات ، في ثلاث نسخ لكل سلالة ، بواسطة LB مع أو بدون أنهيدروتتراسيكلين 0.2 ميكروغرام / مل إلى A600 0.01 في لوحة 96 بئر. تمت زراعة الخلايا بالاهتزاز المستمر عند 37 & # xb0C مع A تلقائي600 مراقبة كل 30 دقيقة بمحطة عمل جانوس (بيركين إلمر). تم قياس معدلات نمو سلالات خروج المغلوب من الرنا الريباسي MT ، والسلالة من النوع البري التي لم يتم تحويلها بواسطة أي بلازميد.

          لتقييم كفاءة تخليق البروتين CER و RFP ، نمت الخلايا المحولة بواسطة pRFPCERtet البلازميد في ثلاث نسخ لمدة 18 ساعة في 200 ul LB عند 37 & # xb0C مع أو بدون anhydrotetracycline 0.2 ميكروغرام / مل في صفيحة بئر عميقة 96 مع اهتزاز مستمر. بعد الحضانة ، تم الطرد المركزي للخلايا في صفيحة 96 بئر وغسلها مرتين باستخدام 0.9٪ كلوريد الصوديوم. تم قياس مضان الخلايا بواسطة قارئ لوحة Victor X5 (Perkin Elmer) عند 430/486 نانومتر لـ CER و 531/595 نانومتر لطلب تقديم العروض.

          لتحديد في الجسم الحي كفاءة تخليق البروتين ، تم تحويل خلايا سلالات خروج المغلوب من النوع البري و rRNA MT بواسطة البلازميد الذي يشفر بروتين FastFT تحت سيطرة محفز araBAD (Subach et & # xa0al. ، 2009). تم تخفيف الخلايا المزروعة في وسائط LB مع 10 ملي أرابينوز عند 37 & # xb0C بعد 48 ساعة بنسبة 1: 100 بواسطة وسائط LB جديدة مع 10 ملي مولار أرابينوز. تم أخذ قسامة في نقاط زمنية مختلفة تم عزل الخلايا عن طريق الطرد المركزي ، وغسلها مرتين بواسطة PBS المعقم ، وتحليلها بواسطة فارز الخلايا الفلوريسنت المنشط BD FACSAria III بأطوال موجية 405/460 نانومتر و 555/610 نانومتر.

          تم إجراء تحليل البروتين المقارن باستخدام 2D PAGE كما هو موصوف (Hoch et & # xa0al. ، 2015). تم استخدام ما لا يقل عن ثلاث مزارع نمت بشكل مستقل لكل سلالة بالضربة القاضية.

          تم إجراء تحليل البروتين المقارن للبندقية كما هو موصوف (Toprak et & # xa0al. ، 2014 Osterman et & # xa0al. ، 2015). باختصار ، الخلايا المعلقة في 0،75٪ w / w RapiGest SF (المياه) تم فصلها عن طريق الصوتنة. بعد إزالة الحطام ، تم تقليل روابط بروتين السيستين مع 10 ملي ديثيوثريتول وألكيلات مع 30 ملي يودواسيتاميد. تمت إضافة التربسين في نسبة 1/50 وزن / وزن من التربسين / البروتين وحضنت عند 37 & # xb0C بين عشية وضحاها. لإيقاف انحلال التربسين ، تمت إضافة حمض ثلاثي فلورو أسيتيك (TFA) إلى التركيز النهائي البالغ 0.5٪ حجم / حجم. تم تحلية الببتيدات وتعليقها في 3٪ أسيتونيتريل (ACN) ، 0.1٪ TFA ، إلى تركيز نهائي قدره 2 & # xb5g / & # xb5l. تم إجراء تحليل مطياف الكتلة على مطياف الكتلة TripleTOF 5600+ بمصدر أيون NanoSpray III (ABSciex ، كندا) مقترنًا بنظام NanoLC Ultra 2D + nano-HPLC (Eksigent). للتعرف على البروتين ، تم تحليل ملفات بيانات wiff باستخدام ProteinPilot 4.5 المراجعة 1656 (ABSciex) باستخدام خوارزمية البحث Paragon 4.5.0.0 1654 (ABSciex) ومجموعة قياسية من إعدادات التعريف للبحث في قاعدة بيانات SwissProt والأنواع الإشريكية القولونية.


          3. الاستنتاجات

          يمكن استخلاص العديد من الاستنتاجات من هذه الدراسات فيما يتعلق بالاستقرار النسبي والهياكل النسبية للحمض النووي الريبي مع النيوكليوتيدات المعدلة المفردة والمتعددة. اختلافات صغيرة قابلة للتكرار في قيم الطاقة المجانية لـ بكتريا قولونية تكشف المتغيرات h31 عن تأثيرات طفيفة مزعزعة للاستقرار من التعديلات التي تم إجراؤها على اللولب 31. T. ثيرموفيلوس كشفت 70S ribosome المركب بنموذج mRNA واثنين من tRNAs أن مواضع نيوكليوتيدات موقع 16S rRNA P في الريبوسوم الشاغر تتطابق جيدًا مع تلك الموجودة في المركب المحتوي على الحمض الريبي النووي النقال ، باستثناء m2 2 G966. 16 بقايا م2 2 G966 (م2G966 في بكتريا قولونية ribosomes) في التركيب البلوري لـ T. ثيرموفيلوس 70S الريبوسوم يحتوي على نموذج مرنا واثنين من الحمض النووي الريبي (الشكل 4 أ) 15 ، 16 أو لا يزال مكدسًا في الوحدة الفرعية الريبوسومية 30 ثانية من T. ثيرموفيلوس التركيب البلوري (الشكل 4 ب). يبدو أن التفاعل مع حلقة anticodon من الحمض الريبي النووي النقال المرتبط بموقع P قد استقر عن طريق تكديس التفاعلات التي تتضمن m2 2 G966 مع ريبوز 34. ومن ثم ، تم اقتراح القاعدة المقلوبة لتسهيل الوضع الصحيح للـ tRNA أثناء الترجمة. 16 ، 25 لذلك ، قد تكون التأثيرات المزعزعة للاستقرار الطفيفة للتعديلات في h31 مهمة لتسهيل حركة التقليب للبقايا 966 ولكن في نفس الوقت ، يتم تثبيت تفاعلات التراص مع الحمض الريبي النووي النقال من خلال مجموعة الميثيل. يتم وضعها في منتصف القواعد الثلاث المكدسة ، يكون لبقايا m 5 C967 تأثير مزعزع للاستقرار أكبر من م 2 G966 (ECh31M5C ضد. ECh31M2G). قد تكون هذه النتيجة ناتجة عن تعطل أكبر للتكديس بواسطة القاعدة الميثيلية لـ m 5 C967.

          تُظهر هياكل h31 المطابقات المقلوبة (A) والمكدسة (B) للبقايا G966 (معرفات انضمام PDB - 2J00 15 و 1FJF 22).

          تشير بيانات القرص المضغوط إلى أن RNAs غير المعدلة والمعدلة بشكل فردي والمعدلة بالكامل تحتوي جميعها على مناطق جذعية من النوع A وتعرض مطابقة مماثلة. تشير الاختلافات الطفيفة بين أطياف القرص المضغوط لبنى h31 المعدلة بالكامل وغير المعدلة إلى الاختلافات المحتملة في مناطق الحلقة. يمكن أن تنشأ هذه الاختلافات من التغييرات المعتمدة على التعديل في الحلقة ، مثل تغيير تكديس القاعدة في المواضع 966 و 967 و 968. ومع ذلك ، تكشف بيانات ذوبان الأشعة فوق البنفسجية أن وجود تعديلات في مواقع محددة لا يؤثر على قدرة يبني لتشكيل هياكل حلقة دبوس الشعر مستقرة.

          لا يزال الدور الوظيفي الدقيق للتعديلات في الموضعين 966 و 967 من h31 غير معروف. تنفذ الريبوسومات العملية الكيميائية الحيوية الأساسية للترجمة ، والتي تتطلب مجموعة رائعة من التفاعلات المحددة للغاية بين الرنا الريباسي ، الرنا المرسال ، الرنا المرسال ، والبروتينات الريبوزومية. يعتقد أن التعديلات تساعد في ضبط وظيفة الريبوسوم. 3 نظرًا لأن وظيفة الريبوسوم المناسبة تعتمد على التوازن الصحيح لسرعة ودقة ارتباط الحمض النووي الريبي ، وتشكيل رابطة الببتيد وإطلاق الحمض النووي الريبي ، يمكن أن تلعب الميثيل في h31 دورًا في الحفاظ على التفاعلات المناسبة داخل الريبوسوم. كشفت التحليلات الطفرية 36 ، 37 أن فقدان المثيلة في أي من الموضعين 966 أو 967 ، يؤدي إلى زيادة إنتاج البروتين بواسطة الريبوسومات الطافرة. لذا فإن بياناتنا تشير إلى أن الميثيل يزعزع استقرار h31 من أجل الحفاظ على التفاعلات المناسبة مع الحمض الريبي النووي النقال أو الرنا الريباسي أو البروتينات. يمكن أن يؤدي عدم وجود تعديل في المخلفات 966 أو 967 في h31 إلى تقليل قدرة القاعدة 966 على قلب وتنظيم تقارب الحمض الريبي النووي النقال أو تحديد المواقع أو الدقة. وبالتالي ، سيكون من المهم للغاية استكشاف العلاقة بين مثيلة G966 و C967 والإخلاص الانتقالي بمزيد من التفصيل. علاوة على ذلك ، فإن توافر طريقة مناسبة لتوليف m 2 G والفوسفوراميد المقابل له (غير متوفر تجاريًا) سيسمح بتوليد RNAs التي تحتوي على تعديلات m 2 G بكميات كبيرة بما يكفي لاستخدامها في دراسات إضافية للفيزياء الحيوية والربط.


          مناقشة

          كان لاستخدام CRISPR / Cas9 لتحرير الجينوم تأثير عميق في مجال البيولوجيا التركيبية ، والأهم من ذلك أنه يستمر في فتح طرق جديدة للطب متعدية مثل العلاجات الجينية 37. في هذه الدراسة ، استخدمنا إمكانات CRISPR / Cas9 والقدرة الفطرية على إعادة التركيب المتماثل للخميرة لهندسة الحمض النووي الريبي الريبوزومي ذي الوحدة الفرعية الصغيرة في الجينوم البكتيري لـ M. mycoides. علاوة على ذلك ، اختبرنا أيضًا وظيفة الطفرات التي تم إدخالها حديثًا عن طريق زرع الجينوم مع جين الرنا الريباسي 16S في المستلم. M. capricolum الخلايا 27. وهكذا ، تمكنا من إنشاء منصة هندسة الجينوم التي يمكن استخدامها لطفرات قوية وواسعة النطاق موجهة من الموقع مباشرة على الكروموسوم البكتيري بكفاءة تصل إلى 100٪.

          RNAs الريبوزومية هي واحدة من أكثر الجينات المحفوظة في جميع ممالك الحياة الثلاث ، والتي تؤكدها حقيقة أن RNA ذات الوحدة الفرعية الصغيرة تستخدم لقياس معدل تطور الكائنات الحية وتصنيفها نسبيًا وفقًا للاختلاف في تسلسل هذا الجين. بصرف النظر عن الطبيعة المحفوظة ، فإن هندسة 16S rRNA تمثل تحديًا كبيرًا أيضًا بسبب عدد نسخ جينات RNA الريبوزومية التي تتراوح بين 1 و 15 داخل المجال. بكتيريا 20. تم إثبات التكرار الوظيفي لنسخ مختلفة من الرنا الريباسي في عدد قليل من الأنواع eubacterial مثل بكتريا قولونية 21 و 22 و M. smegmatis 23 ، 24 وكذلك في حقيقيات النوى ، خميرة الخميرة 38 الذي مكّن من هندسة الكائنات ذات التجمعات المتجانسة من الريبوسومات المشفرة بوحدات نسخ مفردة. وبالتالي تم التحايل على مشكلة رقم النسخ باستخدام الكائنات الحية النموذجية مثل M. smegmatis، الذي يحتوي على نسختين فقط من جينات الرنا الريباسي 23 و 24 و بكتريا قولونية سلالات مع مشغل rRNA واحد مشفر من البلازميد أو الكروموسوم 21 ، 22. وبالمثل ، فإن M. mycoides يحمل الجينوم اثنين فقط من عوامل الرنا الريباسي ، والأهم من ذلك ، أن حذف عامل واحد لا يؤثر على قابلية الخلايا للحياة (هوتشيسون وآخرون. 29). ومن ثم ، هذا يجعل M. mycoides نموذج مثالي لهندسة الرنا الريباسي 16S والريبوسوم. ومع ذلك ، فإن الافتقار إلى الأدوات الجينية قد حد من استخدام M. mycoides باعتباره كائنًا نموذجيًا لدراسة العمليات البيولوجية الأساسية على الرغم من العديد من مآثر البيولوجيا التركيبية الرائدة التي تحققت باستخدام جينومها 25 ، 26 ، 27. أحد هذه الإنجازات ، وهو استنساخ الجينوم البكتيري بأكمله في الخميرة ، سمح لنا بتطبيق الأدوات الجينية المطورة في الخميرة على M. mycoides الجينوم ، مما يجعلها منصة متعددة الاستخدامات لتحرير الجينوم البكتيري. باستخدام القدرة الفريدة لهذه المنصة ، تمكنا من إنشاء نسخة من الجينوم تفتقر إلى جين الرنا الريباسي 16S الأساسي ، وهو أمر غير ممكن بواسطة التقنيات التقليدية. بعد ذلك ، تمت استعادة وظيفة هذا الجينوم غير الوظيفي باستخدام نسخة من الجين من النوع البري أو نسخة هندسية من الجين يمكن أن تدعم وظيفة الريبوسوم. بالإضافة إلى ذلك ، تمكنا من اختبار وظيفة الإصدارات المتعددة من جين 16S rRNA المصمم هندسيًا في تحول خميرة واحد وما تلاه M. mycoides حدث زرع الجينوم (الجدول التكميلي 1) ، وبالتالي خلق إمكانية اختبار وظيفي عالي الإنتاجية لمواقع متعددة من خلال هذه المنصة.

          لم يكن الهدف من هذه الدراسة هو الفهم المنهجي لما إذا كان كل جزء من M. mycoides rrs الجين ضروري لوظيفته. بدلا من ذلك ، تهدف دراستنا إلى استخدام M. mycoides الجينوم المستنسخ في الخميرة كمنصة لاستكشاف إمكانيات هندسة هذا الجين الأساسي من خلال تحديد المواقع التي يمكن إدخال تعديلات على التسلسل فيها ومدى إمكانية التسامح مع مثل هذه التعديلات. في هذه العملية ، وجدنا أن إدخال الحلزون المرتبط ببروتين الغلاف MS2 (MS2) كان أكثر العناصر غير المتجانسة تحملاً منذ خمسة من كل ستة تم تصميمها هندسيًا. rrs* لم يؤثر إجراء هذا التعديل في مواقع مختلفة على صلاحية الخلية. على وجه الخصوص ، في بكتريا قولونية، لم يؤثر إدخال MS2 في h6 على الجدوى ، ولكنه أدى فقط

          85٪ من الوحدات الفرعية الصغيرة الموسومة بـ MS2 عند تنقية التقارب 34. بالنظر إلى النتائج التي توصلنا إليها مع MS2 ، ربما لا يزال إدخال MS2 في مواقع متعددة في وقت واحد يسمح للريبوسومات كاملة الوظائف والجدوى الخلوية في بكتريا قولونية واستعادوا جزءًا أكبر بكثير من الوحدات الفرعية ذات العلامات MS2. وبالمثل ، فإن إدخال عنصر MS2 في مواقع متعددة في الرنا الريباسي للوحدة الفرعية الكبيرة يمكن أن يؤدي إلى تعداد سكاني أنقى مما لوحظ

          90٪ عند وضع علامة في موقع واحد 34. وتجدر الإشارة أيضًا إلى أن مشكلة عدم تجانس الطفرات غير المميتة يتم التحايل عليها في M. mycoides النظام الأساسي ، حيث تم القضاء تمامًا على الجين من النوع البري قبل إدخال جين الرنا الريباسي 16S المطفر.

          من المثير للاهتمام ملاحظة أن جميع المواقع الستة المختارة للهندسة (h6-h39) كانت قادرة على تحمل نوع واحد على الأقل من عنصر الإدراج (الشكل 3 أ) ، مما يشير إلى ذلك بالنسبة لـ rrs* حمل عمليات الإدخال التي لم تنتج عمليات زرع قابلة للحياة ، ولم يكن الموقع هو السبب في حد ذاته. ومع ذلك ، كان من الممكن أن يلعب سياق عناصر الإدراج دورًا في طي الرنا الريباسي بعد النسخ ، أو تعديلات ما بعد النسخ ، أو ارتباط البروتينات الريبوزومية أو استقرار الرنا الريباسي ، مما يؤثر على تجميع الوحدة الفرعية الصغيرة ووظيفتها ، وبالتالي قابلية البقاء الخلوية. على سبيل المثال ، تم إثبات أن إدخال & # x0201csynthetic helices & # x0201d يقلل بشكل متواضع من دقة الريبوسوم (أقل من شقين) فيما يتعلق بقراءة كود الإيقاف وإزاحة الإطارات 33. ومع ذلك ، فإن المعرفة الوظيفية التفصيلية لكيفية مساهمة كل من هذه الحلزونات الست في وظيفة الريبوسوم غير معروفة إلى حد كبير. يتم الحفاظ على السلامة الهيكلية وبالتالي ، يتم الحفاظ على وظائف اللولب الأصلي إلى حد كبير أثناء إضافة العناصر غير المتجانسة ، بينما تنحرف بدائل اللولب بشكل كبير في التسلسل وبالتالي في بنية اللولب (الشكل 2 ب ، د). يمكن أن يفسر هذا سبب كون معظم بدائل اللولب الكاملة مميتة فقط بنسبة 2/12 من البدائل اللولبية المفردة التي أنتجت عمليات زرع قابلة للحياة بدلاً من إدخال اللولب 11/18. على العكس من ذلك ، لاحظنا فقدان الصلاحية عندما تم إدخال عنصرين مختلفين للإدخال في موقعين مختلفين في وقت واحد (الشكل 3 ب) ، على الرغم من أننا لاحظنا قابلية البقاء عندما تم استبدال كل من h17 و h39 في وقت واحد مع العناصر الموجودة في B. الرقيقة و بكتريا قولونية، على التوالي (الموقع الثلاثي الهندسي rrs* التي كانت وظيفية حملت هذين الاستبدلين ، الشكل 3 ج).

          بينما تمت تجربة عناصر الإدراج واختبارها بالفعل في بكتريا قولونية 33 ، 34 ، 35 ، 36 ، كان لا يزال من المدهش أن نلاحظ أن العديد من هذه الإضافات أحادية الموقع كانت قادرة على دعم قابلية البقاء ، بالنظر إلى المسافة التطورية 16S rRNA الكبيرة بين بكتريا قولونية و M. mycoides (الشكل التكميلي 3). والأكثر إثارة للإعجاب ، تمكنا من إنشاء وظائف وظيفية rrs* مصمم هندسيًا في ما يصل إلى ثلاثة مواقع (الشكل 3 ج) داخل الجين بتصميم دقيق ، والذي يوضح بوضوح المرونة التي توفرها بنية 16S rRNA. يمكن استغلال هذه المرونة لإضافة وظائف جديدة إلى آلية الترجمة مثل التعامد وأيضًا لدراسة وظائف الريبوسوم المركزية مثل البدء وفك التشفير عن طريق إدخال الطفرات. وتجدر الإشارة أيضًا إلى أنه تم اختبار جميع المتغيرات أحادية وثنائية وثلاثية المواقع على M. mycoides rrs التي حملت بالفعل سبع طفرات من M. capricolum rrs الجين. من المحتمل أنه ربما تم تصميم المزيد من هؤلاء rrs* كان من الممكن أن تكون وظيفية لو تم اختبارها في سياق النوع البري M. mycoides rrs الجين ، مما يؤكد الفائدة المحتملة لهذه المنصة لتوليد ودراسة طفرات الوحدات الفرعية الصغيرة.

          ركزت جهودنا بشكل أساسي على تقييم ما إذا كان مصممًا rrs* يمكن أن تدعم إنتاج قابلة للحياة M. mycoides الخلايا بعد زرع الجينوم. النمط الظاهري الذي يمكن ملاحظته بسهولة لهندسة الرنا الريباسي هو عيب النمو الناتج عن الطفرات التي تم إدخالها. من المتصور أن تحمل بعض عمليات الزرع هندسيًا rrs* تنمو ببطء عند الزراعة ، وهو ما قد يفسر في بعض الحالات سبب عدم إنتاج الطفرات التي أنتجت عمليات زرع بشكل فردي. M. mycoides الخلايا عند دمجها (الشكل 3 أ و # x02013C). يمكن استخدام هذه المسوخات بطيئة النمو لدراسة عمليات مثل الطي 16S rRNA والاستقرار ونضج الوحدة الفرعية الصغيرة.

          في الختام ، فإن M. mycoides المنصة الموصوفة هنا يمكن أن تمكن من اختبار الإنتاجية العالية لنسخ مختلفة مطفرة من أي جين أساسي لأن الإصدارات الوظيفية فقط يمكنها استعادة قدرة الجينوم على إنتاج خلايا قابلة للحياة عند زرع الجينوم. وبالتالي ، يمكن تطبيق هذا النظام الأساسي لفهم وظيفة مناطق مختلفة من الرنا الريباسي 16S ويمكن توسيعه ليشمل الوحدة الفرعية الكبيرة من الحمض النووي الريبي والعوامل الريبوزومية وخارج الريبوزومية والجينات الأساسية الأخرى المشاركة في العمليات البيولوجية الأساسية للإجابة على الأسئلة الأساسية الحياة.


          نقاش

          RNAs الريبوزومية هي المكونات الرئيسية لآلية الترجمة ويتم تصنيعها بمستويات عالية لتلبية المتطلبات الخلوية لتخليق البروتين ، خاصة في ظل ظروف النمو السريع (24). ومع ذلك ، فإن وصفًا للمسارات التي تؤدي إلى توليد الرنا الريباسي الناضج في بكتريا قولونية ظلت غير مكتملة على الرغم من أن الخطوات الأولية لمعالجة الرنا الريباسي تم تحديدها منذ ما يقرب من 50 عامًا. استنادًا إلى الأدلة التي تشير إلى أن الرنا الريباسي 5S يخضع لنضج 5′ نهاية باستخدام آلية تحلل خارجية النوى 5 إلى 3 ، قمت بفحص سلالة تفتقر إلى RNase AM ، 5 إلى 3 نوكلياز خارجي ، ووجدت أن النضج 5 نهاية من يتم تنفيذ 5S rRNA بواسطة هذا الإنزيم على حد سواء في الجسم الحي و في المختبر (شكل 1). لقد وجدت أيضًا أن RNase AM مسؤول عن نضوج 5′-end لـ 23S rRNA ، لكن هذا الإنزيم يزيل فقط النوات الثلاث الأخيرة من بقايا السلائف السبعة ، مما يشير إلى وجود إنزيم آخر يزيل النواتج الأربعة السابقة (الشكل 2) . أخيرًا ، وجدت أن RNase AM يولد نهاية 5 ناضجة من 16S rRNA (الشكل 4). نُسبت هذه العملية إلى RNase G ، ولكن يتضح هنا أن منتج انشقاق RNase G يحتفظ بثلاثة nts غير معالجة ، والتي تتم إزالتها بعد ذلك بواسطة RNase AM. لماذا يجب أن يزيل RNase AM ثلاثة نتوءات غير معالجة بدقة من كل من الرنا الريباسي لا يزال غير واضح. Nonetheless, the identification of the enzyme that matures the 5' end of these rRNAs, in conjunction with the previously identified enzymes responsible for 3′-end maturation, now provides a full description of the enzymes that generate mature ends for each of the three rRNAs in بكتريا قولونية.

          Due to the high levels of ribosomes that are required for growth, a significant proportion of transcription, and therefore, of the energy generated by a cell, is used for rRNA synthesis. A question of interest is how rRNA degradation, which would contribute to inefficiencies in energy utilization, is minimized given a cellular environment that contains multiple RNases. It has been shown that once complete ribosomes are formed, rRNA becomes extraordinarily stable in the assembled form ( 25), but a small proportion of rRNA does get degraded during the assembly process ( 26, 27). One factor that limits more extensive rRNA degradation during the assembly process could be through a restriction of the activity of rRNA processing enzymes to late stages of rRNA assembly, where over-digestion can be curbed by the presence of ribosomal proteins or rRNA structures that form during the assembly process. Supporting this view, I found that RNase AM maturation of 5S and 23S rRNA occurs not only more efficiently, but also with greater accuracy on ribosomal particles as compared to purified rRNA (Figure 1D and 2C). In the case of 23S rRNA, RNase AM processing was observed to occur at a late stage of assembly when 50S particles join with 30S particles to form the complete ribosome (Figure 3G). Similarly, it has been shown that processing of the 5S and 23S rRNAs at their 3′ ends by RNase T is also more efficient on ribosomal particles, as compared to free RNA ( 8, 9). Identifying the mechanisms through which the activity of the processing RNases is restricted on free rRNA and/or channeled to ribosomal particles will be a topic of interest for the future.

          We had previously provided experimental evidence that the 5′ and 3′ ends of 23S rRNA undergo maturation at similar rates under different growth conditions, and based on those observations, we suggested that the processing of the two ends might be coupled ( 19). This hypothesis was tested by using ΔyciV و ΔrnbΔrph strains to inhibit processing at the 5′ or 3′ ends, respectively. These analyses revealed that in a ΔrnbΔrph strain, 5′-end precursors accumulate to the same extent as 3′-end precursors, suggesting that 3′-end maturation occurs first and is necessary for processing at the 5′ end (Figure 3). Similarly, work on 16S rRNA has suggested that processing at one end facilitates maturation at the other end ( 10, 28). Thus, the coupled processing of 3′ and 5′ ends may be a common feature of bacterial rRNAs, with potential relevance for increasing the efficiency of rRNA maturation at both ends.

          Paralogs of RNase AM are found in a wide variety of organisms, including many other Gram-negative and positive bacteria, archaea and lower eukaryotes. However, the model Gram-positive bacterium, العصوية الرقيقة lacks an RNase AM homolog. In this case, 5′-end maturation of the three rRNAs each proceeds through a different set of mechanisms, involving the enzymes Mini-III for 23S rRNA, RNase J1 for 16S rRNA and RNase M5 for 5S rRNA maturation ( 29–31). Interestingly, in some members of the delta-proteobacteria, RNase AM paralogs are found in fusion with RNase III, which suggests that multiple steps of rRNA processing might be performed by the same enzyme in these organisms. Future studies on this enzyme will be needed to clarify the rRNA maturation role of RNase AM in all domains of life. In summation, the findings described here provide answers to decades-old questions regarding the mechanism of 5′-end maturation of the بكتريا قولونية rRNAs, complete the roster of the RNases required to yield mature rRNAs and describe the first biological function for a 5′ to 3′ RNA exonuclease in this organism.


          شاهد الفيديو: 16s rRNA (كانون الثاني 2022).