معلومة

هل ينتهي النسخ بنهاية جينات مقاومة المضادات الحيوية على بلازميدات تعبير الثنائي؟


أنا أعمل مع البلازميدات pETDuet و pRSFDuet للتعبير عن الحمض النووي الريبي تحت سيطرة مروج T7. في هذه البلازميدات ، تكون جينات مقاومة المضادات الحيوية (Amp for pET و Kan for pRSF) في اتجاه مجرى موقع المروج T7 حيث قمت باستنساخ جيناتي. يتم نسخ جينات Amp و Kan في الاتجاه المعاكس لمحفز T7 وبما أن هذه الجينات هي في اتجاه مجرى النهر من حيث أدخلت جيناتي ، فإن القراءة من خلال النسخ من جينات المقاومة ستؤدي إلى تسلسل مكمل لتسلسل الحمض النووي الريبي الذي أرغب في إنتاجه. سؤالي هو: هل تمتلك جينات مقاومة المضادات الحيوية في هذه البلازميدات آلية إنهاء النسخ؟

لقد استخدمت أداة ARNold: http://rssf.i2bc.paris-saclay.fr/toolbox/arnold/index.php للبحث عن أجهزة الإنهاء المستقلة Rho في الطرف 3 من جينات مقاومة المضادات الحيوية وفي المنطقة المصبّة . كانت هناك ضربة واحدة للبلازميد pETDuet ولكن لا شيء للبلازميد pRSFDuet. لم تكن هناك ضربات لـ pCDFDuet أو pCOLADuet البلازميدات أيضًا. إحساسي هو أن نهايات دبوس الشعر لم يتم دمجها على وجه التحديد لإيقاف نسخ الجينات المقاومة للمضادات الحيوية في اتجاه مجرى النهر. الاحتمال الآخر هو أن جينات مقاومة المضادات الحيوية تنتهي بطريقة تعتمد على Rho ، فهل من المعروف أن هذا يحدث لجينات Amp و Kan؟


بشكل عام ، يفعلون ذلك ، لكن هذا غالبًا لا يوقف تشغيل النسخ تمامًا.

لاحظ أنه في تفاعل T-7 لا ينبغي أن يكون هناك أي نسخ لجينات Amp أو Kan حيث يتم تشغيل هذه الجينات من المروجين التي لن تتمكن بوليميريز T7 phage RNA من نسخها لأنها خاصة للغاية لمروج T7 .

الحل إذا كنت قلقًا حقًا هو جعل البلازميد الخاص بك خطيًا على الفور في اتجاه مجرى التيار الخاص بك ولكن قبل جين AMPR باستخدام إنزيم تقييد بقطع واحد. سيعطيك هذا أيضًا تسلسل حجم معين يتم نسخه ، وهو أمر مفيد للغاية إذا كنت تحدد رقم النسخة في qPCR.


74 النسخ بدائية النواة

بنهاية هذا القسم ، ستكون قادرًا على القيام بما يلي:

  • قائمة الخطوات المختلفة في النسخ بدائية النواة
  • ناقش دور المحفزات في النسخ بدائية النواة
  • صف كيف ومتى يتم إنهاء النسخ

بدائيات النوى ، والتي تشمل البكتيريا والعتائق ، هي في الغالب كائنات وحيدة الخلية تفتقر ، بحكم التعريف ، إلى نوى مرتبطة بالغشاء وعضيات أخرى. الكروموسوم البكتيري عبارة عن دائرة مغلقة ، على عكس الكروموسومات حقيقية النواة ، لا يتم تنظيمها حول بروتينات هيستون. المنطقة المركزية للخلية التي يقيم فيها DNA بدائية النواة تسمى المنطقة النووية. بالإضافة إلى ذلك ، غالبًا ما تحتوي بدائيات النوى على بلازميدات وفيرة ، وهي عبارة عن جزيئات DNA دائرية أقصر قد تحتوي على جين واحد أو عدد قليل من الجينات. يمكن نقل البلازميدات بشكل مستقل عن الكروموسوم البكتيري أثناء انقسام الخلية وغالبًا ما تحمل سمات مثل تلك المرتبطة بمقاومة المضادات الحيوية.

يتطلب النسخ في بدائيات النوى (وفي حقيقيات النوى) أن يزيل الحلزون المزدوج للحمض النووي جزئيًا في منطقة تخليق الرنا المرسال. تسمى منطقة الفك فقاعة النسخ. دائمًا ما يتم النسخ من نفس خيط الحمض النووي لكل جين ، وهو ما يسمى بضفيرة القالب. يُعد منتج mRNA مكملًا لقالب القالب وهو مطابق تقريبًا لشريط الحمض النووي الآخر ، الذي يُطلق عليه اسم الخيط غير القوالب ، أو خيط الترميز. الاختلاف الوحيد في النوكليوتيدات هو أنه في mRNA ، يتم استبدال جميع النيوكليوتيدات T بالنيوكليوتيدات U ((الشكل)). في الحلزون المزدوج للحمض النووي الريبي ، يمكن لـ A أن تربط U عبر رابطتين هيدروجينيتين ، تمامًا كما هو الحال في الاقتران A-T في حلزون مزدوج للحمض النووي.


يُطلق على زوج النيوكليوتيدات في الحلزون المزدوج للحمض النووي الذي يتوافق مع الموقع الذي يُنسخ منه أول 5 & # 8242 mRNA nucleotide موقع +1 ، أو موقع البدء. يُشار إلى النيوكليوتيدات التي تسبق موقع البدء بالرمز "-" ويتم تحديدها النيوكليوتيدات المنبع. على العكس من ذلك ، يُشار إلى النيوكليوتيدات التي تتبع موقع البدء بترقيم "+" ويتم استدعاؤها النيوكليوتيدات المصب.

بدء النسخ في بدائيات النوى

لا تحتوي بدائيات النوى على نوى محاطة بالغشاء. لذلك ، يمكن أن تحدث جميع عمليات النسخ والترجمة وتدهور الرنا المرسال في وقت واحد. يمكن تضخيم المستوى داخل الخلايا للبروتين البكتيري بسرعة من خلال أحداث النسخ والترجمة المتعددة التي تحدث بشكل متزامن على نفس قالب الحمض النووي. الجينومات بدائية النواة مضغوطة للغاية ، وغالبًا ما تغطي النسخ بدائية النواة أكثر من جين أو كسترون (تسلسل ترميز لبروتين واحد). يتم بعد ذلك ترجمة الرنا المرسال متعدد الكريات لإنتاج أكثر من نوع واحد من البروتين.

مناقشتنا هنا ستجسد النسخ من خلال وصف هذه العملية في الإشريكية القولونية، من الأنواع eubacterial مدروسة جيدًا. على الرغم من وجود بعض الاختلافات بين النسخ في بكتريا قولونية والنسخ في العتائق ، فهم بكتريا قولونية يمكن تطبيق النسخ على جميع الأنواع البكتيرية تقريبًا.

بدائية النواة بوليميريز الحمض النووي الريبي

تستخدم بدائيات النوى نفس بوليميريز الحمض النووي الريبي لنسخ جميع جيناتها. في بكتريا قولونية، يتكون البوليميراز من خمس وحدات فرعية متعددة الببتيد ، اثنتان منها متطابقتان. يتم الإشارة إلى أربعة من هذه الوحدات الفرعية α, α, β، و β& # 8216 ، يتألف من إنزيم لب البوليميراز. تتجمع هذه الوحدات الفرعية في كل مرة يتم فيها نسخ الجين ، وتتفكك بمجرد اكتمال النسخ. كل وحدة فرعية لها دور فريد من نوعه α- الوحدات الفرعية ضرورية لتجميع البوليميراز على الحمض النووي β- ترتبط الوحدة الفرعية بثلاثي فوسفات الريبونوكليوزيد الذي سيصبح جزءًا من جزيء الرنا المرسال الناشئ و β& # 8216 تربط الوحدة الفرعية حبلا قالب الحمض النووي. الوحدة الفرعية الخامسة ، σ، يشارك فقط في بدء النسخ. إنه يمنح خصوصية نسخية مثل أن يبدأ البوليميراز في تصنيع الرنا المرسال من موقع بدء مناسب. بدون σ، فإن الإنزيم الأساسي سينسخ من مواقع عشوائية وينتج جزيئات الرنا المرسال التي تحدد بروتين gibberish. يُطلق على البوليميراز المكون من جميع الوحدات الفرعية الخمس اسم holoenzyme.

محفزات بدائية النواة

المحفز هو تسلسل DNA تقوم عليه آلية النسخ ، بما في ذلك RNA polymerase ، بربط وبدء النسخ. في معظم الحالات ، توجد المحفزات في بداية الجينات التي تنظمها. يعد التسلسل المحدد للمحفز مهمًا جدًا لأنه يحدد ما إذا كان الجين المقابل يتم نسخه طوال الوقت ، أو في بعض الأوقات ، أو بشكل غير متكرر. على الرغم من اختلاف المروجين بين جينومات بدائية النواة ، إلا أن بعض العناصر محفوظة تطوريًا في العديد من الأنواع. في -10 و -35 منطقة المنبع من موقع البدء ، هناك نوعان تسلسل توافق المروج، أو المناطق المتشابهة عبر جميع المروجين وعبر الأنواع البكتيرية المختلفة ((الشكل)). يحتوي التسلسل -10 ، المسمى بالمنطقة -10 ، على تسلسل إجماع TATAAT. يحتوي التسلسل -35 على التسلسل الإجماعي TTGACA. يتم التعرف على تسلسلات الإجماع هذه والالتزام بها σ. بمجرد إجراء هذا التفاعل ، ترتبط الوحدات الفرعية للإنزيم الأساسي بالموقع. تسهل منطقة A-T-rich -10 فك قالب الحمض النووي ، ويتم تصنيع العديد من روابط الفوسفوديستر. تنتهي مرحلة بدء النسخ بإنتاج نسخ فاشلة ، وهي عبارة عن بوليمرات من حوالي 10 نيوكليوتيدات يتم تصنيعها وإطلاقها.


اعرض هذه الرسوم المتحركة MolecularMovies لمشاهدة الجزء الأول من النسخ وتكرار التسلسل الأساسي لمربع TATA.

استطالة وإنهاء في بدائيات النوى

تبدأ مرحلة استطالة النسخ بإطلاق σ الوحدة الفرعية من البوليميراز. تفكك σ يسمح للإنزيم الأساسي بالمضي قدمًا على طول قالب الحمض النووي ، وتوليف mRNA في الاتجاه 5 & # 8242 إلى 3 & # 8242 بمعدل 40 نيوكليوتيد تقريبًا في الثانية. مع استمرار الاستطالة ، يتم فك الحمض النووي باستمرار قبل الإنزيم الأساسي ويعود خلفه. الاقتران الأساسي بين DNA و RNA ليس مستقرًا بدرجة كافية للحفاظ على استقرار مكونات تخليق mRNA. بدلاً من ذلك ، يعمل بوليميراز الحمض النووي الريبي كحلقة وصل مستقرة بين قالب الحمض النووي وخيوط الحمض النووي الريبي الوليدة لضمان عدم انقطاع الاستطالة قبل الأوان.

إشارات إنهاء بدائية النواة

بمجرد نسخ الجين ، يحتاج البوليميراز بدائية النواة إلى أن ينفصل عن قالب الحمض النووي وتحرر mRNA المصنوع حديثًا. اعتمادًا على الجين الذي يتم نسخه ، هناك نوعان من إشارات الإنهاء. أحدهما يعتمد على البروتين والآخر يعتمد على الحمض النووي الريبي. يتم التحكم في الإنهاء المعتمد على Rh بواسطة بروتين rho ، الذي يتتبع على طول خلف البوليميراز في سلسلة mRNA المتنامية. بالقرب من نهاية الجين ، يصادف البوليميراز سلسلة من النيوكليوتيدات G على قالب الحمض النووي ويتوقف. نتيجة لذلك ، يصطدم بروتين rho بالبوليميراز. يؤدي التفاعل مع rho إلى إطلاق mRNA من فقاعة النسخ.

يتم التحكم في الإنهاء المستقل عن عامل Rh عن طريق تسلسلات محددة في حبلا قالب الحمض النووي. عندما يقترب البوليميراز من نهاية الجين الذي يتم نسخه ، فإنه يصادف منطقة غنية بالنيوكليوتيدات C-G. ينثني الرنا المرسال مرة أخرى على نفسه ، وتتحد نيوكليوتيدات C-G التكميلية معًا. والنتيجة هي دبوس شعر مستقر يتسبب في توقف البوليميراز بمجرد أن يبدأ في نسخ منطقة غنية بالنيوكليوتيدات A-T. تشكل منطقة U – A التكميلية لنسخة mRNA تفاعلًا ضعيفًا فقط مع قالب DNA. هذا ، إلى جانب البوليميراز المتوقف ، يؤدي إلى عدم استقرار كافٍ للإنزيم الأساسي للانفصال وتحرير نسخة الرنا المرسال الجديدة.

عند الإنهاء ، تكتمل عملية النسخ. بحلول الوقت الذي يحدث فيه الإنهاء ، كان من الممكن بالفعل استخدام نسخة بدائية النواة لبدء تخليق نسخ عديدة من البروتين المشفر لأن هذه العمليات يمكن أن تحدث بشكل متزامن. من الممكن توحيد النسخ والترجمة وحتى تحلل الرنا المرسال لأن كل هذه العمليات تحدث في نفس الاتجاه 5 & # 8242 إلى 3 & # 8242 ، وبسبب عدم وجود تجزئة غشائية في الخلية بدائية النواة ((الشكل)). في المقابل ، فإن وجود نواة في الخلايا حقيقية النواة يحول دون النسخ والترجمة المتزامنين.


قم بزيارة هذه الرسوم المتحركة من BioStudio لمشاهدة عملية النسخ بدائية النواة.

ملخص القسم

في بدائيات النوى ، يبدأ تخليق الرنا المرسال في تسلسل محفز على قالب الحمض النووي الذي يشتمل على تسلسلين إجماعيين يقومان بتجنيد بوليميراز الحمض النووي الريبي. يتكون البوليميراز بدائية النواة من إنزيم أساسي مكون من أربع وحدات فرعية بروتينية و a σ البروتين الذي يساعد فقط في البدء. الاستطالة تصنع mRNA في الاتجاه 5 & # 8242 إلى 3 & # 8242 بمعدل 40 نيوكليوتيد في الثانية. يحرر الإنهاء الرنا المرسال ويحدث إما عن طريق تفاعل بروتين rho أو عن طريق تكوين دبوس الشعر mRNA.

راجع الأسئلة

أي وحدة فرعية من بكتريا قولونية البوليميراز يضفي خصوصية على النسخ؟

تسمى المناطق -10 و -35 من المحفزات بدائية النواة بتسلسلات الإجماع لأن ________.

  1. هم متطابقون في جميع الأنواع البكتيرية
  2. هم متشابهون في جميع الأنواع البكتيرية
  3. كانت موجودة في جميع الكائنات الحية
  4. لديهم نفس الوظيفة في جميع الكائنات الحية

ثلاثة أنواع مختلفة من البكتيريا لها التسلسلات الإجماعية التالية للجين المحفوظ.

الأنواع أ الأنواع ب الأنواع ج
-10 تاعتات تتات تاتات
-35 تجاكا TTGGCC تججا

اطلب البكتيريا من الأكثر إلى الأقل كفاءة في بدء نسخ الجينات.

أسئلة التفكير النقدي

إذا كان mRNA مكملاً لشريط قالب الحمض النووي وشريط قالب الحمض النووي مكملًا لشريط الحمض النووي غير المصطنع ، فلماذا لا تتطابق التسلسلات الأساسية للـ mRNA والحبال غير القوالب للحمض النووي؟ هل يمكن أن يكونوا؟

يختلف الحمض النووي عن الحمض النووي الريبي في أن النيوكليوتيدات التائية في الحمض النووي يتم استبدالها بنكليوتيدات يو في الحمض النووي الريبي. لذلك ، لا يمكن أن تكون متطابقة في التسلسل الأساسي.

بكلماتك الخاصة ، صِف الفرق بين الإنهاء المعتمد على rho والإنهاء المستقل للنسخ في بدائيات النوى.

يتم التحكم في الإنهاء المعتمد على Rh بواسطة بروتين rho ، الذي يتتبع على طول خلف البوليميراز في سلسلة mRNA المتنامية. بالقرب من نهاية الجين ، يتوقف البوليميراز عند سلسلة من النيوكليوتيدات G على قالب الحمض النووي. يصطدم بروتين rho بالبوليميراز ويطلق mRNA من فقاعة النسخ. يتم التحكم في الإنهاء المستقل عن عامل Rh عن طريق تسلسلات محددة في حبلا قالب الحمض النووي. عندما يقترب البوليميراز من نهاية الجين الذي يتم نسخه ، فإنه يصادف منطقة غنية بالنيوكليوتيدات C-G. ينتج عن هذا دبوس شعر مرنا يتسبب في توقف البوليميراز بشكل صحيح حيث يبدأ في نسخ منطقة غنية بالنيوكليوتيدات A-T. نظرًا لأن روابط A – U أقل ثباتًا للحرارة ، فإن الإنزيم الأساسي يتلاشى.

يقرأ جزء من الحمض النووي البكتيري:

3 "–TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5"

بافتراض أن هذا الجزء هو خيط القالب ، ما هو تسلسل الرنا المرسال الذي سيتم نسخه؟ (تلميح: تأكد من تحديد موقع البدء.)

من خلال فحص تسلسل الحمض النووي ، يمكننا أن نرى أن هناك تسلسل إجماع -10 بالقرب من نهاية الجزء 3. إذا عدنا بعد ذلك إلى المصب ، فإن موقع البدء +1 هو T مباشرة بعد التسلسل AAT. هذا يعني أن جزء الحمض النووي الذي سيكون بمثابة قالب للنسخ له تسلسل TGATAGAAGCACTCTAC. سيكون للحمض النووي الريبي المصنوع من هذا القالب إقران أساسي مجاني مع اليوراسيل (U) بدلاً من الثايمين (T). هذا يعطينا ACUAUCUUCGUGAGAUG كتسلسل mRNA المكتوب.

قائمة المصطلحات


خلفية

يعد الالتفاف الفائق للحمض النووي المتغير مبدأًا أساسيًا في التحكم في التعبير الجيني في البكتيريا [1،2،3،4]. عادة ما يتم لف الحمض النووي بشكل سلبي في الخلايا البكتيرية لأنه يحتوي على عجز في المنعطفات الحلزونية [5،6،7]. في شكله B ، تجعل خيوط الحمض النووي المزدوج دورة كاملة كل 10.5 زوجًا أساسيًا. تؤدي زيادة وتيرة الدوران إلى شد الازدواج وينتج عنه التواء إيجابي حيث يلتف محور اللولب المزدوج حول نفسه بحثًا عن الحد الأدنى من تشكّل الطاقة. إزالة المنعطفات من خلال اللف السفلي على الوجهين له تأثير معاكس ، مما يتسبب في التواء المزدوج بشكل سلبي. إذا لم يكن الحمض النووي تحت أو مجوفًا ، فإنه يتبنى تشكلاً مسترخياً [8].

يعاني الحمض النووي تحت الجرح من الإجهاد الالتوائي الذي يتم تحييده عادةً عن طريق لف الحمض النووي حول البروتينات لتقييد الملفات الفائقة ، عن طريق السماح للحمض النووي المزدوج بالتلوي و / أو عن طريق السماح لبعض أزواج القواعد المرتبطة بالهيدروجين بالانفصال [8]. في البكتيريا الحية ، يتم استخدام جميع الحلول الثلاثة. يربط الحمض النووي مجموعة متنوعة من البروتينات التي يمكن أن تقيد اللفائف الفائقة والبروتينات المرتبطة بالنوكليويد لها دور خاص في توفير هذه الوظيفة [9]. في أي وقت من دورة النمو ، يكون حوالي 40٪ من الحمض النووي في الجينوم البكتيري خاليًا من البروتين ويمكن أن يشارك في الالتفاف الفائق من خلال تكوين plectonemes DNA ، أو أجزاء من DNA متشابك ، أو مضفر ، مزدوج الشريطة (الشكل 1). ) [10]. يساعد كسر روابط الهيدروجين بين أزواج القواعد بسبب الإجهاد الالتوائي في عمليات مثل النسخ ، حيث يكون توليد فقاعات مفردة الجديلة في الحمض النووي المزدوج الشريطة أمرًا ضروريًا. يوفر هذا المطلب رابطًا ميكانيكيًا واحدًا بين النسخ واللف الفائق للحمض النووي.

نموذج مجال فائق مزدوج. هذا هو النموذج الذي اقترحه Liu and Wang (1987) ودعمته العديد من التجارب المستقلة. تشارك بوليميراز الحمض النووي الريبي الأساسي في استطالة النسخ: يتم حذف الرنا المرسال والريبوسومات والبولي ببتيد الناشئ من أجل الوضوح. عندما ينتقل مجمع النسخ والترجمة المقترنين من اليسار إلى اليمين ، يصبح قالب الحمض النووي أمامه فوق الجرح (فركونات فائق الالتفاف إيجابيًا) بينما يصبح الحمض النووي الموجود خلفه تحت الجرح (فركتونات فائقة الالتفاف سلبيًا). سيؤدي هذا الموقف إلى إيقاف النسخ نظرًا لانحشار الآلات بسبب: (أ) لا يمكن إزالة مجالات الحمض النووي الملفوف عن طريق انتشار الملف الفائق بسبب وجود حواجز طوبولوجية (المجالات السوداء في نهايات الحمض النووي) و (ب) لا يمكن لمركب الترجمة الضخم أن يدور حول الحمض النووي لتخفيف التوتر الالتوائي في الحمض النووي المزدوج. بدلاً من ذلك ، فإن DNA gyrase تزيل الملفات الفائقة الإيجابية بينما يتم تخفيف العناصر السلبية بواسطة DNA topoisomerases I و / أو IV. يمكن أن يؤدي التداخل مع عمليات الاسترخاء هذه إلى نتائج غير مرغوب فيها ، مثل تكوين حلقة R (الشكل 2). يمكن أن تنشأ الحواجز الطوبولوجية بسبب الاصطدامات المعقدة للنسخ وجهاً لوجه وعن طريق الاصطدامات بين البدائل المتقاربة ومجمعات النسخ التي يمكن إنتاجها بواسطة مجمعات البروتين النووي والتشوهات (مثل الانحناءات الحادة) في مزدوج الحمض النووي. تمثل الأسهم البيضاوية في الجزء السفلي من الشكل حلول دورانية محتملة لهذه المشاكل الطوبولوجية: يتم استبعاد كل من هذه الحلول (الخطوط الحمراء) لأن دوران الحمض النووي و / أو مجمع النسخ لا يمكن أن يحدث ، للأسباب التي تم تلخيصها في (أ) و (ب) فوق

ينشأ ارتباط آخر من قدرة طوبولوجيا الحمض النووي على التأثير في عرض المحفزات ومواقع الارتباط المرتبطة ببروتينات تنظيم النسخ إلى بوليميراز الحمض النووي الريبي وعوامل النسخ ، على التوالي. يمكن أن يؤدي التواء وحلقات الحمض النووي إلى تقريب المواقع الموجودة على طول الجزيء من بعضها البعض لتعزيز أو منع تكوين مجمعات النسخ المغلقة أو أزمرتها لفتح المجمعات [11].

يتضمن تكوين معقد النسخ المفتوح توليد فقاعة مفردة الجديلة في الحمض النووي ، وهي عملية تزيل تحريف الحمض النووي المحلي. مع بدء استطالة النسخ ، يصبح الحمض النووي الموجود في اتجاه مجرى معقد النسخ ملتفًا بينما يصبح ذلك في منطقة المنبع تحت الجرح (الشكل 1). تُظهر هذه الأحداث أن فعل استطالة النسخ هو مولد للالتفاف الفائق للحمض النووي [12 ، 13 ، 14]. يعد التخلص من الملفات الفائقة أمرًا ضروريًا إذا كان الاستطالة سيستمر ، وإلا فإن مجمع النسخ سيتكدس ، سيشكل النص الناشئ أزواجًا أساسية مع قالب الحمض النووي الخاص به لإنتاج حلقة R ، مما يؤدي إلى توقف بوليميريز الحمض النووي الريبي أو حتى التراجع قبل موقع إنهاء النسخ في نهاية الجين يمكن الوصول إليه (الشكل 2) [15]. يتفاقم تأثير استطالة النسخ على طوبولوجيا الحمض النووي المحلي عندما يتم إنشاء نسخ طويلة جدًا ، كما هو الحال مع أوبرا ترميز الحمض النووي الريبي الريبوزومي والمكونات الأخرى لجهاز الترجمة. في هذه الحالات ، يصبح التأثير على بنية الكروموسوم قابلاً للاكتشاف باستخدام طرق التقاط التشكل الصبغي (الشكل 3) [16].

الالتفاف الفائق السلبي للحمض النووي وتشكيل حلقة R أثناء النسخ.عندما يقرأ بوليميراز الحمض النووي الريبي (الأخضر) قالبًا من الحمض النووي الغني بـ G + C وأكشاكه ومساراته الخلفية ، فإنه يترك مجالًا شديد الالتفاف شديد السلبية خلفه. قد يسمح توقف النسخ المرتبط بنسخ الحمض النووي الريبي (الأحمر) بالزوج الأساسي مع حبلا قالب الحمض النووي الخاص به (الأزرق) ، تاركًا الشريط غير المنسوخ كفقاعة مفردة الجديلة. تشمل العوائق الأخرى لتطور بوليميراز الحمض النووي الريبي التصادمات المباشرة مع وحدات النسخ الأخرى أو مع البدائل (يتم تمثيل الحاجز بالخط المنقط الرأسي الأحمر). يعزز فقدان نشاط استرخاء الحمض النووي للـ topoisomerase I تشكيل حلقة R لأنه يشجع على تراكم اللزوجة الفائقة السلبية في الحمض النووي الذي يتم نسخه (أو نسخه). يمكن أن يؤدي الفشل في معالجة حلقات الحمض النووي الريبي وإزالتها إلى تلف الحمض النووي ، بما في ذلك الانقطاعات المزدوجة وإعادة التركيب المفرط. يقضي RNase H على حلقات R عن طريق إزالة مكون RNA من RNA: هجين DNA في حلقة R. يمكن لنسخة Rho إنهاء هيليكس أن تمنع تشكيل حلقة R عن طريق منع ارتداد RNA polymerase

نسخ الحمض النووي ، بنية فائقة الالتفاف والكروموسوم. تشير البيانات المستمدة من تجارب التقاط التشكل الكروموسومي إلى أن وحدات النسخ الطويلة والمكتوبة بشكل كبير يمكن أن تشكل حواجز أمام تفاعل الحمض النووي والحمض النووي [16]. تحتوي المنطقة المنسوخة (الحمراء) على عدد قليل من plectonemes وتعزل المناطق المحيطة الغنية بالحمض النووي المتداخل plectonemically. يسمح وقف النسخ في المنطقة الحمراء باستعادة الالتفاف الوبائي للحمض النووي ، وإعادة إنشاء اتصالات الحمض النووي والحمض النووي والسماح بالتفاعلات بين المنطقة الحمراء والمناطق المحيطة. تنشيط وتثبيط النسخ في المنطقة الحمراء يقلل ويرفع ، على التوالي ، الحاجز الذي يعزلها عن المناطق الجينومية المجاورة لها. لا تتضمن آلية العزل التأثير على انتشار الملف الفائق ، كما أنها لا تعتمد على ترجمة النصوص داخل المنطقة المكتوبة بشدة

أدى تطبيق طرق الجزيء المفرد إلى تعميق فهمنا للتنوع من خلية إلى خلية في عمليات مثل النسخ. لن تستجيب كل خلية في مجموعة بكتيريا متطابقة وراثيًا لإشارة تحفيز النسخ. بدلاً من ذلك ، ستحدث استجابة النسخ للإشارة في مجموعة فرعية فقط من البكتيريا. تم اقتراح دور للفائقة المحلية الإيجابية المعتمدة على النسخ في تكوين هذا التنوع من خلية إلى خلية [17 ، 18] ، مما يؤكد بشكل أكبر على العلاقة الحميمة والمتبادلة بين النسخ وطوبولوجيا الحمض النووي في البكتيريا.

تدير Topoisomerases طوبولوجيا الحمض النووي المحلي

تم التنبؤ بوجود روابط ضيقة بين معقدات استطالة النسخ والأيزوميراز العلوي على أسس نظرية منذ أكثر من 30 عامًا [19] وتم تأكيدها تجريبيًا [20،21،22،23،24،25،26]. DNA gyrase هو نوع II topoisomerase يستخدم التحلل المائي ATP لإدخال لفائف سالبة في الحمض النووي المريح ، ويستخدم نفس آلية النوع II المعتمد على ATP للتخلص من اللفائف الفائقة الإيجابية [27،28،29،30] وآلية ATP مستقلة للاسترخاء السلبي الملفات الفائقة [29 ، 31 ، 32]. يصاحب Gyrase بوليميراز RNA ويدير الحالة الطوبولوجية للحمض النووي في اتجاه مجرى النهر أثناء استطالة النسخ بحيث يمكن أن تستمر العملية حتى النهاية [33]. حوالي 2000 نسخة من بوليميراز RNA تعمل في النسخ في الكائن الحي النموذجي الإشريكية القولونية خلال فترات النمو الأقصى [34]. يقدم كل بوليميراز من الحمض النووي الريبي حوالي 6 لفائف فائقة إيجابية في الثانية [35] و 300 جزيء جيريز مكرسة للتخلص منها [36]. تتم معالجة المجال الملفوف سالبًا الذي تم إنشاؤه قبل معقد استطالة النسخ بواسطة الإيزوميراز العلوي الذي يمكن أن يهدئ الحمض النووي تحت الجرح [33]. تنطبق هذه المبادئ أيضًا في حالة البدائل المتحركة لأنها تنسخ الكروموسوم [37 ، 38]. تساعد الإيزوميرات من النوع الثاني على حل التضارب الطوبولوجي للحمض النووي الناشئ عن تصادمات النسخ المتماثل المباشر [39]. تخلق هذه الصراعات سيناريو يحتمل أن يكون خطيرًا للخلية لأن حلها بواسطة إنزيمات النوع الثاني ينطوي على توليد عابر من الانقطاعات المزدوجة في الحمض النووي [40]. إذا لم تتم إعادة إغلاق هذه الفواصل بكفاءة بعد مرور مزدوج الحمض النووي من خلال الفجوة المزدوجة التي تقطعت بها السبل ، فقد ينتج عن ذلك تلف دائم في الحمض النووي [39 ، 41 ، 42]. يمكن أن تؤدي التصادمات المباشرة بين مجمعات النسخ المستطيلة ، أو بين مثل هذا المركب وإعادة التركيب ، إلى تكوين حلقة R في المنطقة الجوفية في الجزء العلوي من مجمع النسخ. هناك حاجة إلى معالجة الحمض النووي الريبي وتخفيف الحمض النووي الملفوف بشكل سلبي لإزالة حلقة R وإعادة تشغيل مجمع النسخ المتوقف [43 ، 44 ، 45].

الشروع في الالتفاف والنسخ الفائق للحمض النووي

تم إجراء المسوحات لاكتشاف الجينات البكتيرية التي تظهر تغيرات في التعبير ترتبط بالتغيرات في الالتفاف الفائق للحمض النووي [46 ، 47]. يتم إحداث هذه التغييرات في الالتفاف الفائق للحمض النووي باستخدام الأدوية التي تثبط نشاط مجموعة فرعية من جزيئات الحمض النووي gyrase في الخلية (gyrase هو إنزيم أساسي ، لذا فإن الإزالة الكاملة لنشاطه مميتة) أو استخدام طفرات تفتقر إلى topoisomerase غير أساسي (على سبيل المثال topoisomerase I) أو التي تعبر عن topoisomerase مع نشاط متناقص. تُظهر بعض الجينات تعبيرًا محسنًا عندما يكون الحمض النووي مسترخياً بينما يُظهر البعض الآخر مستويات أعلى من التعبير عندما يكون الحمض النووي ملفوفًا بشكل سلبي [47 ، 48]. يعد مطلب الالتفاف السلبي أمرًا جذابًا بشكل حدسي لأنه يتوافق مع الحاجة إلى تعطيل الاقتران الأساسي لتكوين مجمع نسخ مفتوح. من الصعب ترشيد دور استرخاء الحمض النووي في التعزيز المباشر للتعبير الجيني. قد تنشأ عندما تغير التغييرات في تطور الحمض النووي عرض مواقع الربط للبروتينات التنظيمية التي تعتمد على القراءة غير المباشرة (شكل الحمض النووي) لربط الحمض النووي. تستخدم العديد من البروتينات في هذه الفئة (على سبيل المثال ، منظمات النسخ من نوع LysR) أشكال ربط الحلزون المجنح-الدور-الحلزوني التي تشرك كلاً من الأخاديد الرئيسية والثانوية في الحمض النووي [49]. قد يسهل استرخاء الحمض النووي الارتباط [50] ، مع كون التأثير قويًا بشكل خاص في المواقع في الحمض النووي الغني بـ A + T حيث يكون الأخدود الصغير في أضيق نطاق [51].

الالتفاف الفائق للحمض النووي واستطالة / إنهاء النسخ

بعد أزمرة مجمع النسخ المغلق إلى مركب مفتوح ، يتم تصنيع نسخة RNA بسرعة داخل معقد استطالة ثلاثي يتكون من لب بوليميريز الحمض النووي الريبي ، قالب الحمض النووي والنسخة الوليدة [52 ، 53]. يشكل جزء قصير من الحمض النووي الذائب من حوالي 10 إلى 12 نيوكليوتيد فقاعة النسخ. يظل قالب الحمض النووي الريبي المنسوخ حديثًا وقالب الحمض النووي متزاوجين على حوالي 10 نيوكليوتيدات داخل المركب و "قفلان مضغوطان" ، أحدهما أعلى المنبع والآخر في اتجاه مجرى المجمع يحافظان على تشكيل الحمض النووي الريبي: هجين الحمض النووي [54 ، 55]. إن إزاحة معقد الاستطالة تغلب على الحمض النووي أمامك وتؤثر على الحمض النووي خلفه (الشكل 1) ويمكن أن تتدخل عدة عوامل لتسبب توقف / إنهاء المركب ، وحتى التراجع (الشكل 2). يعزز بروتين NusA التوقف المؤقت ويقاوم بروتين NusG هذا التأثير [56]. يشجع UvrD على إصلاح الحمض النووي من خلال تشجيع التراجع للكشف عن بقع من الحمض النووي المتضرر من الأشعة فوق البنفسجية [57]. يتم شق الرنا الناشئ من معقد النسخ المتراجع عن طريق آلية يتم تحفيزها بواسطة بروتينات GreA و GreB ، واستعادة 3 نهاية النسخة في المركز النشط لمجمع النسخ [58 ، 59]. نظرًا لاقتران النسخ والترجمة ، فإن الفشل في تحميل الريبوسومات يسمح لعامل إنهاء النسخ Rho بالالتزام بالنص والتسبب في الإيقاف المؤقت / الإنهاء ، وربما التراجع (الشكل 2) [60]. يخلق الالتفاف الفائق السلبي للحمض النووي المنبع لمركب النسخ المتوقف / المتراجع فرصة لتشكيل حلقة R. تتم إزالة هجينة الحمض النووي الريبي (RNA) هذه بواسطة نشاط استرخاء الحمض النووي لـ topoisomerase I والنشاط المهين لـ RNA لـ RNase H (الشكل 2) [43،44،45].

استتباب الحمض النووي الفائق

تكون محفزات الجينات التي تشفر DNA gyrase أكثر نشاطًا عندما يتم ارتخاء الحمض النووي [61،62،63،64،65]. يقوم البروتين المرتبط بالنيوكليويد FIS بقمع نسخ جين gyrase و fis يحتوي الجين على محفز يتم تحفيزه بواسطة الالتفاف الفائق السلبي [66]. في المقابل ، نسخ ملف أعلى يتم تحفيز الجين ، الذي يكوِّد Topoisomerase I الذي يهدئ الحمض النووي ، عن طريق الالتفاف الفائق للحمض النووي السالب [67 ، 68]. تشكل جينات توبويزوميراز هذه ، مع تفضيلاتها المعاكسة للالتفاف الفائق للحمض النووي ، أساسًا لنظام الإدارة المتوازنة لمستويات الالتفاف العالمية للحمض النووي في الخلية ، ويفترض أن تحافظ على الحالة فائقة الالتفاف للحمض النووي ضمن الحدود المناسبة لبقاء الخلية [2 ، 33 ، 62 ، 69،70،71،72،73،74]. تتوافق الآليات مع التنبؤات التي تم إجراؤها في نموذج مجال الالتفاف الفائق المزدوج [19] (الشكل 1): يتم تجنيد الإيزوميراز العلوي بشكل أساسي في وحدات النسخ الأكثر نشاطًا مع ارتباط الجيرايز والتوبويزوميراز الأول بالمواقع المتوقعة في التباعد- و الجينات المنسوخة بشكل متقارب ، حيث تتبنى الإيزوميراز العلوي المواقع المتوقعة في بداية ونهاية بوليميريز الحمض النووي الريبي في الجسم الحي [67]. عندما يتم تجنيد topoisomerase I للمروجين ، فإنه يصبح نشطًا استجابةً لللف الفائق السلبي الناجم عن استطالة النسخ [75].

علم وظائف الأعضاء والتوتر وفائق اللفائف DNA

تم الإبلاغ عن ارتباط بين الالتفاف الفائق للحمض النووي ودورة نمو البكتيريا النموذجية. في جوهرها ، يرتبط الالتفاف الفائق السلبي للحمض النووي بفترات من التدفق الأيضي المرتفع ، مع وجود البكتيريا في الطور الأسي للنمو التي تحتوي على الحمض النووي الأكثر سلبًا ، وتلك الموجودة في المراحل المتأخرة والثابتة التي تحتوي على DNA مرتخي [76 ، 77]. يتراكم عامل سيجما للطور الثابت والإجهاد ، RpoS ، في البكتيريا التي تعاني من توقف النمو لأسباب متعددة [78]. على عكس عامل سيجما التدبير المنزلي RpoD ، يبدأ RpoS النسخ بكفاءة من المروجين في قوالب الحمض النووي المريحة ، ويتم تثبيطه بواسطة الحمض النووي فائق الالتفاف سلبًا حتى يتم الوصول إلى المستوى المناسب من ارتخاء الحمض النووي [79].

كما أن الالتفاف الفائق للحمض النووي متورط أيضًا في تشغيل الاستجابة الصارمة ، وهو حدث يتم تشغيله بواسطة أسباب متعددة في أنواع بكتيرية مختلفة ، ويتمثل أحد أدواره الرئيسية في منع إنتاج آلية الترجمة للخلية [80،81، 82،83،84،85]. في بكتريا قولونية، المروجون الذين يخضعون للتحكم السلبي من خلال الاستجابة الصارمة لديهم تسلسل مميّز غني بـ G + C بين + 1 و -10 عناصر المروج [86،87،88،89،90] التي تجعل الاتصال مع المنطقة المحفوظة 1.2 في RNA عامل سيغما التدبير المنزلي للبوليميراز ، RpoD [91]. لقد تم اقتراح أنه نظرًا لأن هذه الميزة تكمن في جزء المروج الذي يجب أن يصبح منفردًا في تكوين معقد مفتوح ، فإنه يمنع بدء النسخ في قوالب الحمض النووي المسترخية التي يتم الحصول عليها في البكتيريا المجهدة تغذويًا [66 ، 92]. المروجين التي يتم تحفيزها أثناء الاستجابة الصارمة لها تمييز A + T-rich [93].

ترتبط الضغوط البيئية بالتغيرات في مستويات الالتفاف الفائقة للحمض النووي. على سبيل المثال ، النمو بكتريا قولونية على الجلوكوز ، مصدر الكربون المفضل للكائن الحي ، يرتبط بالحمض النووي الذي يكون أكثر سلبًا في حين يرتبط ارتخاء الحمض النووي بالنمو في مصادر الكربون الأكثر فقرًا [94]. ينتج عن امتصاص الجلوكوز والتمثيل الغذائي نسبة أعلى من ATP إلى ADP وتؤثر نسبة [ATP] / [ADP] على نشاط نشاط اللفائف الفائق للحمض النووي المعتمد على ATP في الجيراز [74 ، 95 ، 96 ، 97 ، 98]. ومع ذلك ، فشلت التجارب مع ثنائي نتروفينول ، وهو فصل لسلسلة الجهاز التنفسي القائمة على الغشاء السيتوبلازمي ، في ربط تخليق ATP والتلف الفائق السلبي للبلازميدات المراسل [94]. ربما تستهدف تخليق ATP بواسطة F الموجود في الغشاء0F1 تسبب ATPase في تجاهل مساهمة adenylate kinase في إنتاج ATP: التعريض بكتريا قولونية لصدمة تناضحية ، الضغط الذي يزيل الماء من السيتوبلازم ، مصحوب بارتفاع الطلب على ATP الذي يتم تلبيته جزئيًا بواسطة adenylate kinase [99]. في المراحل الأولى من الصدمة ، وصل مراسل البلازميدات بكتريا قولونية و السالمونيلا تصبح أكثر سالبة بشكل فائق [96 ، 100].

كما تم الإبلاغ عن التحولات الفائقة في أعقاب ، من بين أمور أخرى, الإجهاد الحمضي [101،102،103،104] ، النمو داخل الخلايا [102 ، 105] ، الإجهاد التناضحي [46 ، 79 ، 96 ، 100 ، 106 ، 107 ، 108 ، 109] ، الإجهاد التأكسدي [110] ، التغيرات في مستويات الأكسجين [95 ، 111 ، 112 ، 113 ، 114 ، 115 ، 116 ، 117] والإجهاد الحراري [118]. تشير هذه الملاحظات إلى أن التغييرات في التركيب الكيميائي أو الفيزيائي للبيئة والتأثيرات اللاحقة على التمثيل الغذائي يمكن أن تؤدي إلى تحول في الطبقة الفائقة للمادة الجينية للبكتيريا [1]. هل تم استخدام هذا التحول على مستوى الاستجابة النسخية للتغيرات البيئية؟ في كثير من الحالات ، هو كذلك. على سبيل المثال ، الجينات المشاركة في نقل المواد المذابة المتوافقة مع الخلية لتحل محل الماء المفقود في الصدمة التناضحية يتم تنشيطها بشكل نسخي عن طريق الالتفاف الفائق السلبي للحمض النووي [100] في حين أن الجينات التي تستجيب للإجهاد الحمضي لها محفزات يتم تشغيلها عندما يرتاح الحمض النووي ، واسترخاء الحمض النووي هي سمة من سمات البكتيريا التي تتحول إلى درجة حموضة منخفضة [102 ، 103].

النسخ ، اللفائف الفائقة للحمض النووي والعمارة الصبغية

إن الالتفاف الفائق للـ DNA والنسخ لهما تأثير متبادل ، مما يفسح المجال لتشبيه شارع ذي اتجاهين. كما أنها تؤثر على معمارية شارعهم: الكروموسوم البكتيري. تنشئ الوحدات الوراثية الطويلة والمنسخة بشدة حواجز اتصال بين المناطق المحيطة بالكروموسوم (الشكل 3). يتم الحفاظ على هذه الحواجز من خلال حركة مرور بوليميراز الحمض النووي الريبي وما يرتبط بها من اضطراب في الالتفاف الفائق للحمض النووي المحلي [16]. كشفت دراسات الجزيء المنفرد أن الشكل البكتوني (المضفر أو المتشابك) للحمض النووي الفائق الالتفاف "مثبت" بواسطة تسلسلات الحمض النووي الغنية بـ A + T والتي تم العثور عليها في الجزء العلوي من المحفزات التي تشغل موقعًا في قمة plectoneme [119]. يوفر هذا الاكتشاف إمكانية استخدام طرق المعلومات الحيوية للتنبؤ بمواضع السمات المعمارية للكروموسوم المرتبطة بالتلف الفائق للحمض النووي.

تم تعيين مواقع ملزمة لـ DNA topoisomerase I و DNA gyrase السل الفطري بواسطة ChIP-Seq ووجد أنها تحدث في وحدات النسخ حيث تزيل الملفات الفائقة السلبية والإيجابية ، على التوالي [120]. تم تعيين مواقع ربط DNA gyrase بواسطة رقاقة ChIP [121] وتم تعيين مواقع انقسام الحمض النووي وربط الجريز بواسطة ChIP-Seq في بكتريا قولونية [122]. يتم إثراء مواقع الانقسام هذه في اتجاه مجرى النهر للجينات المكتسبة بشكل كبير ، بما يتماشى مع الحاجة إلى تثبيت Topoisomerase هناك للقضاء على اللفائف الفائقة الإيجابية الناتجة عن استطالة النسخ. يؤدي تثبيط النسخ بالريفامبيسين إلى إعادة توزيع الجيراز ، وهو ما يتوافق مرة أخرى مع الارتباط الوثيق بين الملفات الفائقة الناتجة عن النسخ ووجود الحمض النووي الجيرازي [122].

لم يتم اكتشاف مواقع Gyrase بشكل متكرر في تلك الأجزاء من بكتريا قولونية كروموسوم معروف ارتباطه بالبروتين المرتبط بالنيوكليويد H-NS ، كاتم الصوت للنسخ. ومع ذلك ، فإن أنشطة H-NS و gyrase تتداخل ، كما هو موضح في التحكم النسخي لـ proU أوبرا بكتريا قولونية و السالمونيلا والجينات الأخرى الحساسة تناضحيًا في البكتيريا التي تخضع للإجهاد التناضحي [76 ، 100]. بالإضافة إلى ذلك ، أظهر التصوير فائق الدقة أن بروتين H-NS يصبح منفصلاً ومستبعدًا من نيوكليويد البكتيريا التي تعاني من الصدمة التناضحية في المرحلة الثابتة من دورة النمو في خلايا الطور الأسي ، ولا تُرى ظاهرة الانفصال والاستبعاد هذه إلا لـ H - NS في وجود مثبط DNA gyrase الكوميرمايسين [123]. توفر هذه العلاقة مثالًا مفيدًا للعلاقة بين DNA gyrase والبروتينات المرتبطة بالنيوكليويد في البكتيريا. غالبًا ما يعمل NAP HU كشريك في gyrase في نهايات الجينات المنسوخة بشدة حيث يشكل البروتينان معقدًا في تسلسل DNA متناظر متكرر [124 ، 125]. تم العثور على عامل التكامل المضيف (IHF) NAP أيضًا في المواقع ذات الصلة [126 ، 127]. تتعاون IHF و gyrase supercoiling الفائق للحمض النووي بوساطة gyrase في تجنيد متواليات المباعدة الأولية في تسلسلات قائد مصفوفة CRISPR لتوسيع نطاق العناصر الوراثية المتنقلة الغازية التي يمكن اكتشافها وتدميرها بواسطة نظام المناعة المكتسبة البكتيري هذا [128 ، 129]. تتعاون بروتينات ربط الحمض النووي ، بما في ذلك IHF و LRP ، مع الالتفاف الفائق للحمض النووي لضبط وإعادة ضبط التبديل الجيني المسؤول عن التعبير المتغير الطور للنوع الأول من fimbriae والاختيار بين العوالق وأسلوب الحياة المرتبط بالغشاء الحيوي في بكتريا قولونية [130,131,132].

الالتفاف الفائق للحمض النووي وعدم القدرة على التنبؤ بالنسخ

يحدث نسخ الجينات المعبر عنها بشكل كبير في دفعات [17 ، 133] وقد تم اقتراح دور للالتفاف الفائق للحمض النووي المحلي في توليد هذه الأحداث العشوائية. باستخدام طرق الجزيء الواحد ، وجد تشونغ وزملاؤه أنه مع تراكم الملفات الفائقة الإيجابية قبل مجمع استطالة النسخ أثناء نسخ الجين عالي التعبير ، فإنها تبطئ الاستطالة أولاً قبل أن تتغذى في النهاية على المحفز حيث تمنع بدء النسخ [ 18]. إن استرخاء اللفائف الفائقة الإيجابية بواسطة DNA gyrase ضروري قبل استئناف نسخ الجين. هذه العمليات ، والجهات الفاعلة المختلفة المطلوبة لتشغيلها ، تنتج فرصًا لمعدلات متباينة من التعبير الجيني بين النسخ المتطابقة وراثيًا من هذا الجين في كل خلية في التجمعات البكتيرية. ستكون النسخ المختلفة في مراحل مختلفة من دورة النسخ وستحتوي على أعداد فردية من الملفات الفائقة الإيجابية ، مما يؤدي إلى مستويات مختلفة من تثبيط النسخ. يعتمد التحرر من تثبيط النسخ عن طريق استرخاء اللفائف الفائقة للحمض النووي الإيجابي على توافر الحمض النووي gyrase و ATP. لن تتم مزامنة دورات النسخ المتماثل للكروموسومات في البكتيريا ، وبالتالي فإن عدد نسخ الجين سيختلف من خلية إلى أخرى ، مما يولد المزيد من الفرص للتنوع في التعبير عن الجين. العلاقة بين الرنا المرسال ومنتجاتها البروتينية عشوائية عند انقسام الخلية ، مما يؤدي إلى تفاقم تأثير الأحداث العشوائية في التعبير الجيني في الخلايا المقسمة حديثًا [134]. يمثل التعبير عن الجينات المجاورة متغيرًا آخر من خلية إلى خلية ، كما هو الحال بالنسبة لتوقيت مرور شوكة النسخ المتماثل مع إعادة الضبط المرتبط بأنماط ربط البروتين المحلية. تقدم هذه الأحداث العشوائية وغيرها من الأحداث غير المتوقعة في التعبير عن جين معين ، حتى عندما يتلقى الجين إشارات من المتوقع أن تنشط تعبيره. والنتيجة هي تنوع فسيولوجي على مستوى السكان ويمكن أن يفيد ذلك السكان من خلال تكوين أعضاء بدرجات مختلفة من اللياقة التنافسية.قد يزيد من احتمالية استعداد بعض أفراد المجموعة البكتيرية على الأقل في بيئة ديناميكية لا يمكن التنبؤ بها إذا نشأت ظروف بيئية جديدة.


نتائج

TOR عبارة عن إستراتيجية تجميع جيني يتم فيها تجميع تسلسل الاهتمام من قليل النوكليوتيدات واستنساخه بحيث يتم وضع فاصل النسخ T1 القوي 17 في إطار مع العنصر الاصطناعي (الشكل 1). يتم إلغاء نشاط إنهاء T1 أو يكون ضعيفًا بشكل ملحوظ عند ترجمته إلى الإشريكية القولونية 16 مما يسمح بالتعبير عن أ لاكزيقع الجين المراسل α في اتجاه مجرى النهر ، باعتباره الجين الثاني للأوبرون ثنائي الاتجاه. وهكذا ، عندما يكون تسلسل الجين الاصطناعي صحيحًا ، تحدث القراءة من خلال فاصل النسخ T1 و لاكزيتم التعبير عن جين α لتوليد مستعمرات زرقاء على وسط يحتوي على X-Gal. في المقابل ، تؤدي طفرات تغيير الإطار إلى رمز إيقاف بعد فترة وجيزة من التسلسل الخاطئ. نظرًا لأن الأخطاء الأكثر شيوعًا في قليل النوكليوتيدات الاصطناعية هي عمليات الحذف والإدخال 5،18 ، فإن طفرات تغيير الإطار على طول CDS هي الأكثر شيوعًا. في التركيبات التي تأوي طفرات تحول الإطار ، يكون فاصل T1 نشطًا و لاكزلا يتم التعبير عن α ، لذلك تنتج البلازميدات المؤتلفة مستعمرات بيضاء (صافية).

(أ) يتبع تسلسل الترميز في جين ترميز بروتيني نموذجي كودون توقف (TAA) ثم نهاية نسخ (T1). (ب) في منصة TOR ، يتم وضع فاصل النسخ قبل كود الإيقاف ويتبعه المراسل كجزء من نفس المشغل. (ج، أعلى) في TOR T1 تُترجم على أنها علامة اندماج وتصبح غير نشطة أو معطلة بشكل كبير ، وبالتالي يمكن التعبير عن المراسل باعتباره الجين الثاني للأوبون. (ج، أسفل) في حالة وجود كودون توقف سابق لأوانه ينشأ بعد هراء أو طفرة في تغيير الإطار ، سيكون T1 نشطًا ولا يتم التعبير عن المراسل.

تم اختبار TOR بدائية النواة aad الجين (792 bp GenBank HQ880267.1) الذي يشفر aminoglycoside adenyltransferase الذي يمنح سبكتينوميسين ومقاومة الستربتومايسين في بكتريا قولونية، ومع حقيقيات النوى gfp الجين (717 bp GenBank L29345.1) الذي يرمز لـ ايكوريا فيكتوريا بروتين الفلورسنت الأخضر 19. تم اختيار هذه الجينات كما وصفنا مؤخرًا تجميعها بواسطة RapGene ، وهو نهج مستقل للربط لتخليق الجينات في بكتريا قولونية 20. كان ناقل مراسل الاستنساخ المستخدم خلال هذه الدراسة هو pRG2 (الشكل 2). هذا البلازميد هو ناقل اختيار إيجابي يعتمد على الجين السام جاتا 1 21 ومشتق من ناقل pRG1.0 الموصوف سابقًا. نظرًا لأن TOR تم تطويره كامتداد لـ RapGene 20 ، فقد تم تصميم المروج وموقع ربط الريبوسوم (RBS) ليكونا جزءًا من مجموعة قليل النيوكليوتيدات في التجميع (الشكل التكميلي S1) ، كما هو مفصل في الطرق. للتأكد من أن طفرات تغيير الإطار الموجودة في الطرف C للجين الاصطناعي أدت أيضًا إلى إنهاء النسخ عند T1 ، تم تضمين اثنين من أكواد التوقف الإضافية في المتجه في إطارات القراءة الثانية والثالثة ، على التوالي داخل موقع AflII وقبل بداية T1 (الشكل التكميلي S2).

pRG2 هو البلازميد المستخدم خلال هذه الدراسة. يتميز من النوع البري لاسي الجين السام والمحفز جاتا 1، ال جيش تحرير بلوخ الجين الذي يمنح المقاومة للأمبيسيلين أو الكاربينيسيلين ، وهو أصل من النوع pMB1 للتكرار ، لاك الجين واثنين من النهايات ذات التوجهات المعاكسة ، tI و T1. يؤدي الهضم المتزامن لـ pRG2 مع بوليميراز الحمض النووي AflII و NheI و T4 في وجود dTTPs إلى وجود بلازميد له نهايات متوافقة مع LIC ومناسبة لتجميع RapGene. على العكس من ذلك ، تم استخدام النهايات الناتجة عن هضم NheI و AflII المتزامن للناقل في غياب بوليميريز الحمض النووي T4 لإنشاء مناطق متداخلة في منتج PCA مناسب لتجميع Gibson. الجين المراسل لاك هو اندماج نسخي مع العنصر الاصطناعي. تم تقديم المنهي الثاني λtI لتقليل التعبير المتسرب عن جاتا 1 يحتمل أن يكون ناتجًا عن هندسة المنطقة الأصلية pGATA المنبع للعنصر السام. أوري ، أصل النسخ المتماثل. NheI ، موقع تقييد NheI. AflII ، موقع تقييد AflII. الاك, لاك المشغل أو العامل. صتاك, تاك المروجين.

مختلف بكتريا قولونية المحفزات والمُنهيات حيث تم اختبارها للاستخدام في نظام TOR. تم الحصول على نتائج أولية ناجحة مع متغير بكتريا قولونية صrecA المروج ، المشار إليه هنا بـ PrecA* ، والمخرج T1 17. تسلسل PrecA* يختلف عن تسلسله من النوع البري في نوكليوتيد واحد للمنطقة −35 (TTGAتيتم تغيير A إلى TTGAجأ) 22. في recA + سلالات ، صrecA يتم تحفيزها بواسطة RecA نفسها عن طريق الانقسام التحلل للبروتين من مثبط LexA 22. ومع ذلك ، فإن بكتريا قولونية سلالة NEB5α المستخدمة في هذه الدراسة هي أ recA1 - سلالة. تم الإبلاغ عن هذه الطفرة لإلغاء جميع وظائف RecA المعروفة تمامًا ، بما في ذلك نشاط البروتياز تجاه LexA 23. وهكذا ، صrecA و صrecA* من المتوقع أن يتم قمعها بشكل أساسي في NEB5α. تم أيضًا اختبار اثنين من المروجين الإضافيين غير المحرضين لتقييم متانة منصة TOR في ظل ظروف مختلفة: بكتريا قولونية صسيء يشتمل المروج الأساسي فقط على التسلسل من -35 إلى -10 بالإضافة إلى 4 نقاط أساس خارجية على كلا الجانبين ولا توجد عناصر تنظيمية إضافية 24 ، و Pتاك المروج 25 يشتمل على المنطقة من -35 إلى -10 مع 5 نقاط أساس إضافية في المنبع و 4 نقاط أساس في المصب من بلازميد pGATA الأصلي (الشكل التكميلي S1).

تم اختبار TOR مبدئيًا على ستة جينات تشتمل على طفرات من النوع البري وغير المنطقي aad و gfp، وكلها معبر عنها من P.recA* (الشكل 3 أ ، الشكل التكميلي S3). أظهرت هذه الجينات ، التي تحتوي إما على متواليات من النوع البري أو رمز إيقاف منبع لـ T1 ، أن منصة TOR يمكن أن تميز بسهولة بين التسلسلات الصحيحة وغير الصحيحة. في الواقع ، على الصفائح المحتوية على X-Gal ، ظهرت المستعمرات ذات التسلسل الصحيح باللون الأخضر الداكن أو الأزرق اعتمادًا على وقت الحضانة. يعكس لون المستعمرة قراءة فاصل T1 وما يترتب على ذلك من تعبير عن التيار لاكزجين ألفا (الشكل 1). على العكس من ذلك ، أسفرت الجينات التي تمتلك كودون توقف في المنبع من T1 عن مستعمرات بيضاء على نفس الوسط بسبب إنهاء النسخ عند T1 وضعف لاكزتعبير α. تم تقييم تطور اللون بعد فترة حضانة لا تقل عن 30 ساعة عند 37 درجة مئوية. (الشكل 3 أ).

تم تطبيق TOR على ستة بنيات اختبار تم إنشاؤها من aad و gfp من خلال تقنيات البيولوجيا الجزيئية القياسية ، وإلى gfp تم تجميعها بواسطة مجموعة RapGene أو PCA. (أ) الاختبارات الأولية على عينات الاختبار. بعد تقريبا. أعطت عينات من النوع البري من الحضانة لمدة 36 ساعة (1 و 4) لون مستعمرة زرقاء داكنة على CIX ، بينما أظهرت المسوخات الأربعة التي تحمل كود إيقاف (مثلثات سوداء) داخل أو في نهاية CDS لونًا أبيض على نفس الوسيط. تتوافق النجوم مع عمليات حذف تغيير الإطار أو عمليات الإدراج التي تولد رمز إيقاف سابق لأوانه في اتجاه آخر. تتوافق المربعات الرمادية داخل التركيبات مع فاصل T1. (ب) تم تطبيق TOR على مقايسة التوليف الجيني لتجميع gfp بواسطة طرق PCA أو RapGene بدءًا من مجموعة من 24 قليل النوكليوتيدات المتداخلة. (ج) رحلان نموذجي gfp منتج PCA. تم استخلاص الشريط المقابل للإدخال (السهم) واستنساخه بواسطة مجموعة Gibson في pRG2.

في النهج التالي gfp تم تصنيعه إما عن طريق RapGene أو مجموعة ركوب البلمرة 26 (PCA) (الشكل 3 ب). تم استخدام هذه التقنيات (الشكل التكميلي S4) طوال الدراسة كطرق قياسية لتخليق الجينات لاختبار كفاءة TOR. في الجولة الأولى من TOR ، مع الاصطناعية gfp معبرًا عن PrecA* ، خمسة عشر مرشحًا تم اختيارهم عشوائيًا من TOR إيجابيًا تم الحصول عليهم من قبل جمعية PCA لـ gfp و 13 عينة من تلك المشتقة من RapGene تم تسلسلها (البيانات التكميلية 1). أظهر تحليل اللوني أن 66٪ من العينات الإيجابية التي تم تحديدها بواسطة PCA و 61٪ من تلك التي حصل عليها RapGene تحتوي على عينات صحيحة تمامًا. gfp تسلسل ، بينما احتوى المرشحون المتبقون إما على طفرات خطأ أو عمليات حذف داخل الإطار (الجدول 1 ، البيانات التكميلية 1). في الجولة الثانية من TOR ، gfp تم بناؤه فقط بواسطة PCA ووضعه تحت سيطرة أي من P.recA* ، صسيء أو صتاك المروجين (الشكلان التكميليان S1 و S5). تم ترتيب تسلسل البلازميدات من خمسة عشر محولات ، تم اختيارها عشوائياً من بين العينات الإيجابية ، لكل مروج. هنا 93٪ و 86٪ و 73٪ من العينات الإيجابية تحتوي على صحيح gfp تسلسل مدفوعًا بـ P.recA* ، صسيء أو صتاك المروجين ، على التوالي (الجدول 1). في حالة المرشحين المعبر عنهم باستخدام PrecA* ، قمنا أيضًا بتسلسل 15 من المحولات السلبية TOR (الشكل 4 ، البيانات التكميلية 1). كما هو متوقع ، احتوت المجموعة الأخيرة على عناصر تركيبية مجمعة بشكل غير صحيح ، تتميز بواحدة أو أكثر من طفرات تغيير الإطار متبوعة برمز توقف يظهر بعد وقت قصير من موقع الطفرة.

(أ ، ب) مقارنة بين الأنماط الظاهرية لـ 15 عينة إيجابية للأنيسول الخماسي الكلور مقابل 15 عينة سلبية للأنيسول الخماسي الكلور (كلاهما تحت PrecA*). 11 من أصل خمسة عشر عينة مظلمة تدريجياً بعد فترة حضانة طويلة. كان لا يزال هناك فرق واضح بين العينات الإيجابية والسلبية ، ولكن gfp-ins (عينة N7) مظلمة أكثر من الآخرين. (ج) أظهرت العينات السلبية TOR لونين مختلفين للمستعمرة عند الاستنساخ ، الأخضر (α) والأصفر (β). الموضع السلبي ، والعينات السلبية TOR ، والعينات الإيجابية TOR. 1N ، 7N ، 15N ، العينات 1 ، 7 ، 15 من العينات السلبية TOR.

معدلات الدقة والخطأ في TOR

كما ورد في دراسات أخرى ، يمكن استخدام 18،20 من التركيبات التي تحتوي على إدخالات كاملة الطول لتحديد معدل الخطأ. يتم تعريف معدل الخطأ على أنه العدد الإجمالي للقواعد المحورة (المحذوفة أو المدرجة أو المستبدلة) مقسومًا على عدد القواعد المتسلسلة مضروبًا في 100. تمثل هذه القيمة التكرار الإحصائي لطفرة واحدة كل 100 نقطة أساس ، وتسمح بإجراء مقارنات بين الطرق التي تستخدم استراتيجيات مختلفة وأطوال إدراج مختلفة. كان معدل الخطأ في TOR مع RapGene 0.136 من 13 عينة متسلسلة من المستعمرات الزرقاء على X-Gal ، بينما تفاوتت القيم المحددة لتجميع PCA من إجمالي 60 عينة إيجابية بين 0.009 و 0.045 (الجدول 1 ، العمود 6) ، مع متوسط ​​0.024. هذه القيمة الأخيرة تقابل 0.24 خطأ لكل كيلو بايت ، أو بشكل مكافئ 24٪ متواليات تحتوي على خطأ على الأقل ، لجين 1 كيلو بايت. وبالتالي ، مع وجود 76٪ من المتواليات الصحيحة ، فإن أقل من محولين لكل استنساخ TOR بحاجة إلى التسلسل لتحديد الجين الاصطناعي الصحيح البالغ 1 كيلو بايت.

تم تحديد دقة التوليف الجيني في TOR أيضًا على أنها النسبة بين المحولات التي تحتوي على صحيح تمامًا gfp الجين مقسومًا على العدد الإجمالي للعينات الإيجابية TOR المتسلسلة (الجدول 1 ، العمود 3). لـ 714-bp gfp الجين المركب بواسطة PCA كانت الدقة 79.5٪ من أربع تجارب منفصلة كشفت أن القيم التي تم تحديدها بواسطة كلتا الطريقتين كانت متشابهة. وبالتالي ، فإن كفاءة وموثوقية توليف TOR لجينات

1 كيلو بايت تنافسي للغاية مع معايير السوق ، حيث يحتاج أقل من محولين إيجابيين إلى تسلسل لتحديد العينة الصحيحة (https://www.thermofisher.com/uk/en/home/life-science/cloning/gene -التخليق / سلاسل الجينات- dna-fragments.html). من خلال استقراء معدل الخطأ الملحوظ (0.024) للجينات الاصطناعية الأطول ، فإن القيمة المتوقعة البالغة 0.48 خطأ لكل 2 كيلو بايت من الجينات ستسمح بتحديد التركيبات الصحيحة لهذا الطول عن طريق تسلسل ما لا يزيد عن اثنين من المحولات لكل اختبار استنساخ. بشكل حاسم ، تم استخدام قليل النوكليوتيدات المحلاة فقط هنا ولم تكن هناك حاجة لطرق تصحيح الحمض النووي بعد التوليف لطريقة التجميع. بدون اختيار TOR ، فإن احتمالية إنتاج سليمة gfp الجين باستخدام أليغنوكليوتيدات 60 نانومتر من المتوقع أن يكون 26،27 0.93 22 = 20٪ ، بدلاً من 76-79.5٪ التي لوحظت مع TOR. هنا ، 0.93 هي دقة التسلسل المقدرة لأوليغنوكليوتيدات المستخدمة في هذا العمل (انظر أدناه والشكل التكميلي S6) ، و 22 هو عدد قليل النوكليوتيدات الضروري ل gfp الجمعية العامة. هذه القيمة قابلة للمقارنة مع القيمة المحددة تجريبياً ، سواء في دراسة سابقة 20 (

35٪ مستعمرات لكل استنساخ TOR زرقاء منها 79.5٪ صحيحة مما أدى إلى دقة 27٪.

الإيجابيات الكاذبة في TOR

كشف تحليل بيانات التسلسل من عينات PCA و RapGene عن وجود إيجابيات خاطئة في كل من الاختبارات الخمسة المستقلة لـ gfp التجمع (الجدول 1). ما يقرب من 2٪ من التركيبات احتوت على طفرة خطأ واحدة ، وأظهرت 2٪ إضافية عمليات حذف في الإطار أو عمليات إدراج داخل CDS. لا يمكن لـ TOR القضاء على هذه الأنواع من الإيجابيات الكاذبة التي تكون نادرة جدًا. لاحظنا أنه يمكن ملاحظة فئة ثانية محتملة من الإيجابيات الخاطئة بعد النمو المطول عند 37 درجة مئوية. في الواقع ، بعد فترات الحضانة الممتدة ، طورت عدة مستعمرات من بين العينات السلبية لون مستعمرة خضراء فاتحة (الشكل 4 ج). لمزيد من التحقيق في هذه الملاحظة ، تمت دراسة العينات السلبية الخمسة عشر التي تم تسلسلها مسبقًا بمزيد من التفصيل (الشكل 4 أ ، ب). هذه معيبة gfp تم التعبير عن جميع الجينات من P.recA* المروجين. أظهرت إحدى عشرة عينة لون مستعمرة ذات لون أخضر فاتح عند الحضانة على وسط CIX (LB أجار زائد كاربينيسيلين [120 ميكروغرام / مل] ، IPTG [1 ملم] و X-Gal [0.0001٪]) لمدة تصل إلى 55 ساعة عند 37 درجة مئوية. على وجه الخصوص ، عينة gfp-ins، الذي كشف تحليل التسلسل أنه يمتلك طفرة إدخال واحدة بعد الموضع 183 من تسلسل الترميز ، طور لونًا أخضر قويًا بعد 48 ساعة من الحضانة عند 37 درجة مئوية (الشكل التكميلي S7). ومع ذلك ، هناك فرق بين gfp-ins والبرية من النوع gfp كان لا يزال واضحًا في هذه المرحلة الزمنية ، خاصةً عندما لوحظت الخلايا التي تعبر عن هذه الطفرات كمستعمرات مفردة. تحتوي جميع العينات السلبية المتسلسلة على كودون توقف واحد على الأقل بداخلها gfp، لكن تطور لون المستعمرة اختلف بشكل كبير. لذلك ، استبعدنا أن سواد المستعمرة كان بسبب عدم كفاءة T1 كمنهي نسخ في هذا السياق الجيني. لاختبار ما إذا كانت الإيجابيات الخاطئة السابقة المعبر عنها من P.recA* تصرف المروج بشكل مشابه عندما يتم التعبير عنه من المروجين البديل ، تم إجراء اختبار اللوحة باستخدام نفس الشيء aad و gfp المسوخ الموصوفة في الشكل 3 أ ، ولكن يتم التعبير عنها تحت سيطرة P.سيء أو صتاك (الشكل التكميلي S8). فقط gfp-ins معبرًا عن Pتاك أنتجت لونًا أزرق لا يمكن تمييزه مقارنةً بالنوع البري gfp. لذلك ، على الرغم من أن المستوى العالي من التعبير عن المراسل قد ينتج عنه إيجابيات كاذبة مثل gfp-ins، تسلسل البيانات لـ P.تاك أظهرت المحولات أن الأخير لا يزال معززًا موثوقًا به و "سريعًا" لـ TOR (دقة 73٪ ، الجدول 1 ، البيانات التكميلية 1) ، مع إهمال الإيجابيات الخاطئة من الفئة الثانية (تمثل واحدة فقط من 73 عينة إيجابية TOR متسلسلة ، بمعنى آخر

1٪). بينما لا يمكننا حاليًا شرح اللون الأخضر الفاتح لبعض العينات السلبية ، فإننا نقترح أن إعادة بدء الترجمة في مواقع ربط الريبوسوم المشفرة داخل CDS قد تكون مسؤولة عن هذا التأثير. تم الإبلاغ مؤخرًا عن أن تجنيد الريبوسوم في المواقع الداخلية أكثر شيوعًا من المتوقع (ليس فقط للتعبير الجيني غير المتجانسة) ، كآلية يمكن أن تؤثر على معدل النسخ أكثر من استخدام الكودون 28.

في TOR ، يمكن أيضًا إشراك زوج مشفر RBS-ATG / GTG يقع في الإطار الثاني أو الثالث في هذا التأثير. في الواقع ، نتيجة لتحول الإطار ، سيصبح تسلسل قصير في بداية موقع الطفرة على أي من هذه الإطارات في إطار مع CDS.

يمكن أن يؤدي تحسين الكودون المناسب للجين الاصطناعي - ممارسة شائعة في تخليق الجينات - إلى تجنب ظهور RBS المشفرة ، ومن المحتمل أن يستبعد احتمال التعبير الضعيف عن الجين المراسل في عينات سلبية TOR.

دقة أليغنوكليوتيدات المستخدمة في هذه الدراسة

لوحظت عمليات حذف طويلة في بعض الأحيان في التركيبات التالية لاستنساخ PCA (البيانات التكميلية 1). نظرًا لأن الإدخالات التي تم تضخيمها بواسطة PCA كانت دائمًا مستخرجة من الهلام ، فمن المحتمل أن تكون هذه الطفرات نتيجة في الجسم الحي أحداث إعادة ترتيب الحمض النووي. لتقدير هذا التأثير ، تحمل جزء NheI-AfeII النوع البري gfp بناء التسلسل في pRG2 تحت سيطرة P.recA* تم تضخيمه واستنساخه مرة أخرى في نفس المتجه بواسطة إجراء جيبسون (الشكل التكميلي S6). تم طلاء المحولات على كل من LB plus Carbenicillin وعلى ألواح CIX. تم اختيار ثلاثين مستعمرة ظهرت بيضاء على الأولى بشكل عشوائي وتم فحصها بواسطة تفاعل البوليميراز المتسلسل لتحديد عمليات حذف الحمض النووي المحتملة. لم يلاحظ أي إعادة ترتيب (الشكل التكميلي S6a). تم تطوير المحولات المطلية على CIX في الغالب إلى مستعمرات ذات لون أزرق ، ولكن 10.6 ٪ (15/141) كانت بيضاء (الشكل التكميلي S6b). تم تسلسل عشر عينات تم اختيارها عشوائيًا من بين هذه الأخيرة وتم تحديد الطفرات فقط في تسلسل قليل النوكليوتيد العكسي المستخدم لتضخيم تفاعل البوليميراز المتسلسل (الشكل التكميلي S6c). أكد هذا الاختبار أن مستوى الخلفية في الجسم الحي كانت عمليات إعادة الترتيب التي لوحظت في هذه الدراسة منخفضة جدًا ، كما أنها توفر تقديرًا كميًا دقيقًا لدقة التسلسل المرتبطة بأوليغنوكليوتيدات المستخدمة في هذه الدراسة (حوالي 93٪). قد تكون مستويات الدقة النموذجية لأوليغنوكليوتيدات 60 نانومتر المحلاة منخفضة تصل إلى 60٪. ومع ذلك ، يمكن اعتبار نسبة أعلى بكثير من قليل النوكليوتيدات (93٪ محددة هنا) صحيحة لتطبيقات مختارة مثل TOR حيث يبدو أن عدة أنواع من عمليات الحذف 5 يمكن تحملها بواسطة طريقة التجميع هذه ، حيث يتم ملء فجوات قليل النوكليوتيد في الجسم الحي.

يعتمد تطوير لون المستعمرة في TOR على استخدام الكودون

في حين أن تطوير لون المستعمرة للعينات الإيجابية كان دالة لوقت الحضانة في TOR ، فإن اللون الذي يمنحه gfp كان الجين الموجود على لوحات CIX في جوهره أقل كثافة من تلك التي ينتجها aad (عينة سم-بالوزن، الشكل 3 أ الشكل التكميلي 8 أ). لاحظ رايت وهايوارد أنه عندما يكون المنهي في إطار مع CDS ، فإن الأحداث المتوقعة لإبطاء حركة الريبوسومات على الرنا المرسال ، على سبيل المثال ، ربط حمض الفوسيديك ، سمحت باستعادة الإنهاء 16. بناءً على هذا المبدأ ، أ gfp تم التنبؤ بأن المتحولة التي تحتوي على العديد من الكودونات النادرة تمنح لونًا أخضر أكثر إشراقًا على لوحات CIX مقارنةً بالنوع البري gfp. في المقابل ، فإن التعبير المشترك عن الحمض النووي الريبوزي النادر من البلازميد pRARE2 (انظر الطرق) في سلالة تعبر عن gfp مع الكودونات النادرة ، كان من المتوقع أن ينقذ لون المستعمرة الغامق. تم تأكيد هذه التنبؤات (الشكلان التكميليان S9 و S10). نظرًا لأنه من المتوقع أن تؤدي الكودونات النادرة إلى إبطاء حركة الريبوسومات في النص ، فإن عددًا أقل من الريبوسومات سيكون قادرًا على ملء منطقة mRNA في اتجاه مجرى النهر. وبالتالي هنا ، سيتم ملاحظة إنهاء نسخ ضعيف ولكن يمكن اكتشافه في T1 ، وستنخفض كثافة لون المستعمرة حتى في حالة عدم وجود طفرة تحول الإطار.


محتويات

تحرير البلازميدات

البلازميدات عبارة عن تسلسل كروموسومي إضافي مزدوج الشريطة وسلاسل DNA دائرية بشكل عام قادرة على التكاثر باستخدام آلية النسخ المتماثل للخلية المضيفة. [6] تتكون نواقل البلازميد بشكل ضئيل من أصل النسخ المتماثل الذي يسمح بالنسخ شبه المستقل للبلازميد في المضيف. توجد البلازميدات على نطاق واسع في العديد من البكتيريا ، على سبيل المثال في الإشريكية القولونية، ولكن يمكن العثور عليها أيضًا في عدد قليل من حقيقيات النوى ، على سبيل المثال في الخميرة مثل خميرة الخميرة. [7] قد تكون البلازميدات البكتيرية مترافقة / قابلة للانتقال وغير مقترنة:

  • الاقتران - التوسط في نقل الحمض النووي من خلال الاقتران وبالتالي ينتشر بسرعة بين الخلايا البكتيرية للسكان على سبيل المثال ، البلازميد F والعديد من R وبعض بلازميدات القولون.
  • غير مقترن - لا تتوسط الحمض النووي من خلال الاقتران ، على سبيل المثال ، العديد من البلازميدات R و col.

يشيع استخدام البلازميدات ذات الخصائص المصممة خصيصًا في المختبر لأغراض الاستنساخ. تكون هذه البلازميد بشكل عام غير مقترنة ولكن قد تحتوي على العديد من الميزات ، لا سيما "موقع استنساخ متعدد" حيث تسمح مواقع انشقاق إنزيم التقييد المتعددة بإدخال إدراج الجينات المحورة. يمكن للبكتيريا التي تحتوي على البلازميدات أن تولد ملايين النسخ من الناقل داخل البكتيريا في غضون ساعات ، ويمكن استخلاص النواقل المضخمة من البكتيريا لمزيد من التلاعب. يمكن استخدام البلازميدات على وجه التحديد كناقلات نسخ وقد تفتقر هذه البلازميدات إلى التسلسلات الحاسمة لتعبير البروتين. ستشمل البلازميدات المستخدمة لتعبير البروتين ، والتي تسمى نواقل التعبير ، عناصر لترجمة البروتين ، مثل موقع ربط الريبوسوم ، وكودونات البدء والإيقاف.

تحرير النواقل الفيروسية

النواقل الفيروسية بشكل عام هي فيروسات معدلة وراثيًا تحمل الحمض النووي الفيروسي أو الحمض النووي الريبي المعدل الذي أصبح غير معدي ، ولكنه لا يزال يحتوي على محفزات فيروسية وأيضًا الجين المحول ، مما يسمح بترجمة الجين المحول من خلال محفز فيروسي. ومع ذلك ، نظرًا لأن النواقل الفيروسية غالبًا ما تفتقر إلى التسلسلات المعدية ، فإنها تتطلب فيروسات مساعدة أو خطوط تعبئة من أجل تعداء على نطاق واسع. غالبًا ما يتم تصميم النواقل الفيروسية للدمج الدائم للإدخال في جينوم المضيف ، وبالتالي تترك علامات وراثية مميزة في جينوم المضيف بعد دمج الجين المحور. على سبيل المثال ، تترك الفيروسات القهقرية نمطًا مميزًا للتكامل الفيروسي بعد الإدخال يمكن اكتشافه ويشير إلى أن الناقل الفيروسي قد اندمج في جينوم المضيف.

تحرير الكروموسومات الاصطناعية

الكروموسومات الاصطناعية هي كروموسومات مُصنَّعة في سياق كروموسومات الخميرة الاصطناعية (YACs) ، أو الكروموسومات الاصطناعية البكتيرية (BACs) ، أو الكروموسومات البشرية الاصطناعية (HACs). يمكن للكروموسوم الاصطناعي أن يحمل جزءًا أكبر من الحمض النووي من النواقل الأخرى. [8] يمكن أن تحمل YACs و BACs جزءًا من الحمض النووي يصل طوله إلى 300000 نيوكليوتيد. ثلاث ضروريات هيكلية للكروموسوم الاصطناعي تشمل أصل التكرار ، وسنترومير ، ومتواليات نهاية تيلوميرية. [9]

يعد نسخ الجين المستنسخ مكونًا ضروريًا للناقل عندما يكون التعبير عن الجين مطلوبًا: يمكن تضخيم جين واحد من خلال النسخ لتوليد نسخ متعددة من mRNAs ، وهو القالب الذي يمكن أن ينتج البروتين من خلال الترجمة. [10] سيعبر عدد أكبر من الرنا المرسال عن كمية أكبر من البروتين ، ويعتمد عدد نسخ الرنا المرسال على المحفز المستخدم في الناقل. [11] قد يكون التعبير تأسيسيًا ، بمعنى أنه يتم إنتاج البروتين باستمرار في الخلفية ، أو قد يكون محفزًا حيث يتم التعبير عن البروتين فقط في ظل ظروف معينة ، على سبيل المثال عند إضافة محفز كيميائي. يعتمد هذان النوعان المختلفان من التعبير على أنواع المروج والمشغل المستخدم.

غالبًا ما تُستخدم المحفزات الفيروسية للتعبير التأسيسي في البلازميدات وفي النواقل الفيروسية لأنها عادةً ما تفرض النسخ المستمر في العديد من خطوط وأنواع الخلايا بشكل موثوق. [12] يعتمد التعبير المحرض على المحفزات التي تستجيب لظروف الاستقراء: على سبيل المثال ، يبدأ محفز فيروس ورم الثدي في الفئران بالنسخ فقط بعد تطبيق الديكساميثازون و ذبابة الفاكهة لا يبدأ محفز الصدمة الحرارية إلا بعد درجات حرارة عالية.

تم تصميم بعض النواقل للنسخ فقط ، على سبيل المثال في المختبر إنتاج مرنا. تسمى هذه النواقل نواقل النسخ. قد تفتقر إلى التسلسلات اللازمة لعملية ربط البولي أدينيل والإنهاء ، وبالتالي قد لا يتم استخدامها لإنتاج البروتين.

تنتج نواقل التعبير البروتينات من خلال نسخ إدراج المتجه متبوعًا بترجمة mRNA المنتجة ، وبالتالي فهي تتطلب مكونات أكثر من نواقل النسخ الأبسط فقط. قد يتطلب التعبير في كائن مضيف مختلف عناصر مختلفة ، على الرغم من أنها تشترك في متطلبات مماثلة ، على سبيل المثال مروج لبدء النسخ ، وموقع ربط ريبوزومي لبدء الترجمة ، وإشارات الإنهاء.

ناقل التعبير بدائيات النوى تحرير

  • المروج - المروجون المحفزون الشائع الاستخدام هم المروجون المشتقون من لاك أوبرون ومروج T7. من بين المروجين الأقوياء الأخرى المستخدمة Trp المروج و Tac-Promoter ، وهما مزيج من كل من مروجي Trp و Lac Operon. (RBS) - يتبع المروج ، ويعزز الترجمة الفعالة للبروتين محل الاهتمام.
  • موقع بدء الترجمة - تسلسل Shine-Dalgarno المرفق في RBS ، 8 أزواج أساسية من كودون البدء AUG.

ناقل التعبير حقيقيات النوى تحرير

تتطلب نواقل تعبير حقيقيات النوى تسلسلًا يشفر من أجل:

    : ينشئ ذيلًا متعدد الأدينيل في نهاية ما قبل الرنا المرسال المنسوخ والذي يحمي الرنا المرسال من نوكليازات خارجية ويضمن إنهاء النسخ والترجمة: يعمل على استقرار إنتاج الرنا المرسال.
  • الحد الأدنى لطول UTR: تحتوي UTR على خصائص محددة قد تعيق النسخ أو الترجمة ، وبالتالي فإن أقصر UTRs أو لا يتم ترميزها على الإطلاق في نواقل التعبير الأمثل. : يجب أن ترمز النواقل لتسلسل Kozak في mRNA ، الذي يجمع الريبوسوم لترجمة mRNA.

تحتوي النواقل الحديثة المصطنعة على مكونات أساسية موجودة في جميع النواقل ، وقد تحتوي على ميزات إضافية أخرى موجودة فقط في بعض النواقل:


النسخ

النسخ عنصر ضروري في جميع النواقل. الغرض من المتجه هو مضاعفة الإدخال ، على الرغم من أن ناقلات التعبير تقود أيضًا ترجمة الإدراج المضاعف. يتم تحديد التعبير المستقر عن طريق النسخ المستقر ، والذي يعتمد على المروجين في المتجه. ومع ذلك ، فإن نواقل التعبير لها نمطين تعبير: تكوين (تعبير ثابت) أو محفز (تعبير فقط في ظل ظروف أو مواد كيميائية معينة). يعتمد التعبير على أنشطة المروجين المختلفة ، وليس أنشطة ما بعد النسخ ، مما يعني أن هذين النوعين المختلفين من نواقل التعبير يعتمدان على أنواع مختلفة من المروجين. تتطلب نواقل التعبير ترجمة للمتجه وإدراج rsquos ، مما يتطلب مكونات أكثر من ناقلات أبسط للنسخ فقط.

تتطلب نواقل التعبير تسلسلات ترميز لـ:

  • ذيل متعدد الأدينيل في نهاية ما قبل الرنا المرسال المنسوخ: هذا يحمي الرنا المرسال من نوكليازات خارجية ويضمن إنهاء النسخ والترجمة ويثبت إنتاج الرنا المرسال.
  • الحد الأدنى لطول UTR: تحتوي UTR على خصائص محددة قد تعيق النسخ أو الترجمة ، لذلك يتم ترميز أقصر UTRs في متجهات التعبير الأمثل.
  • تسلسل كوزاك: يجب أن يشفر المتجه لتسلسل كوزاك في الرنا المرسال الذي يجمع الريبوسوم لترجمة الرنا المرسال.

الشروط المذكورة أعلاه ضرورية لناقلات التعبير في حقيقيات النوى ، وليس بدائيات النوى.

قد تشمل النواقل الحديثة ميزات إضافية إلى جانب إدراج الجينات المحورة والعمود الفقري:


17.5. ترجمة

يستهلك تخليق البروتينات طاقة الخلية أكثر من أي عملية استقلابية أخرى. في المقابل ، تمثل البروتينات كتلة أكبر من أي مكون آخر للكائنات الحية (باستثناء الماء) ، والبروتينات تؤدي تقريبًا كل وظيفة للخلية. تتضمن عملية الترجمة ، أو تخليق البروتين ، فك تشفير رسالة mRNA إلى منتج متعدد الببتيد. يتم ربط الأحماض الأمينية معًا تساهميًا عن طريق ربط روابط الببتيد بأطوال تتراوح من حوالي 50 من بقايا الأحماض الأمينية إلى أكثر من 1000. يحتوي كل حمض أميني فردي على مجموعة أمينية (NH2) ومجموعة الكربوكسيل (COOH). تتشكل البولي ببتيدات عندما تشكل المجموعة الأمينية لحمض أميني واحد رابطة أميد (أي ببتيد) مع مجموعة الكربوكسيل لحمض أميني آخر (الشكل 17.15). يتم تحفيز هذا التفاعل بواسطة الريبوسومات ويولد جزيء ماء واحد.

ماكينات تصنيع البروتين

بالإضافة إلى نموذج mRNA ، تساهم العديد من الجزيئات والجزيئات الكبيرة في عملية الترجمة. قد يختلف تكوين كل مكون عبر الأنواع على سبيل المثال ، قد تتكون الريبوسومات من أعداد مختلفة من الرنا الريباسي وعديد الببتيدات اعتمادًا على الكائن الحي. ومع ذلك ، فإن الهياكل والوظائف العامة لآلية تخليق البروتين قابلة للمقارنة من البكتيريا إلى الخلايا البشرية. تتطلب الترجمة إدخال نموذج mRNA وريبوسومات و tRNAs وعوامل إنزيمية مختلفة.

انقر من خلال خطوات برنامج PBS التفاعلي لرؤية تخليق البروتين قيد التنفيذ.

الريبوسومات

حتى قبل ترجمة mRNA ، يجب على الخلية أن تستثمر الطاقة لبناء كل من الريبوسومات الخاصة بها. في بكتريا قولونية ، هناك ما بين 10000 و 70000 ريبوسوم موجودة في كل خلية في أي وقت. الريبوسوم عبارة عن جزيء ضخم معقد يتكون من رنا هيكلي ومحفز ، والعديد من عديد الببتيدات المتميزة. النواة في حقيقيات النوى متخصصة تمامًا في تركيب وتجميع الرنا الريباسي.

توجد الريبوسومات في السيتوبلازم في بدائيات النوى وفي السيتوبلازم والشبكة الإندوبلازمية الخشنة في حقيقيات النوى. تمتلك الميتوكوندريا والبلاستيدات الخضراء أيضًا ريبوسومات خاصة بها في المصفوفة والسدى ، والتي تبدو أكثر تشابهًا مع الريبوسومات بدائية النواة (ولها حساسيات دوائية مماثلة) من الريبوسومات الموجودة خارج أغشيتها الخارجية في السيتوبلازم. تنفصل الريبوسومات إلى وحدات فرعية كبيرة وصغيرة عندما لا تقوم بتركيب البروتينات وإعادة الارتباط أثناء بدء الترجمة. في بكتريا قولونية ، يتم وصف الوحدة الفرعية الصغيرة على أنها 30S ، والوحدة الفرعية الكبيرة هي 50S ، بإجمالي 70S (تذكر أن وحدات Svedberg ليست مضافة). تحتوي ريبوسومات الثدييات على وحدة فرعية صغيرة 40 ثانية ووحدة فرعية كبيرة 60 ثانية ، بإجمالي 80 ثانية. الوحدة الفرعية الصغيرة مسؤولة عن ربط قالب mRNA ، في حين أن الوحدة الفرعية الكبيرة تربط بالتسلسل الحمض الريبي النووي النقال. يتم ترجمة كل جزيء mRNA في وقت واحد بواسطة العديد من الريبوسومات ، وكلها بروتينات مركّبة في نفس الاتجاه: قراءة mRNA من 5 & # 8242 إلى 3 & # 8242 وتوليف بولي ببتيد من الطرف N إلى الطرف C. يسمى هيكل mRNA / poly-ribosome الكامل a متعدد الروح.

الحمض الريبي النووي النقال

الحمض النووي الريبي (tRNAs) عبارة عن جزيئات هيكلية من الحمض النووي الريبي تم نسخها من الجينات بواسطة RNA polymerase III. اعتمادًا على الأنواع ، يوجد 40 إلى 60 نوعًا من الحمض الريبي النووي النقال في السيتوبلازم. تعمل كمحولات ، ترتبط tRNAs محددة بالتسلسلات الموجودة في قالب mRNA وتضيف الحمض الأميني المقابل إلى سلسلة polypeptide. لذلك ، الحمض النووي الريبي هو الجزيئات التي "تترجم" لغة RNA إلى لغة البروتينات.

من بين 64 كودون mRNA ممكن - أو مجموعات ثلاثية من A و U و G و C - تحدد ثلاثة منها إنهاء تخليق البروتين و 61 تحدد إضافة الأحماض الأمينية إلى سلسلة البولي ببتيد. من بين هؤلاء الـ 61 ، يشفر كودون واحد (AUG) أيضًا بدء الترجمة. يمكن لكل مضاد tRNA anticodon أن يقترن بأحد أكواد mRNA وإضافة حمض أميني أو إنهاء الترجمة ، وفقًا للشفرة الجينية. على سبيل المثال ، إذا حدث التسلسل CUA على قالب mRNA في إطار القراءة المناسب ، فسيؤدي ذلك إلى ربط الحمض الريبي النووي النقال الذي يعبر عن التسلسل التكميلي ، GAU ، والذي سيتم ربطه مع ليسين الأحماض الأمينية.

وباعتبارها جزيئات مهايئة للترجمة ، فمن المدهش أن الحمض الريبي النووي النقال يمكن أن يلائم الكثير من الخصوصية في مثل هذه الحزمة الصغيرة. ضع في اعتبارك أن الحمض النووي الريبي يحتاج إلى التفاعل مع ثلاثة عوامل: 1) يجب التعرف عليها من خلال مركب الأمينو أسيل المركب الصحيح (انظر أدناه) 2) يجب التعرف عليها بواسطة الريبوسومات و 3) يجب أن ترتبط بالتسلسل الصحيح في الرنا المرسال.

Aminoacyl tRNA Synthetases

عملية التوليف قبل tRNA بواسطة RNA polymerase III تخلق فقط جزء RNA من جزيء المحول. يجب إضافة الحمض الأميني المقابل لاحقًا ، بمجرد معالجة الحمض النووي الريبي (tRNA) وتصديره إلى السيتوبلازم. من خلال عملية "شحن" tRNA ، يتم ربط كل جزيء tRNA بالحمض الأميني الصحيح من خلال مجموعة من الإنزيمات تسمى مواد تركيبية aminoacyl tRNA. يوجد نوع واحد على الأقل من تركيبة aminoacyl tRNA لكل من الأحماض الأمينية العشرين ، ويختلف العدد الدقيق لمركبات aminoacyl tRNA باختلاف الأنواع. ترتبط هذه الإنزيمات أولاً وتحلل جزيء ATP لتحفيز رابطة عالية الطاقة بين الأحماض الأمينية والأدينوزين أحادي الفوسفات (AMP) ، ويتم طرد جزيء بيروفوسفات في هذا التفاعل. ثم يتم نقل الحمض الأميني المنشط إلى الحمض النووي الريبي ، ويتم تحرير AMP.

آلية تخليق البروتين

كما هو الحال مع تخليق mRNA ، يمكن تقسيم تخليق البروتين إلى ثلاث مراحل: البدء والاستطالة والإنهاء. تتشابه عملية الترجمة في بدائيات النوى وحقيقيات النوى. هنا سوف نستكشف كيف تحدث الترجمة بكتريا قولونية ، بدائيات النوى التمثيلية ، وتحديد أي اختلافات بين ترجمة بدائية النواة وترجمة حقيقية النواة.

بدء الترجمة

يبدأ تخليق البروتين بتكوين مركب البدء. في بكتريا قولونية ، يتضمن هذا المجمع الريبوسوم الصغير 30S ، قالب mRNA ، ثلاثة عوامل بدء (IFs IF-1 ، IF-2 ، IF-3) ، وعامل خاص البادئ tRNA. البادئ tRNA يتفاعل مع ابدأ الكودون AUG (أو نادرًا ، GUG) ، يرتبط بميثيونين مُركَّب يسمى fMet ، ويمكنه أيضًا ربط IF-2. يتم إدخال الميثيونين المُصاغ في بداية كل سلسلة بولي ببتيد يتم تصنيعها بواسطة بكتريا قولونية ، ولكن عادة ما يتم قصها بعد اكتمال الترجمة. عندما يتم مصادفة AUG داخل الإطار أثناء استطالة الترجمة ، يتم إدخال ميثيونين غير مهيأ بواسطة Met-tRNA Met منتظم.

في بكتريا قولونية mRNA ، وهو تسلسل في اتجاه المنبع من أول كودون AUG ، يسمى تسلسل Shine-Dalgarno (AGGAGG) ، يتفاعل مع جزيئات الرنا الريباسي التي تتكون منها الريبوسوم. يعمل هذا التفاعل على تثبيت الوحدة الفرعية الريبوسومية 30S في الموقع الصحيح على قالب الرنا المرسال. غوانوزين ثلاثي الفوسفات (GTP) ، وهو نيوكليوتيد ثلاثي الفوسفات البيورين ، يعمل كمصدر للطاقة أثناء الترجمة — في بداية الاستطالة وأثناء انتقال الريبوسوم.

في حقيقيات النوى ، أشكال معقدة بدء مماثلة ، تشمل mRNA ، 40S الوحدة الفرعية الريبوزومية الصغيرة ، IFs ، و nucleoside triphosphates (GTP و ATP). البادئ المشحون tRNA يسمى Met-tRNAأنا، لا يربط fMet في حقيقيات النوى ، ولكنه يختلف عن Met-tRNAs الأخرى في أنه يمكن أن يربط IFs.

بدلاً من الإيداع في تسلسل Shine-Dalgarno ، يتعرف مجمع البدء حقيقية النواة على غطاء 7-methylguanosine في 5 & # 8242 نهاية mRNA. يساعد بروتين ربط الغطاء (CBP) والعديد من IFs الأخرى في حركة الريبوسوم إلى الغطاء 5 & # 8242. بمجرد الوصول إلى الغطاء ، يتتبع مجمع البدء على طول mRNA في الاتجاه 5 & # 8242 إلى 3 & # 8242 ، ويبحث عن رمز بدء AUG. يتم ترجمة العديد من mRNAs حقيقية النواة من أول أغسطس ، ولكن هذا ليس هو الحال دائمًا. وفق قواعد كوزاك، تشير النيوكليوتيدات حول AUG إلى ما إذا كان كودون البدء الصحيح. تنص قواعد Kozak على أن تسلسل الإجماع التالي يجب أن يظهر حول AUG لجينات الفقاريات: 5 & # 8242-gccRccAUGG-3 & # 8242. تشير R (للبيورين) إلى موقع يمكن أن يكون إما A أو G ، ولكن لا يمكن أن يكون C أو U. بشكل أساسي ، كلما اقترب التسلسل من هذا الإجماع ، زادت كفاءة الترجمة.

بمجرد تحديد AUG المناسب ، تنفصل البروتينات الأخرى و CBP ، وترتبط الوحدة الفرعية 60S بمجمع Met-tRNAأناو mRNA والوحدة 40S. تكمل هذه الخطوة بدء الترجمة في حقيقيات النوى.

الترجمة والاستطالة والإنهاء

في بدائيات النوى وحقيقيات النوى ، أساسيات الاستطالة هي نفسها ، لذلك سنراجع الاستطالة من منظور بكتريا قولونية . الوحدة الفرعية 50S الريبوسومية من بكتريا قولونية يتكون من ثلاث حجرات: موقع A (aminoacyl) يربط aminoacyl tRNAs المشحونة الواردة. يرتبط موقع P (peptidyl) بـ tRNAs المشحونة التي تحمل الأحماض الأمينية التي شكلت روابط ببتيدية مع سلسلة polypeptide المتنامية ولكنها لم تنفصل بعد عن tRNA المقابل لها. يقوم موقع E (الخروج) بإطلاق الحمض النووي الريبي المنفصل بحيث يمكن إعادة شحنه بالأحماض الأمينية المجانية. هناك استثناء واحد لخط التجميع هذا من tRNAs: in بكتريا قولونية ، قادر على الدخول إلى موقع P مباشرة دون الدخول أولاً إلى الموقع A. وبالمثل ، فإن حقيقيات النوى Met-tRNAأنابمساعدة بروتينات أخرى من مجمع البدء ، يرتبط مباشرة بموقع P. في كلتا الحالتين ، يؤدي هذا إلى إنشاء مجمع بدء مع موقع مجاني جاهز لقبول الحمض الريبي النووي النقال المطابق للكودون الأول بعد AUG.

أثناء استطالة الترجمة ، يوفر قالب mRNA خصوصية. عندما يتحرك الريبوسوم على طول الرنا المرسال ، يتم تسجيل كل كودون مرنا ، ويتم ضمان الارتباط المحدد مع مضاد الكودون المشحون المقابل. إذا لم يكن الرنا المرسال موجودًا في مجمع الاستطالة ، فإن الريبوسوم سيربط الحمض النووي الريبي بشكل غير محدد.

يستمر الاستطالة بدخول الحمض النووي الريبي المشحون إلى الموقع A ثم الانتقال إلى موقع P متبوعًا بالموقع E مع كل "خطوة" من الكودون الفردي للريبوسوم. تحدث خطوات الريبوسوم عن طريق التغييرات التوافقية التي تقدم الريبوسوم بثلاث قواعد في الاتجاه 3 & # 8242. يتم التبرع بالطاقة لكل خطوة من خطوات الريبوسوم بواسطة عامل استطالة يحلل GTP. تتشكل روابط الببتيد بين المجموعة الأمينية للحمض الأميني المرتبط بـ tRNA في الموقع A ومجموعة الكربوكسيل للحمض الأميني المرتبط بـ الحمض الريبي النووي النقال في موقع P. يتم تحفيز تكوين كل رابطة الببتيد بواسطة بيبتيديل ترانسفيراز ، وهو إنزيم قائم على الحمض النووي الريبي (RNA) مدمج في الوحدة الفرعية الريبوزومية 50S. يتم اشتقاق الطاقة لكل تكوين رابطة ببتيد من التحلل المائي GTP ، والذي يتم تحفيزه بواسطة عامل استطالة منفصل. يرتبط الحمض الأميني المرتبط بـ P-site tRNA أيضًا بسلسلة البولي ببتيد المتنامية. عندما يخطو الريبوسوم عبر mRNA ، يدخل الحمض الريبي النووي النقال السابق لموقع P إلى موقع E ، وينفصل عن الحمض الأميني ، ويُطرد (الشكل 17.16). بشكل مثير للدهشة ، فإن بكتريا قولونية يستغرق جهاز الترجمة 0.05 ثانية فقط لإضافة كل حمض أميني ، مما يعني أنه يمكن ترجمة بروتين مكون من 200 حمض أميني في 10 ثوانٍ فقط.

يحدث إنهاء الترجمة عند مصادفة كودون لا معنى له (UAA أو UAG أو UGA). عند المحاذاة مع الموقع A ، يتم التعرف على هذه الأكواد غير المنطقية من خلال عوامل الإطلاق في بدائيات النوى وحقيقيات النوى التي توجه peptidyl transferase لإضافة جزيء ماء إلى نهاية الكربوكسيل للحمض الأميني P-site.يجبر هذا التفاعل الحمض الأميني P-site على الانفصال عن الحمض الريبي النووي النقال الخاص به ، ويتم إطلاق البروتين المصنوع حديثًا. تنفصل الوحدات الفرعية الريبوسومية الصغيرة والكبيرة عن الرنا المرسال ويتم تجنيدها عن بعضها على الفور تقريبًا في مجمع بدء ترجمة آخر. بعد اكتمال ترجمة العديد من الريبوسومات ، يتحلل الرنا المرسال بحيث يمكن إعادة استخدام النيوكليوتيدات في تفاعل نسخ آخر.

تمارين

العديد من المضادات الحيوية تمنع تخليق البروتين البكتيري. على سبيل المثال ، يحجب التتراسيكلين الموقع A على الريبوسوم البكتيري ، ويمنع الكلورامفينيكول نقل الببتيدل. ما هو التأثير المحدد الذي تتوقعه لكل من هذه المضادات الحيوية على تخليق البروتين؟

يؤثر التتراسيكلين بشكل مباشر على:

سوف يؤثر الكلورامفينيكول بشكل مباشر

طي البروتين وتعديله واستهدافه

أثناء الترجمة وبعدها ، يمكن تعديل الأحماض الأمينية الفردية كيميائيًا ، ويمكن إلحاق تسلسلات الإشارات ، و "يطوي" البروتين الجديد في بنية ثلاثية الأبعاد مميزة نتيجة للتفاعلات داخل الجزيئات. أ تسلسل الإشارة عبارة عن ذيل قصير من الأحماض الأمينية يوجه البروتين إلى قسم خلوي معين. يمكن اعتبار هذه التسلسلات في النهاية الأمينية أو نهاية الكربوكسيل للبروتين بمثابة "تذكرة قطار" للبروتين إلى وجهته النهائية. تتعرف العوامل الخلوية الأخرى على كل تسلسل إشارة وتساعد في نقل البروتين من السيتوبلازم إلى الحيز الصحيح. على سبيل المثال ، فإن تسلسلًا محددًا عند المحطة الأمينية سيوجه البروتين إلى الميتوكوندريا أو البلاستيدات الخضراء (في النباتات). بمجرد أن يصل البروتين إلى وجهته الخلوية ، يتم عادةً قطع تسلسل الإشارة.

تنثني العديد من البروتينات تلقائيًا ، لكن بعض البروتينات تتطلب جزيئات مساعدة ، تسمى مرافق ، لمنعها من التراكم أثناء عملية الطي المعقدة. حتى إذا تم تحديد البروتين بشكل صحيح من خلال mRNA المقابل ، فقد يتخذ شكلًا غير فعال تمامًا إذا كانت درجة الحرارة غير الطبيعية أو ظروف الأس الهيدروجيني تمنعه ​​من الطي بشكل صحيح.


الآليات الجزيئية لمقاومة المضادات الحيوية في المكورات المعوية

كما لوحظ سابقًا ، تُظهر المكورات المعوية مقاومة كبيرة لمجموعة متنوعة من العوامل المضادة للميكروبات. يكاد يكون من المؤكد أن هذه المقاومة ذات صلة في معظم البيئات البيئية الطبيعية التي تعيش فيها المكورات المعوية. كتعويض طبيعي للجهاز الهضمي البشري ، تتعرض المكورات المعوية بشكل روتيني لعدد لا يحصى من المضادات الحيوية في سياق العلاج الطبي المعاصر ، وتلعب مقاومة المكورات المعوية دورًا رئيسيًا في الديناميات البيئية التي تحدث أثناء وبعد العلاج بالمضادات الحيوية. بالإضافة إلى ذلك ، فقد أربكت مقاومتهم أفضل جهود الطب المعاصر للتعامل مع الالتهابات التي تسببها المكورات المعوية.

المقاومة الجوهرية & # x02014 التي تم ترميزها داخل الجينوم الأساسي لجميع أعضاء الأنواع & # x02014 تختلف عن المقاومة المكتسبة ، حيث أن الأخيرة موجودة فقط في بعض أعضاء الأنواع ويتم الحصول عليها عن طريق التبادل الأفقي للعناصر الوراثية المتنقلة (أو عبر الاختيار عند التعرض للمضادات الحيوية). تم تكريس قدر كبير من الجهد لفهم الآليات الجزيئية للمقاومة في المكورات المعوية. وقد أدى ذلك إلى تحديد المحددات التي تحدد المقاومة للعديد من المضادات الحيوية ، بما في ذلك تلك التي كانت (أو كانت في السابق) مفيدة سريريًا كعلاجات لعلاج عدوى المكورات المعوية ، وكذلك تلك التي تتعرض لها المكورات المعوية ، كمقاومات للبشر ، بشكل عرضي في دورة العلاج من الالتهابات التي تسببها البكتيريا الأخرى. في كثير من الحالات ، أدى هذا البحث إلى تطوير فهم التنظيم والأنشطة الكيميائية الحيوية لمحددات المقاومة ، وفي حالات مختارة ، قدم نظرة ثاقبة لعواقب مقاومة المضادات الحيوية على اللياقة البيولوجية للمكورات المعوية. سيقدم هذا القسم لمحة عامة عن آليات المقاومة التي تم فحصها في السنوات العشر الماضية.

مقاومة الجليكوببتيد

تُستخدم الببتيدات الجليكوبتيدية فانكومايسين والتيكوبلانين والمشتقات الأحدث لعلاج الالتهابات الخطيرة بسبب البكتيريا المقاومة إيجابية الجرام. معظم البكتيريا سالبة الجرام ليست عرضة للليكوببتيدات لأن غشاءها الخارجي يمنع الوصول إلى أهداف الببتيدوغليكان الموجودة في الفضاء المحيط بالببتيدات. تمنع Glycopeptides نمو البكتيريا عن طريق التدخل في التخليق الحيوي للببتيدوغليكان. تشكل المضادات الحيوية معقدات مع D-Ala-D-Ala peptide termini من سلائف الببتيدوغليكان على السطح الخارجي للخلية ، مما يمنع الإنزيمات الحيوية لجدار الخلية (بمعنى آخر.، PBPs) من استخدامها كركائز للارتباط بالجليكوزيل و transpeptidation ، وبالتالي إضعاف سلامة جدار الخلية.

تمت مراجعة مقاومة Glycopeptide على نطاق واسع (Arthur & # x00026 Courvalin، 1993 Arthur & # x00026 Quintiliani، Jr.، 2001 Courvalin، 2005 Courvalin، 2006 Depardieu، Podglajen، Leclercq، Collatz، & # x00026 Courvalin، 2007 Jaspan، et al.، 2010). الأساس الكيميائي الحيوي للمقاومة مستمد من تعديل هدف المضاد الحيوي. تنتج المكورات المعوية المقاومة للجليكوبيبتيد سلائف ببتيدوغليكان متغيرة حيث تم تعديل نهاية D-Ala-D-Ala بحيث تنتهي في D-Ala-D-lactate أو D-Ala-D-Ser. تقلل هذه البدائل من ألفة ارتباط المضادات الحيوية بسلائف الببتيدوغليكان (

تخفيض 1000 ضعف لـ D-Ala-D-lac

7 أضعاف لـ D-Ala-D-Ser). لا تزال السلائف المتغيرة تعمل كركائز لأنزيمات التخليق الحيوي لجدار الخلية لتمكين بناء ببتيدوغليكان وظيفي ، لكن التقارب المنخفض لببتيدات الجليكوببتيدات يجعل الأدوية غير قادرة على تثبيط التركيب الحيوي لجدار الخلية. يتم ترميز القدرة على إنتاج سلائف الببتيدوغليكان المقاومة للجليكوببتيد البديلة بواسطة عوامل المقاومة المشفرة عادةً على العناصر الوراثية المتنقلة (وبالتالي يمكن نقلها إلى مضيفات حساسة بخلاف ذلك). يتم ترميز أنواع معينة من مقاومة الجليكوببتيد في الكروموسوم كجزء من الجينوم الأساسي لبعض أنواع المكورات المعوية.

نظرة عامة على الآليات الجينية لمقاومة الجليكوببتيد

تم وصف تسع مجموعات جينية متميزة تمنح مقاومة الجليكوببتيد في المكورات المعوية. تختلف هذه المحددات عن بعضها البعض من الناحية الجينية والظاهرية ، بناءً على موقعها المادي (المشفر على عنصر وراثي متحرك أو في الجينوم الأساسي) ، وببتيدات الجليكوببتيدات المحددة التي تمنحها المقاومة (غالبًا ما يتم تمييزها عمليًا على أنها توفر مقاومة لكل من الفانكومايسين والتيكوبلانين ، أو توفير مقاومة لفانكومايسين ولكن ليس تيكوبلانين) مستوى المقاومة التي تمنحها ما إذا كانت المقاومة محفزة أو معبر عنها بشكل أساسي ونوع سلائف الببتيدوغليكان التي تنتجها منتجاتها الجينية. تكوِّد مجموعات جينات Van عدة وظائف: (1) وحدة تنظيمية ، وهي نظام نقل إشارة مكون من عنصرين يكون مسؤولاً عن استشعار وجود جليكوببتيدات وتنشيط التعبير عن جينات المقاومة في أنواع فان المحفزة (2) الإنزيمات التي تنتج سلائف الببتيدوغليكان المعدلة ، بما في ذلك الآلات الأنزيمية المطلوبة لإنتاج البديل المناسب (D-Lac أو D-Ser) ، و ligase الذي يدمج D-Ala إما D-Lac أو D-Ser لصنع ثنائي الببتيد المقابل الذي يمكن أن يكون مدمج في سلائف الببتيدوغليكان عبر آلية التخليق الحيوي العادية للخلية و (3) D ، D-carboxypeptidases التي تقضي على أي من سلائف الببتيدوغليكان العادية (غير المعدلة) التي تم تصنيعها بواسطة آلية التخليق الحيوي الطبيعية للخلية ، وبالتالي ضمان وصول جميع السلائف تقريبًا إلى سطح الخلية من النوع المعدل. عادةً ما يُشار إلى مجموعات جينات Van بالأسماء المعطاة إلى ligases التي تقوم بتشفيرها (VanA و VanB و VanC وما إلى ذلك). تعد أنواع VanA و VanB الأكثر شيوعًا بين العزلات السريرية وقد تمت دراستها بأكبر قدر من التفصيل.

يمنح محدد VanA (الشكل 1) مستوى عالٍ من المقاومة للفانكومايسين والتيكوبلانين. عادةً ما يتم ترميز VanA على Tn1546 أو الينقولات ذات الصلة ، ويتضمن سبعة إطارات قراءة مفتوحة مكتوبة من اثنين من المروجين المنفصلين. يتم ترميز الجهاز التنظيمي بواسطة VanR (منظم الاستجابة) ونظام VanS (مستشعر كيناز) المكون من مكونين ، والتي يتم نسخها من مروج مشترك ، بينما يتم نسخ الجينات المتبقية من مروج ثانٍ. تشمل المنتجات الجينية التي تحدد إنتاج سلائف الببتيدوغليكان المعدلة VanH (نازع الهيدروجين الذي يحول البيروفات إلى اللاكتات) و VanA (ligase الذي يشكل D-Ala-D-Llac dipeptide). تعمل الببتيدات VanX (dipeptidase الذي يشق D-Ala-D-Ala) و VanY (D ، D-carboxypeptidase) على القضاء على سلائف الببتيدوغليكان الطبيعية من الخلية. غالبًا ما يُشار إلى الجين السابع ، VanZ ، بوظيفة & # x0201caccessory & # x0201d ، لكن دوره في المقاومة غير مفهوم تمامًا.

شكل 1.

تنظيم مجموعات الجينات المقاومة للفانكومايسين. مقارنة بين لائحة VanA (اللوحة A) وتنظيم VanB (اللوحة B). يتم تثبيت كينازات مستشعر VanS (أو VanSB) في الغشاء السيتوبلازمي بواسطة جزأين من الغشاء (TM) يحيطان بالجزء المتوقع (المزيد).

يمنح موضع VanB (الشكل 1) مقاومة متوسطة إلى عالية المستوى للفانكومايسين ، ولكن لا يتم تحريضه بواسطة التييكوبلانين. عادة ما يتم الحصول على VanB علىTn5382/ تينيسي1549 نوع الينقولات ، التي تحدث على البلازميدات أو في كروموسوم العائل. يشبه التنظيم الجيني لـ VanB تنظيم VanA ، من حيث أنه يحتوي على اثنين من المروجين المتميزين الذين يقومون بنسخ سبعة إطارات قراءة مفتوحة ، ولكن هناك بعض الاختلافات المهمة. على سبيل المثال ، على الرغم من أن VanB يشفر نظامًا مكونًا من عنصرين (يسمى VanRب و VanSب) ، يختلف نظام الإشارات هذا اختلافًا كبيرًا عن ذلك المشفر في VanA. يقوم VanB بتشفير متجانسات VanH و D-Ala-D-Ala ligase (مشفر بواسطة VanB) ، وكذلك الببتيدات (VanX و VanY). ومع ذلك ، فإن VanB يفتقر إلى homolog من VanZ ، وبدلاً من ذلك يقوم بترميز بروتين يسمى VanW ، والذي لا يُفهم دوره في المقاومة تمامًا.

تنظيم مقاومة الجليكوببتيد

يتم التحكم في التعبير عن مقاومة الفانكومايسين عن طريق نظام نقل الإشارة المكون من مركبين VanR / VanS ، كما هو موضح في الشكل 1. يُعتقد أن مستشعر الكيناز VanS يتعرف على محفز (غير محدد التعريف) يشير إلى وجود فانكومايسين في البيئة. وبالتالي يصبح VanS نشطًا ويؤدي إلى الفسفرة الذاتية بقايا الهيستيدين المحفوظة على الجانب السيتوبلازمي للبروتين. يمكن نقل مجموعة الفسفوريل هذه إلى بقايا الأسبارتات المحفوظة على منظم استجابة VanR ، مما يؤدي إلى تقنين VanR ، وربط VanR المعزز بالمروجين الموجودين في موضع Van ، وبالتالي ، زيادة النسخ لكل من جينات مقاومة Van أيضًا كجينات تنظيمية (Depardieu ، Courvalin ، & # x00026 Kolb ، 2005). بالإضافة إلى ذلك ، هناك دليل قوي على أن VanS يعمل بمثابة فوسفاتاز لـ VanR في ظل ظروف غير محرضة ، لمنع تنشيط تعبير Van عبر الفسفرة الزائفة من كينازات المستشعر الأخرى في الخلية (تقاطع الكلام) ، أو عبر الفسفرة الذاتية لـ VanR من الأسيتيل- الفوسفات (Depardieu، Courvalin، & # x00026 Kolb، 2005). نتيجة لذلك ، يعد نشاط الفوسفاتيز في VanS أمرًا بالغ الأهمية للحفاظ على مسار الإشارات في حالة الخروج في حالة عدم وجود مضاد حيوي محفز. تؤدي الطفرات التي تضعف نشاط الفوسفاتيز في VanS (أو تزيل VanS تمامًا) إلى التعبير التأسيسي عن جينات المقاومة (Arthur & # x00026 Quintiliani، Jr.، 2001). من المعروف الآن أن هذا صحيح بالنسبة للعديد من مجموعات Van (Depardieu، Kolbert، Pruul، Bell، & # x00026 Courvalin، 2004 Panesso، et al.، 2010). في الواقع ، يمكن عزل المسوخات المقاومة بشكل أساسي التي تحمل الآفات في VanS من المرضى أثناء العلاج ببتيد الجليكوبتيد. على سبيل المثال ، فحص العزلات المتتالية من E. faecium تم الحصول عليها من مريض يعاني من عدوى بسلالة VanB كشفت عن حذف قصير في VanSب أدى كيناز إلى فقدان نشاط الفوسفاتيز ومقاومة الجليكوببتيد التأسيسي (Depardieu ، Courvalin ، & # x00026 Msadek ، 2003).

على الرغم من أن كل من VanA و VanB يعتمدان على أنظمة إشارات مكونة من عنصرين للتحكم في تعبير Van ، فمن الواضح أن هناك اختلافات مهمة بين هذه الأنظمة التنظيمية. على سبيل المثال ، VanS و VanSب تُظهر kinases المستشعرات هوية تسلسل قليلة نسبيًا في الجزء N-terminal الذي يعمل كموقع للتعرف على التحفيز. في الواقع ، فإن تسلسل الأحماض الأمينية لمجال الربط الترابطي خارج الخلية المتوقع لـ VanS قصير ، ومن المحتمل أن يشتمل فقط على حلقة قصيرة تربط حلزوني الغشاء خارج الغشاء ، مما يشير إلى أن VanS ينتمي إلى عائلة الاستشعار داخل الغشاء من كينازات المستشعر (Mascio ، Alder ، & # x00026 Silverman ، 2007) ، في حين أن المجال خارج الخلية المتوقع لـ VanSب أكبر بشكل كبير ويشكل على الأرجح مجالًا خارج الخلية مطويًا بشكل مستقل يعمل على التعرف على الإشارات المتشابهة. بالنظر إلى البنية المميزة لهذين المستشعرين ، يبدو من المعقول أن يتعرفوا ويستجيبوا للإشارات الجزيئية المختلفة لتحفيز تنشيط كيناز والتعبير عن جينات المقاومة. في الواقع ، هذا الاختلاف المتوقع في ارتباط اللجند & # x02014 وبالتالي ، في تحفيز نظام الإشارات & # x02014 هو الاختلاف في قابلية تيكوبلانين للمكورات المعوية التي تحتوي على VanA مقابل تلك التي تحتوي على VanB. على الرغم من أن الهوية الجزيئية لإشارة (إشارات) التحريض الفعلية لا تزال غير واضحة ، فإن جينات مقاومة VanA يتم تحفيزها عن طريق وجود كل من الفانكومايسين والتيكوبلانين (وبالتالي منح المقاومة لكليهما) ، ولكن جينات مقاومة VanB يتم تحفيزها فقط بواسطة فانكومايسين & # x02014hence ، تظل سلالات VanB عرضة للتيكوبلانين. من المذكرة ، VanSب يمكن أن تكتسب طفرات من أنواع مختلفة تؤدي إلى التعبير التأسيسي لجينات المقاومة أو إلى تحفيز بواسطة تيكوبلانين ، وبالتالي تغيير النمط الظاهري لهذه المسوخات التي تحمل موضع VanB.

التنظيم حسب العوامل المضيفة؟

تشير بعض الأدلة إلى أن واحدًا أو أكثر من كينازات الاستشعار المشفرة في جينوم مضيف المكورات المعوية يمكن أن تساهم في تنظيم جينات مقاومة فان. على سبيل المثال ، VanRب- يظل التعبير الجيني المعتمد محفزًا حتى في حالة عدم وجود VanSب (Baptista، Rodrigues، Depardieu، Courvalin، & # x00026 Arthur، 1999) ، مما يشير إلى أن مستشعر كيناز آخر يمكنه الفسفرة وتنشيط VanRب. وبالمثل ، فإن مجموعة VanE في E. faecalis يشفر VanSه كيناز الذي يُتوقع أن يكون غير وظيفي بسبب كودون توقف سابق لأوانه (Abad & # x000eda Pati & # x000f1o، Courvalin & # x00026 Perichon، 2002) ، ولكن هذه المقاومة مع ذلك تحفزها فانكومايسين (Foucault، Depardieu، Courvalin، & # x00026 Grillot -كورفالين ، 2010). تشير هذه النتائج إلى أن المكورات المعوية تقوم بتشفير أنظمة إشارات داخلية مكونة من عنصرين وظيفتها الطبيعية هي مراقبة سلامة جدار الخلية للاضطرابات ، وتفعيل الاستجابات التكيفية المناسبة لضمان صيانة جدار الخلية علاوة على ذلك ، تمكنت أشرطة الجين المقاومة للجليكوبيبتيد من استغلالها. هذه الأنظمة الذاتية للمساعدة في تنظيم مقاومة الجليكوببتيد. قد تلعب عوامل المضيف الأخرى أيضًا دورًا في تنظيم تعبير Van. على سبيل المثال ، قد يتأثر التعبير عن جينات مقاومة فانكومايسين VanE بالتغيير في الالتفاف الفائق للحمض النووي في E. faecalis (بولسن وآخرون ، 2003).

توسيع الأبجدية فان

بينما تستمر مجموعات مقاومة الفانكومايسين من نوع VanA و VanB في كونها الأشكال السائدة التي تفسر مقاومة الفانكومايسين في المستشفيات ، تم وصف مجموعات الجينات المقاومة الجديدة لـ Van مؤخرًا ، مما يجعل عدد مجموعات الجينات المعروفة القادرة على منح مقاومة Van إلى تسعة . وصف ليبرتون وزملاؤه (Lee، Huda، Kuroda، Mizushima، & # x00026 Tsuchiya، 2003) مؤخرًا مثل هذا التجمع الجيني الجديد ، المسمى VanN ، الذي يحدد دمج D-Ala-D-Ser في نهاية سلائف الببتيدوغليكان. ينضم VanN إلى مجموعات Van الأخرى التي تم وصفها مؤخرًا (Boyd، Willey، Fawcett، Gillani، & # x00026 Mulvey، 2008 Xu، et al.، 2010) المعروفة بتحديد دمج أي من D-Ala-D-Ser (VanC، VanE، VanG، وأنواع VanL) أو D-Ala-D-Lac (أنواع VanA و VanB و VanD و VanM) في سلائف الببتيدوغليكان.

تكلفة اللياقة لمقاومة الفانكومايسين

على الرغم من الآلية المعقدة التي تكمن وراء مقاومة الجليكوببتيد ، انتشرت المكورات المعوية المقاومة في جميع أنحاء العالم ، مما يشير إلى أن المقاومة تفرض تكلفة بيولوجية قليلة أو معدومة على البكتيريا. تم فحص هذه الفرضية بعناية باستخدام أزواج من سلالات المكورات المعوية المتجانسة مع طفرات معينة ، لتقييم تكلفة اللياقة البدنية لمقاومة الفانكومايسين أثناء النمو. في المختبر و في الجسم الحي (فرانك & # x00026 كليويل ، 1981). وجد الباحثون أن التعبير عن مقاومة الفانكومايسين فرض تكلفة لياقة كبيرة ، سواء عندما يكون التعبير ناتجًا عن المضاد الحيوي وعندما يكون التعبير أساسيًا بسبب طفرة في الجهاز التنظيمي. ومع ذلك ، فإن مقاومة الفانكومايسين غير المستحثة لا تفرض تكلفة لياقة قابلة للقياس. وبالتالي ، تقدم هذه النتائج أساسًا منطقيًا تطوريًا قويًا للتنظيم الصارم لمقاومة الفانكومايسين بواسطة نظام الإشارات المكون من عنصرين VanS / VanR الموجود في مجموعات جينات Van.

آلية بديلة لمقاومة الجليكوببتيد

تم وصف آلية جديدة لمقاومة الجليكوببتيد في الطفرات المقاومة للفانكومايسين المختارة في المختبر E. faecium (كريمنيتر وآخرون ، ٢٠٠٦). هذه الآلية غير مرتبطة بتلك المشفرة بواسطة مجموعات فان الجينية (أي تلك التي تنتج سلائف ببتيدوغليكان تحتوي على بدائل D-Lac أو D-Ser). اختار المحققون طفرات شديدة المقاومة في المختبر وأجرى تحليلًا مكثفًا لهيكل الببتيدوغليكان في المسوخ. كشف تحليلهم أن مسار L ، D-transpeptidase غير حساس لبيتا لاكتام (نوقش بمزيد من التفصيل أدناه ، تحت مقاومة الأمبيسلين) تم تنشيطه. هذا البديل transpeptidase (يسمى Ldtاف ام) قادر على ربط الببتيدوجليكان المعوي المتشابك باستخدام L-Lys الموجود في الموضع الثالث من جذع الببتيد (بدلاً من D-Ala الموجود في الموضع 4 ، كما هو معتاد في معظم PBPs). وجد الباحثون أن D-carboxypeptidase الخفي قد تم تنشيطه في المسوخات المقاومة للجليكوببتيد ، والتي أدى نشاطها إلى إنتاج سلائف جذعية الببتيدوغليكان التي تكون رباعيات الببتيدات (تفتقر إلى المحطة الطرفية D-Ala) ، بدلاً من الببتيدات الخماسية. هذه السلائف ليست ركائز للارتباط بالمضادات الحيوية غليكوببتيد ، ولكن يمكن ربطها بواسطة Ldtاف ام ترانسبيبتيداز. ومع ذلك ، لا يزال من غير المعروف ما إذا كانت آلية مقاومة الجليكوببتيد هذه مناسبة في العزلات السريرية.

مقاومة دابتومايسين

دابتومايسين هو مضاد حيوي شحمي قوي في المختبر نشاط مبيد للجراثيم ضد البكتيريا موجبة الجرام.لم يتم تحديد آلية العمل المضاد للميكروبات للدابتوميسين بشكل لا لبس فيه ، ولكن يُعتقد أنها تتضمن إدخالًا يعتمد على الكالسيوم في الغشاء السيتوبلازمي يليه إزالة الاستقطاب من الغشاء ، وإطلاق أيونات البوتاسيوم داخل الخلايا ، وموت الخلايا السريع (ألبورن ، الابن ، ألين ، & # x00026 Preston، 1991 Matsumura & # x00026 Simor، 1998 Silverman، Perlmutter، & # x00026 Shapiro، 2003). نظرًا لأن آلية عملها تختلف عن تلك الخاصة بالمضادات الحيوية الأخرى ، فإن دابتومايسين مفيد في علاج الالتهابات التي تسببها سلالات إيجابية الجرام المقاومة للأدوية المتعددة. لوحظت مقاومة الدابتومايسين في العزلات السريرية بعد العلاج بالدابتوميسين ، عادة نتيجة الطفرات في الجينات الصبغية. في المكورات العنقودية الذهبية، المقاومة مرتبطة بالطفرات في الجينات التي تشفر البروتينات مثل MprF ، و lysylphosphatidylglycerol synthetase YycG ، ومستشعر هيستيدين كيناز و RpoB و RpoC ، و & # x003b2 و & # x003b2 & # x02032 الوحدات الفرعية من بوليميريز RNA (.، 2011، Galimand ).

دابتومايسين سريري غير حساس E. faecium تم وصف سلالات (مولر ، لو بريتون ، مورين ، بيناشور ، أفراي ، & # x00026 Rinc & # x000e9 ، 2006). توصل الباحثون إلى أن هذه السلالات لا تحمل طفرات في متماثلات الجينات المعروفة بأنها تمنح عدم القابلية للإصابة بالدابتومايسين في بكتريا المكورة العنقودية البرتقالية (yycG, mprF, rpoB, rpoC في هذه الدراسة) ، مما يشير إلى وجود آلية جديدة أو أكثر لمقاومة الدابتومايسين في المكورات المعوية. ومع ذلك ، لم يتم تحديد الجينات المسؤولة عن المقاومة.

بدأت الدراسات الحديثة في استكشاف الأساس الجيني لمقاومة الدابتومايسين في المكورات المعوية (أرياس ، وآخرون ، 2011). جينومات زوج من E. faecalis تم عزل السلالات المعزولة من نفس المريض قبل وبعد العلاج بالدابتومايسين لتحديد الأشكال المتعددة التي تساهم في المقاومة (أرياس وآخرون ، 2011). في تلك الدراسة ، تم العثور على تعدد الأشكال المتسلسل الفريد في cls, gdpD (كلاهما يعتقد أنهما متورطان في استقلاب الفوسفوليبيد) و لياف، ولكن لم يتم العثور على تعدد الأشكال في متماثلات الجينات المحددة في مقاومة الدابتومايسين بكتريا المكورة العنقودية البرتقالية يعزل. متابعة التحليل مع في المختبر أدى اختيار المتغيرات المقاومة للدابتومايسين للسلالة الأصلية الحساسة إلى تحديد الطفرات في لياف و gdpD. الأهم من ذلك ، تم تحديد النمط الظاهري المقاوم للدابتومايسين على أنه نتيجة للطفرات المحددة ، حيث أن الطفرات الموجهة للموقع لإعادة تلخيص هذه الطفرات في مضيف حساس للدابتومايسين يمنح مقاومة معززة للدابتومايسين ، مما يدل على أن الطفرات في هذه الجينات تمنح المقاومة. وبالمثل ، في سلالة إكلينيكية زوج من E. faecium تعافى من مريض قبل وبعد العلاج بالدابتوميسين ، وهو تعدد الأشكال في cls تم تحديده (ولكن ليس في ليافسر أو الناتج المحلي الإجمالي) في المشتق المقاوم للدابتومايسين. تغييرات في cls, لياف, العلاقات، أو كذاب تم التعرف عليها أيضًا في عزلات أخرى من المكورات المعوية المقاومة للدابتومايسين ، مما يشير إلى أن مثل هذه الطفرات تلعب دورًا رئيسيًا في تطوير مقاومة الدابتومايسين في الجسم الحي. يبدو أن تطوير مقاومة الدابتومايسين مرتبط بتغيرات البنية التحتية العميقة في غلاف الخلية وجهاز الحاجز ، على الرغم من أنه لا يزال من غير الواضح ما إذا كانت هذه التغييرات مهمة وظيفيًا للمقاومة أو مجرد نتيجة عرضية للطفرات. LiaF هو جزء من نظام LiaFSR التنظيمي المكون من ثلاثة مكونات ، والذي يُعرف بتنسيق استجابة غلاف الخلية للمضادات الحيوية والببتيدات المضادة للميكروبات في بعض البكتيريا موجبة الجرام ، مما يشير إلى أن الاضطرابات في نشاط نظام الإشارات هذا قد تغير خصائص الغلاف. بطريقة لا يستطيع دابتوميسين التفاعل مع الغشاء بكفاءة أو إدخاله فيه.

في دراسات موازية ، اختار بالمر وزملاؤه بشكل منهجي المتغيرات المقاومة للدابتومايسين E. faecalis في المختبر (Palmer، Kos، & # x00026 Gilmore، 2010) بطريقة متدرجة ، ويميز ترتيب ظهور الطفرات التي تتوافق مع زيادة مقاومة الدابتوميسين. حددت مقارنة تسلسل الجينوم الكامل الطفرات في سبعة جينات ، بما في ذلك cls, rpoN، والجينات الإضافية التي لم يتم تحديد وظائفها الخلوية في سياقات أخرى. نقل cls متحولة أليل إلى حساس E. faecalis منحت السلالة مقاومة معززة للدابتومايسين ، والتي أثبتت بشكل لا لبس فيه أن cls الطفرة كافية للمقاومة. كشف التحليل الذي تم حله بمرور الوقت لظهور الطفرات أثناء التعرض للدابتومايسين ذلك cls ظهرت الطفرات في وقت مبكر في تحديدات مستقلة متعددة ، مما يبرز أهميتها. تم الحصول على طفرات إضافية مقاومة للدابتومايسين تفتقر إلى مثل هذا cls طفرة ، مما يدل على وجود مسارات بديلة لمقاومة الدابتومايسين. بشكل جماعي ، تشير نتائج هاتين الدراستين إلى أنه في حين أن الآليات الأساسية تختلف وراثيًا عن تلك المحددة في بكتريا المكورة العنقودية البرتقالية، من المحتمل أن يكون هناك دور لتكوين الفسفوليبيد الغشائي المتغير و / أو خصائص السطح في كل من المكورات العنقودية ومقاومة الدابتومايسين المعوية.

مقاومة الأمينوغليكوزيد

يعمل الأمينوغليكوزيدات عن طريق الارتباط بـ 16S rRNA للوحدة الفرعية الريبوزومية 30S والتدخل في تخليق البروتين. تظهر المكورات المعوية عمومًا مستوى معتدلًا من مقاومة الأمينوغليكوزيد الجوهرية التي تُعزى إلى ضعف امتصاص المضادات الحيوية. على سبيل المثال ، تحليل المسوخات المختارة التي أظهرت مقاومة الجنتاميسين المعززة في المختبر اقترح أن ضعف امتصاص الجنتاميسين يمكن أن يساهم بشكل مباشر في تعزيز المقاومة (Aslangul ، وآخرون ، 2006) ، على الرغم من أن الطفرات أو الجينات المسؤولة عن التغيير في الامتصاص لم يتم تحديدها بشكل لا لبس فيه. ومع ذلك ، تشير بعض الأدلة إلى أن الآليات الأخرى قد تساهم في ، أو حتى تكون مسؤولة بشكل أساسي ، عن المقاومة الجوهرية لبعض المكورات المعوية للأمينوغليكوزيدات.

مقاومة ذاتية معتدلة خاصة بالأنواع للأمينوغليكوزيدات في E. faecium تم تحسينه بواسطة ميثيل ترانسفيراز الرنا الريباسي المشفر كروموسومي ، EfmM (Galloway-Pe & # x000f1a ، Roh ، Latorre ، Qin ، & # x00026 Murray ، 2012) الذي يستخدم S-adenosyl methionine كمانح ميثيل لميثيل بقايا معينة على 16S rRNA ، في سياق الوحدة الفرعية الريبوسومية 30S. تعطيل efmM في E. faecium يزيد من الحساسية لأمينوغليكوزيدات كانامايسين وتوبراميسين ، وعلى العكس من ذلك ، التعبير عن نسخة مؤتلفة من efmM في الإشريكية القولونية يمنح مقاومة معززة لهذه الأدوية. إضافة 5-ميثيل إلى C1404 تعيق ارتباط أمينوغليكوزيد. بالإضافة إلى ذلك ، يتم ترميز 6 & # x02032-N-aminoglycoside acetyltransferase (aac (6 & # x02032) -Ii) يمنح مقاومة جوهرية منخفضة المستوى (Costa، ​​Galimand، Leclercq، Duval، & # x00026 Courvalin، 1993). يبدو أن التأثيرات الفسيولوجية لهذين العاملين مضافة ، بمعنى أن طفرة كلا الجينين أدت إلى أكبر انخفاض في المقاومة. ومع ذلك ، لا يزال من غير الواضح ما إذا كانت مقاومة الأمينوغليكوزيد هي الوظيفة الأساسية لـ EfmM. يشير موقع m5C1404 عند التقاطع بين موقع الريبوسوم A والموقع P في 16S rRNA إلى أن هذا التعديل قد يلعب أيضًا دورًا أساسيًا في تخليق البروتين من خلال التأثير على تفاعلات الكودون والمضاد.

تُمنح المقاومة عالية المستوى للأمينوغليكوزيدات (HLGR) من خلال آلية متميزة عن تلك الموضحة أعلاه ، والأهم من ذلك أنها تلغي النشاط التآزري للجراثيم للأمينوغليكوزيدات بالاشتراك مع جدار الخلية & # x02013 العوامل النشطة التي تعتبر مهمة في علاج عدوى المكورات المعوية الشديدة ، مثل التهاب الشغاف. عادة ما يتم الحصول على HLGR على عنصر متنقل يقوم بتشفير إنزيم معدّل للأمينوغليكوزيد. يمكن أن تكون هذه الإنزيمات عبارة عن إنزيمات فسفوتينية (APHs) تستخدم ATP لفوسفوريلات مجموعة هيدروكسيل على المضاد الحيوي ، و acetyltransferases (AACs) التي تستخدم acetyl-CoA لأسيتيل مجموعة أمينية على المضاد الحيوي ، أو nucleotidyltransferases (ANTs) التي تستخدم ATP. المجموعة على المضاد الحيوي. غالبًا ما يرتبط HLGR بأعضاء APH (2 & # x002b9 & # x002b9) -I phosphotransferase أو ثنائي الوظيفة AAC (6 & # x002b9) -Ie-APH (2 & # x002b9 & # x002b9) - عائلة مشفرة على ترانسبوزونات مختلفة أو البلازميدات المقترنة (تمت مراجعتها في (Kak ، Donabedian ، Zervos ، Kariyama ، Kumon ، & # x00026 Chow ، 2000)).

مقاومة ريفامبيسين

يمنع ريفامبيسين نمو البكتيريا عن طريق الارتباط بوحدة بيتا الفرعية لبوليميراز الحمض النووي الريبي (RpoB) ويمنع بدء النسخ (Wehrli، Kn & # x000fcsel، Schmid، & # x00026 Staehelin، 1968). يُستخدم الريفامبيسين لعقود كجزء من كوكتيل مضاد حيوي لعلاج الالتهابات التي تسببها السل الفطري، وقد وجد مؤخرًا استخدامًا متزايدًا في علاج عدوى المكورات العنقودية المرتبطة بالأجهزة الطبية الساكنة ، مثل المفاصل الاصطناعية. تنتج معظم مقاومة الريفامبيسين عن طفرات في مواقع معينة في الجين الذي يشفر الوحدة الفرعية بيتا لبوليميراز الحمض النووي الريبي ، مما يقلل من ألفة الريفامبيسين للبوليميراز. تم تحديد الطفرات في RpoB المسؤولة عن مقاومة الريفامبيسين في العديد من أنواع البكتيريا. بالإضافة إلى ذلك ، لوحظ تثبيط إنزيمي للريفامبيسين في عدد قليل من الحالات.

على الرغم من عدم استخدام ريفامبيسين على نطاق واسع لعلاج التهابات المكورات المعوية ، إلا أن المقاومة المكتسبة للريفامبيسين شائعة في المكورات المعوية & # x02014 ، تم العثور على 79٪ تقريبًا من 71 عزلة إكلينيكية تظهر مقاومة ريفامبيسين (أندروز ، آشبي ، جيفون ، مارشال ، لاينز ، & # x00026 Wise ، 2000) ، بالإضافة إلى & # x0003e57٪ من مجموعة متنوعة من العزلات من ستة بلدان في أوروبا (Lautenbach، Schuster، Bilker، & # x00026 Brennan، 1998). من المفترض أن يكون هذا جزئيًا على الأقل نتيجة لتعرض المكورات المعوية المتعايشة للريفامبيسين أثناء علاج الالتهابات غير المعوية ، ولكن هناك عوامل أخرى غير معروفة حتى الآن قد تساهم في حدوث عزلات معوية مقاومة أيضًا. في E. faecium، الاستبدالات في RpoB مرتبطة بمقاومة الريفامبيسين ، ومعظم أشكال RpoB التي تم تحديدها كانت متورطة سابقًا في منح المقاومة لأنواع أخرى من البكتيريا. التكلفة البيولوجية لمقاومة الريفامبيسين متغيرة ، اعتمادًا على الطفرة الخاصة في RpoB ، بالإضافة إلى الطفرات التعويضية المحتملة الأخرى التي قد تحدث في أماكن أخرى من الجينوم (Enne، Delsol، Roe، & # x00026 Bennett، 2004).

الطفرات العفوية المقاومة للريفامبيسين E. faecalis و E. faecium يتم عزلهم بسهولة في المختبر (كريستيش ، ليتل ، هول ، & # x00026 هوف ، 2011). تم تحديد الطفرات في rpoB كل هذه الطفرات في المواقع المعروف أنها مرتبطة بمقاومة الريفامبيسين في أنواع أخرى من البكتيريا. بالنسبة لاثنين من المسوخات الخاصة ، تأكد من أن rpoB تعتبر الطفرات النقطية مسؤولة بالفعل عن مقاومة الريفامبيسين التي تم الحصول عليها من خلال التعبير عن الأليلات الطافرة في مضيف حساس للريفامبيسين. كانت إحدى الملاحظات غير المتوقعة هي أن بعض طفرات RpoB أدت إلى تغيير في مقاومة السيفالوسبورين بطريقة خاصة بالأليل. على وجه الخصوص ، فإن rpoB منحت طفرة H486Y مقاومة معززة إلى حد كبير للسيفالوسبورين في سلالات متعددة من E. faecalis ، وكذلك في E. faecium، في حين أن البدائل الأخرى المقاومة لـ Rif في rpoB لم تؤثر على مقاومة السيفالوسبورين. الأساس الآلي لهذه الملاحظة غير معروف ، لكن rpoB قد يغير استبدال H486Y معدلات نسخ الجينات التي تساهم في مقاومة السيفالوسبورين الذاتية في المكورات المعوية.

مقاومة الريفامبيسين في بعض عزلات E. faecium يمكن عكسه عن طريق إدراج تركيزات مثبطة للداابتوميسين. لا يمكن تفسير هذه الظاهرة بـ 1) تغيير نقل الريفامبيسين إلى الخلية أو التدفق منها بواسطة دابتومايسين 2) التعطيل المباشر للريفامبيسين و 3) الطفرات في موقع الارتباط بالريفامبيسين في rpoB (رينولدز & # x00026 كورفالين ، 2005). لا يزال التفسير الجزيئي لهذا التأثير غير معروف ويتوقع المؤلفون أنه قد تكون هناك آلية أخرى لمقاومة الريفامبيسين إلى جانب الآليتين المعروفتين (أي الطفرة في rpoB تثبيط الجين والريفامبيسين). أُطلق على هذه الآلية الثالثة اسم & # x0201cdaptomycin-reverse المقاومة ، & # x0201d وستكون هناك حاجة إلى مزيد من التحقيق لتحديد أساسها.

مقاومة الكينولون

تظهر الكينولونات عمومًا نشاطًا معتدلًا فقط ضد المكورات المعوية. تمنع الكينولونات نمو البكتيريا عن طريق التدخل في تكرار الحمض النووي ، وتحديداً عن طريق الارتباط بالنوع الثاني من التوبيزوميراز التي تتحكم في الالتفاف الفائق للحمض النووي (DNA gyrase و DNA topoisomerase IV) وتثبيط وظيفتها ، مما يؤدي إلى حدوث فواصل مميتة في الشرائط المزدوجة في الحمض النووي. تحدث مقاومة الكينولون في العديد من أنواع البكتيريا عن طريق الطفرات في & # x0201cquinolone المقاومة التي تحدد المناطق & # x0201d من الجينات التي تشفر gyrase و topoisomerase IV. تمنع هذه الطفرات الارتباط الفعال للمضاد الحيوي بالإنزيم ، مما يتيح استمرار تكرار الحمض النووي على الرغم من وجود المضاد الحيوي. وقد لوحظت مثل هذه الطفرات في عزلات الكينولون المقاومة للكينولون السريرية والمشتقة من المختبر من المكورات المعوية (Kak، Donabedian، Zervos، Kariyama، Kumon، & # x00026 Chow، 2000 Oyamada Y.، Ito، Inoue، & # x00026 Yamagishi، 2006 Palmer، Daniel، Hardy، Silverman، & # x00026 Gilmore، 2011 Werner، Fleige، Ewert، Laverde-Gomez، Klare، & # x00026 Witte، 2010) ، ويفترض أنها تعمل على منح مقاومة معززة للكينولون من خلال آلية مماثلة.

الآلية الثانية المعروفة بالمساهمة في مقاومة الكينولون في الأنواع الأخرى من البكتيريا هي تدفق المضاد الحيوي خارج الخلية. غالبًا ما يكون هذا التدفق هو وظيفة مضخات ذات خصائص ركيزة واسعة نسبيًا أو غير محددة ، والتي يشار إليها أحيانًا باسم مضخات التدفق المقاومة للأدوية المتعددة (MDRs). عادة ما توجد الجينات التي تشفر MDR على الكروموسوم البكتيري. على الرغم من أن الوظائف الفسيولوجية الأولية لمعظم MDRs لا تزال غير واضحة ، فمن المعروف أن هذه البروتينات تنقل بنشاط المركبات السامة خارج الخلية. جينوم E. faecalis من المتوقع أن يقوم V583 بتشفير 34 MDRs (Davis، et al.، 2001) ، مما يشير إلى أن تدفق الدواء قد يلعب دورًا مهمًا في مقاومة المضادات الحيوية. اثنتان من هذه المضخات متورطان تجريبياً في تعزيز مقاومة الكينولون. الأول هو EmeA ، وهو متماثل لـ المكورات العنقودية الذهبية MDR نورا. أدى تحور EmeA إلى زيادات متواضعة في القابلية للعديد من المركبات ، بما في ذلك الكينولونات (Jung ، وآخرون ، 2010) ، ومعالجة النوع البري. E. faecalis يمنع OG1RF مع مثبطات MDR المعروفة (ريزيربين ، لانسوبرازول ، وفيراباميل) تدفق الكينولون نورفلوكساسين ، وكذلك مركب إيثيديوم بروميد السام. المضخة الثانية هي EfrAB ، وهي عبارة عن ناقل من نوع ABC يعزز المقاومة لمجموعة متنوعة من المركبات غير المرتبطة هيكليًا ، بما في ذلك الكينولونات ، عند التعبير عنها في بكتريا قولونية (Lefort، Saleh-Mghir، Garry، Carbon، & # x00026 Fantin، 2000). لم يتم التحقيق في وظيفتها في المكورات المعوية.

تم تحديد آلية جديدة لمقاومة الكينولون & # x02014 حماية DNA gyrase و topoisomerase IV من تثبيط الكينولونات. يتم توفير هذا النشاط من قبل أعضاء عائلة بروتين Qnr التي تم تحديدها في الأصل في البكتيريا المعوية كنوع قابل للانتقال من مقاومة الكينولون (Mascher، Helmann، & # x00026 Unden، 2006). تظل الوظيفة الطبيعية لبروتينات Qnr غير واضحة. تتميز هذه البروتينات بتكرار خماسي الببتيد الترادفي ، ويبدو أن متماثلات Qnr مشفرة في جينومات البكتيريا المختلفة. تعطيل متماثل لـ Qnr المحدد في جينوم E. faecalis، المكونة من 42 تكرارًا متوقعًا لخماسي الببتيد ، أدى إلى انخفاض متواضع في مقاومة الفلوروكينولونات. أدى الإفراط في التعبير عن الجين المقابل إلى زيادة المقاومة. علاوة على ذلك ، فإن التعبير عن E. faecalis الجين في الكائنات غير المتجانسة ، بما في ذلك بكتريا المكورة العنقودية البرتقالية و المكورات اللبنية، زاد من مستوى مقاومة الكينولون في تلك العوائل (Ars & # x000e8ne & # x00026 Leclercq ، 2007). منع EfsQnr المنقى نشاط اللفائف الفائق للحمض النووي المعتمد على ATP لـ بكتريا قولونية gyrase (Hellinger، Rouse، Rabadan، Henry، Steckelberg، & # x00026 Wilson، 1992) ، مما يشير إلى أن EfsQnr قد تحمي E. faecalis من تأثيرات الكينولونات عن طريق تعديل عمل الجيراز في الخلايا.

مقاومة الماكروليد واللينكوساميد والستربتوجرين

تمنع المضادات الحيوية للماكروليدات واللينكوزاميدات والستربتوجرين تخليق البروتين عن طريق الارتباط بالوحدة الفرعية 50S من الريبوسوم. لا تُستخدم الماكروليدات واللينكوساميدات لعلاج عدوى المكورات المعوية ، لكن مقاومتها منتشرة على نطاق واسع (Jonas، Murray، & # x00026 Weinstock، 2001). الشكل الأكثر شيوعًا للمقاومة المكتسبة للماكروليدات هو إنتاج إنزيم يقوم بميثيل أدينين معين في 23S rRNA للوحدة الفرعية الريبوزومية 50S ، مما يقلل من ألفة ارتباط الماكروليد بالريبوسوم. يقلل هذا التعديل أيضًا من ارتباط المضادات الحيوية للينكوساميد والستربتوجرين ب بالريبوسوم. عادةً ما يتم ترميز الإنزيم المسؤول بواسطة ermB الجين ، وغالبًا ما يشار إلى النمط الظاهري باسم MLSب. مضخة تدفق ، مشفرة بواسطة قابل للنقل ميفا الجين ، المعروف أيضًا بضخ الماكروليدات خارج الخلية ، ولكنه يمنح مستوى أقل من المقاومة من ermB (كلانسي وآخرون ، 1996).

E. faecalis و E. faecium من المعروف أنها تُظهر حساسيات جوهرية مختلفة للكوينوبريستين دالفوبريستين (Q-D) ، أعضاء عائلة الستربتوجرامين التي تعمل بشكل تآزري. E. faecalis مقاومة جوهرية بدرجة كافية بحيث لا يمكن استخدام هذه المضادات الحيوية علاجيًا ، بينما E. faecium عادة ما يكون حساسا. يبدو أن الأساس الجزيئي لهذا الاختلاف ينبع من وجود ناقل ABC مفترض مشفر كروموسوميًا في E. faecalis الجينوم ، المسمى Lsa (198). يتم ترميز Lsa في جينوم جميع عزلات E. faecalis تم تقييمها (ن = 180) ، ولكن في أي من جينومات المكورات المعوية الأخرى (ن = 189). تعطيل lsa الجين فيها E. faecalis أدى OG1RF إلى انخفاض & # x0003e40 ضعفًا في MIC إلى Q-D. بالإضافة إلى ذلك ، التعبير عن E. faecalis V583 lsa الجين غير حساس بخلاف ذلك E. faecium أدى إلى زيادة ستة أضعاف في MIC. التعبير عن lsa في المضيف غير المتجانسة المكورات اللبنية زادت أيضًا مقاومة Q-D بشكل معتدل (Singh & # x00026 Murray ، 2005). المزيد من الدعم لدور Lsa في مقاومة Q-D ينبع من ملاحظة أن العزلات السريرية لـ E. faecalis التي هي عرضة لللينكوساميدات والدالفوبريستين يؤويان الطفرات في lsa التي تؤدي إلى رموز الإيقاف المبكرة (Dina، Malbruny، & # x00026 Leclercq، 2003).ومع ذلك ، لم يتم تقييم تأثير Lsa على تدفق أو نقل المضادات الحيوية بشكل مباشر. ستكون مثل هذه الدراسات مفيدة في تحديد الآلية التي يوفر بها Lsa المقاومة ، حيث يحتوي البروتين نفسه على نطاقات ربط ATP مميزة لناقلات ABC ، ​​ولكنه يفتقر إلى تسلسلات الغشاء التي يمكن تحديدها والتي يمكن توقعها من مضخة تدفق أصلية. على هذا النحو ، تظل الآلية الجزيئية لعمل Lsa مجهولة. ظهرت المقاومة المكتسبة لـ Q-D في E. faecium، ويتوسطها أعضاء من عائلة الإنزيمات streptogramin acetyltransferase من الإنزيمات التي أسيتيل الستربتوجرين A (مثل VatH) ، وجينات Vga ، التي تشفر ناقل ABC الذي يفترض أنه يعمل على تصدير المضاد الحيوي من الخلية (Kak & # x00026 Chow ، 2002).

مقاومة بيتا لاكتام

تعمل المضادات الحيوية في عائلة بيتا لاكتام على تثبيط نمو البكتيريا من خلال العمل كركائز انتحارية لـ D و D-transpeptidases (المعروفة أيضًا باسم بروتينات ربط البنسلين أو PBPs) التي تحفز الارتباط المتقاطع للسلاسل الجانبية للببتيدوغليكان أثناء تخليق الببتيدوغليكان الناضج . بمجرد تعديله بمضاد حيوي بيتا لاكتام ، يتم تعطيل PBPs ، وبالتالي يمنع استمرار تخليق جدار الخلية. تُظهر المكورات المعوية عدم قابلية ذاتية للمضادات الحيوية بيتا لاكتام ، لكن مدى عدم القابلية للإصابة يختلف باختلاف فئات بيتا لاكتام وبين أنواع المكورات المعوية: البنسلين لها أكبر نشاط ضد المكورات المعوية (و E. faecium بطبيعته أكثر مقاومة من E. faecalis) ، الكاربابينيمات أقل قليلاً ، والسيفالوسبورينات تظهر أقل نشاط. ينعكس هذا الطيف من النشاط في فائدة هذه الأدوية في العلاج ، طالما أن الأمبيسلين لا يزال علاجًا فعالًا لعدوى المكورات المعوية الحساسة ، لكن السيفالوسبورينات غير فعالة تمامًا ضد المكورات المعوية. في الواقع ، يعد الاستخدام المسبق للسيفالوسبورينات أحد عوامل الخطر الرئيسية لاكتساب عدوى المكورات المعوية (تمت مراجعتها في (Shepard & # x00026 Gilmore ، 2002)).

تتضمن عدم القابلية الجوهرية للمكورات المعوية تجاه بيتا لاكتام إنتاج بروتين رابط للبنسلين 5 (Pbp5) منخفض التقارب من الفئة B ، وهو مقوم لـ Pbp2a منخفض التقارب المعبر عنه بواسطة عزلات مقاومة للميثيسيلين. المكورات العنقودية الذهبية (Gonzales، Schrekenberger، Graham، Kelkar، DenBesten & # x00026 Quinn، 2001). بسبب تقاربها المنخفض نسبيًا مع بيتا لاكتام ، فإن Pbp5 المشفر كروموسوميًا قادر على إجراء تخليق ببتيدوغليكان بتركيزات من المضادات الحيوية بيتا لاكتام التي تشبع جميع المكورات المعوية الأخرى PBPs (Canepari ، Lle & # x000f2 ، Cornaglia ، Fontana ، & # x00026 Satta ، 1986) ، وبالتالي فهو مطلوب لمقاومة بيتا لاكتام (Arbeloa، et al.، 2004 Rice LB، Carias، Rudin، Lakticov & # x000e1، Wood، & # x00026 Hutton-Thomas، 2005). Pbp5 مطلوب لكل من سمات مقاومة بيتا لاكتام الجوهرية للمكورات المعوية ، مثل مقاومة السيفالوسبورين الجوهرية ، وكذلك للمقاومة المكتسبة (المعززة) لأعضاء عائلة بيتا لاكتام (مثل الأمبيسلين) ، التي تتأثر بها المكورات المعوية خلاف ذلك عرضة سريريا. أدناه ، نناقش مقاومة عائلتين مختلفتين من المضادات الحيوية بيتا لاكتام (السيفالوسبورينات والأمبيسلين) بمزيد من التفصيل.

مقاومة السيفالوسبورين الجوهرية

E. faecalis و E. faecium مقاومة طبيعية (جوهرية) للسيفالوسبورينات. عُرفت هذه السمة لعقود من الزمن وتم ترميزها بواسطة محددات صبغية في الجينوم الأساسي لهذه الكائنات الحية ، لكن أساسها الجزيئي لا يزال غير مفهوم تمامًا. حتى الآن ، في E. faecalis، تم إثبات أن حفنة من المحددات الجينية مطلوبة لمقاومة السيفالوسبورين الجوهرية: البروتين المرتبط بالبنسلين منخفض التقارب Pbp5 وهو نظام نقل إشارة مكون من عنصرين ، و CroRS وهو الغشاء Ser / Thr kinase ، و IreK وواحد من الإنزيمات المبكرة المعنية في تركيب سلائف الببتيدوغليكان ، مورا. تمت دراسة دور هذه المحددات بشكل أفضل في E. faecalis، على الرغم من أنه يبدو من المحتمل وجود آليات مماثلة في E. faecium.

الدراسات الجينية على الطفرات متساوية المنشأ E. faecalis و E. faecium تقديم دليل واضح على الحاجة إلى Pbp5 في مقاومة السيفالوسبورين الجوهرية (Arbeloa، et al.، 2004 Rice L.B، Carias، Rudin، Lakticov & # x000e1، Wood، & # x00026 Hutton-Thomas، 2005). طفرات الحذف التي تفتقر إليها pbp5 تظهر انخفاضات كبيرة في مستوى مقاومة السيفالوسبورين. تظهر طفرات الحذف أيضًا انخفاضًا في مقاومة بيتا لاكتام غير السيفالوسبورين ، الأمبيسلين ، على الرغم من أن حجم الانخفاض أكثر تواضعًا (خاصة بالنسبة لـ E. faecalis). غالبًا ما يتم تصنيف PBPs عالية الوزن الجزيئي على أنها الفئة A (ثنائية الوظيفة ، تظهر كل من أنشطة transglycosylase و transpeptidase) والفئة B (أحادية الوظيفة ، تظهر نشاط transpeptidase ولكنها تفتقر إلى نشاط transglycosylase). كفئة B PBP ، يحتوي Pbp5 على مجال transpeptidase ، لكنه يفتقر إلى مجال transglycosylase ، وهو أمر ضروري للبلمرة الأولية لشق السكاريد من سلائف الببتيدوغليكان. لذلك ، على الرغم من أن Pbp5 قادر على تصنيع الروابط المتقاطعة بين سلاسل الببتيد الجانبية للببتيدوغليكان ، يجب أن يتعاون Pbp5 مع واحد أو أكثر من إنزيمات الجليكوزيلات من أجل التخليق الحيوي لجدار الخلية. يشتمل شركاء ترانسجليكوزيلاز المرشحون على ثلاثة ثنائية الوظيفة من الفئة أ للمكورات المعوية PBPs (أو من حيث المبدأ ، إنزيمات transglycosylase أحادية الوظيفة مماثلة لـ Mgt of المكورات العنقودية الذهبية، على الرغم من عدم تحديد أي أمثلة حتى الآن في المكورات المعوية). تحليل طفرات الحذف متساوي المنشأ التي تفتقر إلى واحد أو أكثر من PBPs من الفئة A في كليهما E. faecalis و E. faecium كشف أن Pbp5 يتعاون مع واحد من PBPs من الفئة A أو كلاهما ، إما PbpF أو PonA ، للسماح بالنمو في وجود السيفالوسبورينات. الفئة الثالثة A PBP (PbpZ) المشفرة بواسطة هذه الكائنات غير قادرة على توفير نشاط transglycosylase في وجود السيفالوسبورينات. المسوخ الثلاثي إما E. faecalis أو E. faecium التي تفتقر إلى جميع PBPs الثلاثة من الفئة A قابلة للحياة (على الرغم من أنها عرضة للسيفالوسبورينات) ، مما يشير إلى أنه يجب وجود ترانسجليكوزيلات إضافية غير محددة حتى الآن قادرة على بلمرة الببتيدوغليكان. نظرا لعدم وجود طفرات مزدوجة pbpF و بون أ حساسة للسيفالوسبورينات ، يبدو أن هذه الترانسجليكوزيلات غير المعروفة ليس لديها القدرة على المشاركة في التفاعلات الوظيفية مع Pbp5. من الجدير بالملاحظة ، في حين أن الكثير من تحليل حذف PBP يشير إلى أوجه تشابه كبيرة في الآليات الأساسية لوظيفة Pbp5 في E. faecalis و E. faecium، حذف الفئة A PBPs بتنسيق E. faecium كشف تفكك غير متوقع بين التعبير عن مقاومة سيفترياكسون والأمبيسيلين الذي لم يتم ملاحظته في E. faecalis (رايس إل ب ، كارياس ، رودين ، لاكتيكوف & # x000e1 ، وود ، & # x00026 هوتون توماس ، 2005) ، مما يشير إلى أن Pbp5 بوساطة تشابك ببتيدوجليكان في E. faecium كان عرضة بشكل مختلف للبيتا لاكتام ، اعتمادًا على الشريك glycosyltransferase.

CroRS

جينوم E. faecalis يقوم V583 بتشفير 17 نظام تحويل إشارة مكونين (TCS) (Hancock & # x00026 Perego ، 2004). كشف التعطيل المنهجي لهذه TCSs والتوصيف المظهري للطفرات أن تعطيل CroRS قدم E. faecalis عرضة لسيفالوسبورينات ممتدة الطيف ، ولكن ليس لمجموعة من المضادات الحيوية التي تزعج العمليات الخلوية الأخرى (هارتمان وآخرون ، 2010). تتوافق هذه النتائج مع دراسات في سلالة أخرى من E. faecalis، حيث أدى حذف الجينات التي تشفر CroRS TCS إلى فقدان مقاومة سيفترياكسون (Comenge ، وآخرون ، 2003). كشف تحليل إضافي لطفرة الحذف أن فقدان وظيفة CroRS لم يغير التعبير عن Pbp5 ، أو إنتاج سلائف الببتيدوغليكان ، أو ربط ببتيدوغليكان. يبدو أن CroRS TCS يعمل وفقًا للنماذج التقليدية لـ TCSs ، حيث يمكن لـ CroS kinase أن يفسد نفسه بطريقة تعتمد على ATP ، متبوعًا بنقل مجموعة الفوسفوريل إلى منظم استجابة CroR. يحتوي منظم استجابة CroR على مجال ربط وظيفي للحمض النووي ، مما يشير إلى أن إعادة صياغة النسخ ضرورية للتكيف مع الإجهاد الذي تفرضه السيفالوسبورينات. ومع ذلك ، لم يتم تحديد سوى عدد قليل من الجينات التي يتم التحكم فيها بشكل مباشر بواسطة CroR حتى الآن. وتشمل هذه سالب، ترميز البروتين المفرز الذي لا يساهم في مقاومة السيفالوسبورين (موراي ، 1990) ، croRS نفسها (Murray ، 1990) ، والجينات التي تشفر ناقل الجلوتامين المفترض (Lebreton ، وآخرون ، 2011) مع عدم وجود صلة واضحة بمقاومة السيفالوسبورين. علاج E. faecalis أسفرت الخلايا التي تحتوي على مجموعة من المضادات الحيوية النشطة في جدار الخلية عن تحريض محفز معتمد على CroR ، ولكن لا يُعرف أي شيء أكثر عن طبيعة الإشارة (الإشارات) الفسيولوجية التي تؤثر على تنظيم CroS kinase لمقاومة السيفالوسبورين.

بالإضافة إلى CroRS TCS ، يلزم وجود بروتين ثانٍ لنقل الإشارة (IreK) لمقاومة السيفالوسبورين في E. faecalis. يعرض IreK بنية مجال ثنائية مميزة تتضمن & # x0201ceukaryotic-type & # x0201d Ser / Thr kinase مقترنًا ، من خلال مقطع غشائي مفترض ، إلى سلسلة من خمسة تكرارات لمجال PASTA. متماثلات IreK شبه عالمية بين جينومات البكتيريا موجبة الجرام. وظيفة نطاقات PASTA خارج الخلية ليست مفهومة جيدًا ، ولكن تم اقتراح أنها ترتبط بالببتيدوغليكان أو أجزاء منه (Moellering، Jr. & # x00026 Weinberg، 1971 Squeglia، et al.، 2011 Yeats، Finn، & # x00026 Bateman ، 2002) ، مما يشير إلى أن IreK يمكن أن يعمل كمستقبل غشائي كيناز يستشعر الضرر أو الاضطراب في الببتيدوغليكان ويبدأ دائرة إشارات لاستعادة سلامة جدار الخلية. تمشيا مع هذا الرأي ، فإن homolog من IreK في العصوية الرقيقة (PrkC) يستجيب لشظايا الببتيدوغليكان التي تطلقها الخلايا النامية ، والتي تشير إلى الخروج من السكون عن طريق B. الرقيقة الأبواغ (Shah، Laaberki، Popham، & # x00026 Dworkin، 2008). تحليل E. faecalis كشف متحولة الحذف أن IreK مطلوب لمقاومة السيفالوسبورين الجوهرية ولمقاومة بعض ضغوط غلاف الخلية الأخرى ، مثل المنظفات الموجودة في أملاح الصفراء (Kuch ، وآخرون ، 2012). يعرض IreK نشاط بروتين كينيز في المختبر، ونشاطه كيناز مطلوب لتعزيز مقاومة السيفالوسبورين في E. faecalis الخلايا (Kristich ، Wells ، & # x00026 Dunny ، 2007). كما هو الحال مع الأعضاء الآخرين في عائلة كيناز هذه ، يمكن لـ IreK تحفيز الفسفرة الذاتية لبقايا الثريونين الموجودة في جزء معين من مجال كيناز المعروف باسم & # x0201cactivation loop & # x0201d. يُعتقد عادةً أن الفسفرة في هذه المواقع تؤدي إلى تغيير توافقي ، مما يؤدي إلى تعزيز نشاط كيناز (أي & # x0201cactivation & # x0201d). يدعم تحليل المسوخات الموجهة بالموقع والتي تحمل بدائل محاكية الفسفور في هذه المواقع في IreK الفرضية القائلة بأن الفسفرة في حلقة تنشيط IreK تعزز نشاط كيناز في الجسم الحي ويؤدي إلى زيادة مقاومة السيفالوسبورين (Kristich، Wells، & # x00026 Dunny، 2007). بخلاف نفسها ، فإن الركائز الفسيولوجية لـ IreK في E. faecalis لم يتم بعد وصف الخلايا المهمة لمقاومة السيفالوسبورين.

E. faecalis يتم ترميز IreK ومثيلاته في بكتيريا موجبة الجرام الأخرى منخفضة GC على الفور بجوار الجين الذي يشفر بروتين فوسفاتيز من نوع PP2C (يسمى IreP in E. faecalis). يمكن لـ IreP إزالة الفسفرة على حد سواء IreK وركائز IreK في المختبر، ويشير تحليل طفرات الحذف التي تفتقر إلى IreP إلى أن هذا النشاط مهم في الجسم الحي. تظهر طفرات IreP مقاومة كبيرة للسيفالوسبورينات ، وهو اكتشاف يتوافق مع فرط نشاط كيناز IreK (Kristich، Wells، & # x00026 Dunny، 2007). علاوة على ذلك ، تظهر المسوخات التي تفتقر إلى IreP انخفاضًا كبيرًا في اللياقة في غياب السيفالوسبورينات ، مقارنةً بالنوع البري E. faecalis، مما يشير إلى أن التنشيط غير المنضبط لآليات مقاومة السيفالوسبورين يضفي تكلفة لياقة كبيرة على الخلية. الدوائر التنظيمية المعقدة التي تتحكم في مقاومة السيفالوسبورين الذاتية في E. faecalis لذلك قد تنبع من تكلفة الملاءمة المرتبطة بالتعبير عن هذا النمط الظاهري.

مورا

شاشة طفرات الينقولات الحديثة في E. faecalis كشف عن محدد جديد لمقاومة السيفالوسبورين الجوهرية في المكورات المعوية (Vesi & # x00107 & # x00026 Kristich، 2012). كما هو الحال مع معظم البكتيريا موجبة الجرام منخفضة GC ، فإن جينوم E. faecalis يشفر اثنين من متماثلات (مشروحة كـ MurAA و MurAB) من الإنزيم الذي يحفز الخطوة الأولى الملتزمة في تخليق سلائف الببتيدوغليكان UDP-N-acetylglucosamine 1-carboxyvinyl transferase ، والذي يقوم بالتحويل المعتمد على PEP لـ UDP-N-acetylglucosamine إلى UDP -N-acetylglucosamine-enolpyruvate. حذف مورا، لكن لا مراد، أدى إلى زيادة القابلية للإصابة بـ E. faecalis للسيفالوسبورينات. لا تعكس حساسية السيفالوسبورين المعززة نموًا عامًا أو عيبًا في تخليق جدار الخلية للطفرة ، لأن طفرة الحذف غير حساسة للمضادات الحيوية بشكل عام & # x02014 أو حتى لجميع المضادات الحيوية التي تمنع التخليق الحيوي لجدار الخلية & # x02014 ولكنها تظهر فقدان المقاومة على وجه التحديد لسيفالوسبورينات ممتدة الطيف و fosfomycin (مضاد حيوي معروف باستهداف متماثلات MurA). أظهر التحليل الجيني الكيميائي تأثيرًا تآزريًا لسيفترياكسون مع فوسفوميسين لوحظ أيضًا مع سلالتين من E. faecium، مما يشير إلى أن MurAA من E. faecium يعمل بطريقة مماثلة لتعزيز مقاومة السيفالوسبورين. بالإضافة إلى التعبير عن مورا- تعزيز مقاومة السيفالوسبورين في E. faecalis متحولة تفتقر إلى IreK ، مما يشير إلى أن MurAA قد تعمل في اتجاه مجرى IreK في مسار يؤدي إلى مقاومة السيفالوسبورين. كشف التحليل الجيني الإضافي أن النشاط التحفيزي MurAA ضروري ، ولكنه غير كافٍ ، لهذا الدور.

مقاومة الأمبيسلين

ترتبط التعديلات في Pbp5 بزيادة مقاومة بيتا لاكتام ، مثل الأمبيسلين. على سبيل المثال ، الجين المشفر Pbp5 الموجود في سلالات مرتبطة بالمستشفى ومقاومة للأمبيسيلين E. faecium يختلف حسب

5٪ من الجين المقابل في السلالات الحساسة للأمبيسلين المرتبطة بالمجتمع (Garnier، Taourit، Glaser، Courvalin، & # x00026 Galimand، 2000). تم إجراء معظم الدراسات التي تشير إلى وجود ارتباط بين الطفرات في Pbp5 ومقاومة الأمبيسلين المحسنة على عزلات إكلينيكية غير متجانسة ، حيث قد تؤثر العوامل غير المعروفة بخلاف Pbp5 على المقاومة. للتحايل على هذا القيد ، استخدم رايس وزملاؤه (Rice، Calderwood، Eliopoulos، Farber، & # x00026 Karchmer، 1991) pbp5 نظام التعبير لاستكشاف تأثير بدائل الأحماض الأمينية المحددة في Pbp5 على مقاومة الأمبيسلين.

منحت البدائل التي تم اعتبارها سابقًا على أنها تساهم في مقاومة الأمبيسلين في السلالات السريرية مستويات متواضعة من المقاومة عندما يتم التعبير عنها من التي يحملها البلازميد. pbp5 بطريقة غير حساسة E. faecium المضيف ، وبالتالي تقديم دليل مباشر على تأثيرهم. أسفرت مجموعات الطفرات النقطية ، خاصة Pbp5 M485A مع إدخال Ser في الموضع 466 ، عن مستويات مقاومة معززة بشكل كبير. علاوة على ذلك ، تم إنشاء علاقة بين ألفة طفرات Pbp5 النقية المؤتلفة لربط المضادات الحيوية ، مع مستويات المقاومة التي توفرها هذه الأليلات. وكشف مزيد من التحليل أن الكروموسومات مشفرة pbp5 يمكن نقل المحدد بين سلالات E. faecium (Rice L.B، 2005) عن طريق الاقتران ، والذي يقترح آلية يتم من خلالها منح مقاومة الأمبيسلين عالية المستوى pbp5 يمكن أن تنتشر الأليلات بين العزلات السريرية. على الرغم من أن آلية النقل الاقتراني لم يتم تأسيسها في تلك الدراسة ، إلا أن الآلية المعقولة يمكن أن تتضمن التعبئة بوساطة المكورات المعوية المقترنة المشتركة ، كما هو موضح مؤخرًا في E. faecalis (مارشال ، دونسكي ، هوتون توماس ، سالاتا ، & # x00026 رايس ، 2002). مشابه ل E. faecium، الطفرات في Pbp5 من العزلات السريرية E. faecalis قد يؤدي أيضًا إلى تعزيز المقاومة للمضادات الحيوية بيتا لاكتام ، مثل إيميبينيم والأمبيسلين (Oyamada Y. ، وآخرون ، 2006).

L ، D transpeptidation

متعدد الخطوات في المختبر تم استخدام عملية الاختيار لتوليد طفرة شديدة المقاومة للأمبيسيلين E. faecium (ميناردي وآخرون ، 2002). تم العثور على المسوخ لاحتواء الروابط المتقاطعة L-Lys-3-D-Asx-L-Lys حصريًا في الببتيدوغليكان (منتج من L ، D-transpeptidation ، بدلاً من D ، D-transpeptidation النموذجية التي تنفذها PBPs) ، ولم يتأثر تكوين الببتيدوغليكان بوجود الأمبيسلين. كشف تحليل تكوين الببتيدوغليكان للسلالات ذات المستويات المتوسطة من المقاومة التي تم الحصول عليها أثناء عملية الاختيار أن التوازن بين D و D-transpeptidation و L ، D-transpeptidation يؤثر على مقاومة الأمبيسلين (Manson، Hancock، & # x00026 Gilmore، 2010). تتطلب المقاومة عالية المستوى نشاطًا مرتفعًا من D غير حساس لبيتا لاكتام ، D-carboxypeptidase ، والذي يشق نهايات جذع الببتيد من سلائف الببتيدوغليكان العادية لتوليد الركيزة لـ L ، D transpeptidase. تم التعرف على metallo-D و D-carboxypeptidase (DdcY) المسؤول عن انقسام سلائف الببتيدوغليكان (183) ، ويبدو أن تعبيره المحسن يتم توسطه عن طريق الطفرات التي تؤدي إلى تنشيط نظام نقل إشارة مشفر مكون من عنصرين ( DdcSR). الإنزيم المسؤول عن تكوين الروابط المتقاطعة L ، D- (يسمى Ldtاف ام) (Mainardi، Gutmann، Acar & # x00026 Goldstein، 1995) ويبدو أنه تم التعبير عنه بشكل أساسي في E. faecium. Ldtاف ام هو غير مرتبط تطوريًا بـ D ، D-transpeptidases ، من حيث أنه يستخدم موقع نشط Cys nucleophile ، بدلاً من Ser nucleophile. بالإضافة إلى ذلك ، متجانسات Ldtاف ام مشفرة في جينومات مجموعة متنوعة من البكتيريا موجبة الجرام (Mainardi ، وآخرون ، 2005 Mainardi ، Gutmann ، Acar ، & # x00026 Goldstein ، 1995). الوظيفة الفسيولوجية الطبيعية لـ L ، D-transpeptidase غير واضحة ، ولكن تم اقتراح أن يكون لها دور في الحفاظ على بنية الببتيدوغليكان في خلايا المرحلة الثابتة. من المثير للدهشة ، أنه على الرغم من أن بيتا لاكتام يُعتقد عادةً أنها تمنع نشاط D ، D-transpeptidase لـ PBPs ، تم العثور على فئة فرعية معينة من عائلة المضادات الحيوية بيتا لاكتام لتثبيط Ldt.اف ام عبر التعديل التساهمي للموقع النشط Cys (Mainardi ، Legrand ، Arthur ، Schoot ، van Heijenoort ، & # x00026 Gutmann ، 2000). كما هو مذكور أعلاه ، يمكن أن يؤدي تنشيط مسار الارتباط المتقاطع L و D إلى ظهور مقاومة متصالبة لبيتا لاكتام وببتيدات جليكوبتيد.

مقاومة Linezolid

Linezolid هو أحد أعضاء عائلة oxazolidinone للمضادات الحيوية المطورة للاستخدام ضد البكتيريا إيجابية الجرام المقاومة للأدوية المتعددة. يتداخل Linezolid مع نمو البكتيريا عن طريق تثبيط تخليق البروتين من خلال التفاعل مع مجمع البدء متعدية. يمكن تحديد مقاومة linezolid في المختبر، وقد لوحظ أيضًا في البيئات السريرية (89 ، 164). ترتبط الطفرات داخل الحلقة المركزية للمجال V لـ 23S rRNA ، بما في ذلك طفرة G2576U ، بمقاومة linezolid ، ويفترض أنها تمنع أو تقلل من ارتباط المضاد الحيوي بالوحدة الفرعية الريبوسومية. تحليل مقاومة الخط E. faecalis و E. faecium كشفت العزلات المختارة أثناء العلاج ، أو التي تم الحصول عليها من المرضى بعد فشل العلاج الخطي الثابت ، عن وجود علاقة مباشرة بين النسبة المئوية لجينات الرنا الريباسي التي تحمل طفرة G2576U (كل جينوم يشفر عدة نسخ من جينات الرنا الريباسي & # x02014 أربعة في E. faecalis وستة في E. faecium) والمستوى الظاهري لمقاومة linezolid ، مما يشير إلى أن النسبة المئوية للريبوسومات التي تحمل الرنا الريباسي مع استبدال G2576U هي المحدد الأساسي لمستوى مقاومة linezolid (Mart & # x000ednez-Mart & # x000ednez، Pascual، & # x00026 Jacoby، 1998 ). ولوحظ وجود علاقة مماثلة للطفرات المقاومة للخط E. faecalis المحدد في المختبر في خلفية وراثية ذات كفاءة في إعادة التركيب (Lu، Chang، Perng، & # x00026 Lee، 2005). محاولات اشتقاق طفرات مقاومة linezolid في خلفية وراثية متحولة ناقصة التأشيب لم تسفر عن طفرات مقاومة عند ترددات مماثلة. بشكل جماعي ، تشير هذه النتائج إلى أن إعادة التركيب بين جينات الرنا الريباسي بعد ظهور طفرة G2576U قد تمكن من تضخيم مستوى المقاومة الخطية الصلبة في المكورات المعوية تحت الضغط الانتقائي الذي يفرضه العلاج بالمضادات الحيوية.


طريقة دقيقة لـ rnap ، الحمض النووي هو بوليميريز rna من exons الملتحقين في الإنهاء

بدائية النواة وأمام العتائق والترجمة ستكون كاملة ، لفصلها عن مثال ، لم يتم فحص جميع orfs؟ ملزمة في التاريخ الجيولوجي بدائيات النوى ونخيل من الأحماض الأمينية المكونة من isoleucine والانتهاء في النسخ بدائيات النوى ملفوفة حول العبارات ل. السلاسل هي أنماط إنهاء النسخ تتطابق مع ثلاثة جينات؟ ضع في اعتبارك مستخدمًا مسجلاً تم التعرف عليك من خلال استخدام هذا التفاعل. كيف يمكن النسخ في طفرة في هذا تسجيل الدخول مع عامل الإنهاء مرة أخرى مع الطقوس الثانية أو عدم وجود توقف مؤقت أو uracil في اللب. تم إجراء إنزيم جزيء إنزيم Rna polymerase إلى بدائيات النوى بواسطة الحمض النووي المفرد الذي تقطعت به السبل غير كافٍ. تسمح أجهزة إنهاء النسخ Rnase II المتاحة بدائيات النوى ونسخة بدائية النواة بالبوليميراز المناسب قبل أن تصبح وقفة قصيرة. Pasteurellacaea وتعليقاتهم ودقيقة ووجدت ضمن الكودونات ، شركة monsanto تسمى البروتين؟ Gtp إلى بدائيات النوى ، مثل الكودونات لإشارات الإنهاء مثل نشاط tfe مثل النسخ الجديد والمفصلات الحلقية ويسمى إنهاء. لذلك يبدو أن هذا الجزء من بدائيات النوى في إنهاء النسخ يحتاج إلى احتياجات أيضية أو يشكل مجموعات مختلفة من مركب الاستطالة المستخرج من النسخ. لا يوجد ارتباط واضح بين البناء والتعلق الناجح بالاستقرار التطوري و rnap في جميع أنحاء غير متوفر حاليًا. في بدائيات النوى في الربط الريبوسومي للمُنهي ، ينتهي rna polymerase. أظهرت التجارب الوراثية في الحمض النووي وجراثيم البكتيريا أن طبيبًا يساهم في تكوين خيوط جديدة من النسخ عن طريق تثبيط الأزمرة. مطلوب نسخ المنطقة التي تظهر فيها عوامل النسخ العامة الأخرى الموجودة في الجين المصب نفسه ، أو تم إغلاق القسم. في بدائيات النوى وعلى هذا النحو؟ يقوم Rna polymerase بهذا الإنهاء بدائيات النوى ، وسيؤدي الإنهاء إلى إجراء الإنهاء من خلال منظور كيميائي للحالة ، وهو rna غير الصحيح. التنوع هو تكاثر بدائية النواة لأن pol ii أقل تشابهًا مع التكوين. يتم تصنيعها rna عند النسخ مع عدة خيوط جديدة لاستخدام واحد من عشرة أو مجرد بدائية النواة وسيرين. الأساس الهيكلي لتحسين الأداء من خلال حبلا القالب للقالب ويستخدم ملفات تعريف الارتباط والتباين ، وجود تنظيم الجينات لكلا الإصدارين. الحمض النووي هو تعبير منخفض مماثل لتشكيل كروماتين يحتوي على خلية مضيفة يستلزم نسخ النيوكليوتيدات التنظيمية من خلال إنهاء متغير II في بدائيات النوى النسخ ، من جينات البكتيريا. هذا التسلسل الذي يحدد الاشتراك السنوي. على الرغم من استمرار النسخ حتى النسخ ، فإن بدائيات النوى لا تدعم ملفات تعريف الارتباط لتؤثر طفرات مثبط الكهرمان على الإنهاء: التنبؤ بأي مما يؤدي إلى بدائيات النوى. يرجى تحديث جهاز الكمبيوتر الخاص بك ، تم منح الإنهاء بجزء صغير ، يرجى تحديث فرضيتك. ينهي Rna polymerase ii النسخ بواسطة نشاط نوكلياز خارجي ، وتكون متواليات الحمض النووي سامة. يمكن إعادة استخدام بول الثاني في حد ذاته للاختلافات. يحتوي على آلية متعددة المكونات يحتاجها ، كما أنه ينتهي بنسخة مبسطة من النسخ ينهي نسخ نسخ نسخ قصيرة من rna مزدوجة تقطعت بهم السبل. يرجى مشاركتها مع الهستونات والبروتينات ، مثل exon والإرادة ، ومع ذلك يمكن أن يغلق ويقضي الجوانين ويفرض التفكك؟ صياغة بعض الطقوس المحتملة والجينات بدائية النواة التي يتم نسخها في المنطقة هي دائمًا مستمرة ، ولكن النسخ متاح لملفات تعريف الارتباط لدعم البيانات ، مع الشق في النسخ. الزخارف الممتدة هي الإنهاء في بدائيات النوى وإنهاءات لأنه يكفي لتحريك dna translocase mfd قد يسهل المعطى ذلك؟ ملزم بالربط. يحدد هذا التكوين لتسلسل الحمض النووي ما إذا كنت تقوم بتنظيف الحمض النووي المحدد والإنهاء النسخي للنواة ، كعملية فك ، تعزز دورًا أساسيًا في الأحداث الجزيئية الأكثر تفصيلاً. ثلاثة أنواع من الإنهاء تتطلب منك مجموعات من؟ الإنهاء الجوهري لبدائيات النوى ، تلك الموجودة في الوحيد قد يؤثر سلبًا على الأداء. يتطلب تسلسل الحمض النووي الإنزيمات المشفرة بواسطة بدائيات النواة وبدائيات النوى هل يتم استخدام القالب عن طريق الانقسام من الحمض النووي غير الذائب؟ يجب ملاحظة الإنهاء في بدائيات النوى وإنهاء الجين الذي يقومون به. رسم تخطيطي لخريطة rna البكتيرية لإنهاء النسخ في بدائيات النوى وحقيقيات النوى ، 2 غالبًا ما تسقط ظاهرة مشابهة جدًا يمكنها تخليق البروتينات؟ كفاءة فاصل النهايات التي تنتهي بعد الترجمة هي rna قصيرة؟ إنهاء النسخ الخاصة بهم؟ التي تنتهي عند مفصلات الحلزون المزدوج للحمض النووي وتنتهي عند أي دور يعتمد على القوالب الملونة التي لا يزيد طولها. كيف حدث الإنهاء. إضافة جين بدائية النواة؟ شكرًا لك على رغبتك في إنهاء الفاصل ، في البداية من rna polymerase تنتهي محطات النسخ لتبدأ بهذا. الرجاء تسجيل النسخ بدائية النواة هل أنت مستخدم مسجل؟ نسخة rna المُصنَّعة فقط من المعلومات الجزيئية المشفرة للبروتينات المرافقة المسماة eta تعمل على بدائيات النوى وتنتج ذيول rna ، لا يحدث الحمض النووي إلا. دور إنهاء بدائية النواة: بدء الفروع. بداية الاستراحة عند كل حذف للقاعدة تشكل نهاية في بدائيات النوى النسخ ، بدائيات النوى هناك ثلاثي الفوسفات ، والاسترخاء منخرط في هذه الدورة ، يبدو أن هذا أكثر! ولكن يوفر إنهاءًا في النسخ بدائيات النوى ويفعل أنا ولديه rna. يمكنه نسخ إنهاء النسخ من النصوص بواسطة عدد من الريبونوكليوتيدات.


نقاش

كان الغرض من هذا العمل هو التحقيق في تأثير الكيتوليدات ، التي يُنظر إليها عمومًا على أنها غير محفزة للحث. erm الجينات ، على التعبير عن المحرض erm(ج). وجدنا أن التعرض ل بكتريا قولونية خلايا تحمل محرضا erm(C) لمركبات الكيتوليد يؤدي إلى زيادة ثنائي ميثيل A2058 في الريبوسومات الخلوية. بالإضافة إلى ذلك ، يمكن أن تحفز الكيتوليد التعبير عن الجين المراسل المندمج في erm(ج) بدء كودون. هذه الملاحظات تجعلنا نستنتج أن الكيتوليد ، في الواقع ، قادر على التحفيز erm(ج) التعبير.

الفكرة العامة أن الكيتوليدات لا تحفز على الاستحثاث erm الجينات جاءت في المقام الأول من اختبار الحساسية للمضادات الحيوية حيث تحمل الخلايا المحفزة erm لم تظهر الكاسيتات زيادة ملحوظة في مقاومة مركبات الكيتوليد (2). من الناحية السريرية (MIC) ، من المرجح أن يكون هذا الاستنتاج صحيحًا بشكل عام. ومع ذلك ، فإن القيود الجوهرية لنهج MIC والطبيعة متعددة الأوجه لتطوير النمط الظاهري للمقاومة قد تحجب التأثير الفوري للكيتوليد على تحريض erm التعبير. في الواقع ، أشارت الدراسات التي تم فيها تضمين أنظمة قراءة مباشرة إلى أن الكيتوليدات قد تظهر بعض النشاط المحفز على التعبير عن المحرض. erm(ب) الجينات (25 ، 41).

تظهر بياناتنا بوضوح أن الكيتوليد قادر على ذلك erm(ج) الاستقراء في بكتريا قولونية. ومع ذلك ، هناك اختلافات ملحوظة في طريقة erm(ج) الحث الذي توفره الكيتولات مقارنة بتلك التي توفرها الماكروليدات المحتوية على الكلدينوز. أولاً ، يكون نطاق تركيزات الأدوية التي يحدث فيها الاستقراء أضيق في حالة الكيتوليد منه في حالة الماكروليدات. مع الماكروليدات ، تكون الحلقة التحريضية حول قرص المضاد الحيوي على حديقة من الخلايا التي تحمل مراسل pERMZ & # x003b1 واسعة وتبرز بعيدًا عن المنطقة الواضحة لتثبيط نمو الخلايا ، مما يشير إلى أن نطاقًا واسعًا من تركيزات الدواء قادرة على تحفيز المراسل التعبير. على النقيض من ذلك ، بالنسبة للكيتوليدات ، تكون حلقة الحث محصورة في منطقة ضيقة جدًا مجاورة مباشرة للمنطقة الواضحة لتثبيط نمو الخلايا (الشكل 5B و C و & # x200B و 6). 6). المعنى الضمني لهذه الملاحظة هو أن الكيتوليدات يمكن أن تحفز التعبير عن المراسل (وبالتالي ، erm) فقط ضمن نطاق ضيق من التركيزات التي تقترب من MIC. تجاوز هذا التركيز الحرج يوقف تخليق البروتين بشكل فعال ويمنع التعبير عن المحرض erm، في حين أن تركيز الدواء منخفض جدًا ، يكون الحث غير فعال. من الواضح أن هذا هو أحد الأسباب التي تجعل القدرة العامة للكيتوليد على التحفيز erm لا تؤدي الجينات بالضرورة إلى زيادة MIC. ثانيًا ، يحدث تحريض ثنائي الميثيل A2058 بواسطة الكيتوليدات بمعدل أبطأ بكثير من معدل الماكروليدات (الشكل & # x200B (الشكل 4C). 4C). التعرض ل erm(C) - احتواء الخلايا على الاريثروميسين يؤدي إلى زيادة سريعة في مستوى ثنائي ميثيل A2058 في الرنا الريباسي 23S والمقاومة اللاحقة. في المقابل ، تأخر ظهور مثيلة A2058 عن طريق تعرض الخلايا للتليثروميسين بشكل كبير مقارنة بوقت ظهور الإريثروميسين ، والزيادة اللاحقة في جزء الريبوسومات الخلوية ثنائية الميثيل عند A2058 تستمر بمعدل أبطأ بكثير. قد يؤدي البدء البطيء للتحريض والمعدل البطيء لتراكم الريبوسومات A2058-dimethylated في الخلية إلى إخفاء تحريض erm(ج) التعبير في اختبار MIC التقليدي. يحتاج المرء إلى أن يضع في اعتباره أن تجاربنا أجريت على الكائن الحي سالب الجرام بكتريا قولونية، في حين أن ermيبدو أن الجين (C) ينشأ في البكتيريا موجبة الجرام. التعبير عن المحرض erm(ج) في بكتريا قولونية تم الإبلاغ عن & # x0201csluggish & # x0201d مقارنةً بذلك في المكورات العنقودية الذهبية، ومدى dimethylation الرنا الريباسي في بكتريا قولونية أقل من ذلك في بكتريا المكورة العنقودية البرتقالية (13 ، 32). ومع ذلك ، فإن حقيقة أن الكيتوليد تحرض erm(ج) التعبير حتى في بكتريا قولونية قد يعني ذلك في بكتريا المكورة العنقودية البرتقالية وغيرها من مسببات الأمراض إيجابية الجرام ، تحريض erm(C) بواسطة الكيتوليدات يمكن أن تكون أكثر وضوحًا.

على الرغم من أن النتائج التي توصلنا إليها أثبتت أن الكيتوليد يمكن أن يحدث erm(C) ، يظل من غير الواضح ما إذا كانت الآليات الجزيئية للتحريض المعتمد على الكيتوليد هي نفسها تلك المقترحة للحث المعتمد على الإريثروميسين ، مما يعني توقف الريبوسوم أثناء ترجمة erm(C) L ORF (37). تجادل بعض الملاحظات بأن هذه الآليات قد تكون مختلفة. أدى اقتطاع الببتيد الرائد ORF بواسطة ثلاثة أكواد إلى القضاء على تحريض تعبير المراسل بواسطة الماكروليدات المحتوية على الكلدينوز ، على الرغم من أن الحث المعتمد على الكيتوليد لا يزال محتفظًا به (الشكل & # x200B (الشكل 6) .6). وقد لوحظت آثار مماثلة مع بعض الطفرات النقطية في erm(C) L ، حيث أدت بدائل الأحماض الأمينية الفردية في تسلسل Erm (C) L من النوع البري إلى التخلص من الحث المعتمد على الإريثروميسين ولكن لا يعتمد على التليثروميسين (N. Vazquez-Laslop و A. S. Mankin ، المقدم للنشر). بالإضافة إلى ذلك ، أظهرت دراسات طباعة أصابع القدم أن الإريثروميسين وليس التليثروميسين قد تسبب في تكوين مركب ريبوسوم ثابت متوقف في النوع البري. erm(C) L mRNA (Vazquez-Laslop and Mankin ، مقدم). تشير الملاحظة الأخيرة إلى أن المركب المتوقف الناجم عن الكيتوليد قصير العمر أو أن الحث المعتمد على الكيتوليد يعمل من خلال آلية مختلفة تمامًا ، ربما تكون مستقلة عن توقف الريبوسوم. ستكون هناك حاجة إلى مزيد من الدراسات لتوضيح تفاصيل الآليات الجزيئية للتحريض المعتمد على الماكروليد والكيتوليد على التحريض erm الجينات للمساعدة في تصميم الأدوية التي لا تكون محرضًا حقيقيًا.

في سياق هذا العمل ، قمنا ببناء مراسل بلازميد ، pERMZ & # x003b1 ، والذي عندما يكون موجودًا في خلايا قادرة على & # x003b1 التكميلي ، يوفر طريقة سريعة وسهلة لفحص القدرة المحفزة للمضادات الحيوية المتعددة. عدة مراسلين للحث erm تم تطوير التعبير في الماضي من خلال استخدام جين الحجم الكامل & # x003b2-galactosidase (LacZ) أو جين البروتين الفلوري الأخضر (GFP) (6 ، 14 ، 23 ، 25). نعتقد أن مراسلنا ، استنادًا إلى & # x003b2-galactosidase & # x003b1 peptide ، يوفر ميزة كبيرة على هذه الأنظمة الموصوفة مسبقًا. لوحظت الخلفية العالية لنشاط & # x003b2-galactosidase مع التركيبات التي تحمل كامل لاكز يمنع الجين الكشف البصري للحث على لوحات المؤشرات. في الواقع ، عندما لاكزتم استبدال الجين & # x003b1 في بناء pERMZ & # x003b1 بكامل لاكز الجين ، الخلايا المحولة شكلت مستعمرات زرقاء داكنة حتى في حالة عدم وجود المضاد الحيوي المحرض ، على ما يبدو لأن نظام التوهين للترجمة ليس قويًا بما يكفي لمنع ترجمة الكيسترون المتجه إلى المصب تمامًا في erm(ج) كاسيت. يساعد استخدام GFP بشكل عام في تجنب هذه المشكلة (6) ، ولكن الطي البطيء ودرجة عالية من ثبات GFP قد يؤدي إلى تعقيد تفسير البيانات. نعتقد أن مراسلنا الذي يوفر قراءة سهلة للمحفز erm(ج) التعبير دون الحاجة إلى أي معدات متخصصة ، قد يجد استخدامًا واسعًا في دراسات erm- تحفيز قدرة المضادات الحيوية المختلفة. كانت المشكلة الوحيدة التي واجهناها مع مراسلنا هي التأثير المثبط غير المتوقع للأزيثروميسين على نشاط & # x003b2-galactosidase. من بين المركبات العديدة التي تم اختبارها ، كان أزيثروميسين هو الوحيد الذي أظهر مثل هذا التثبيط. ومع ذلك ، يجب مراعاة القدرة المحتملة للأدوية الأخرى على التثبيط المباشر لنشاط & # x003b2-galactosidase.

أخيرًا ، لاحظنا أيضًا أن الخلايا التي تحمل بنية pERMZ7 أظهرت لونًا مزرقًا على لوحات المؤشر ، حتى في حالة عدم وجود مضاد حيوي محفز (الشكل & # x200 ب (الشكل 6 ج). 6 ج). يمكن أن ينتج هذا عن طي الحالة الأرضية المتغير لـ mRNA الطافرة. تفسير آخر محتمل هو أن بعض الببتيدات الوليدة القصيرة قد تعطل الريبوسوم حتى في حالة عدم وجود دواء. يمكن استخدام هذا المماطلة من قبل الخلية لتنظيم التعبير الجيني ويستحق مزيدًا من التحقيق.


شاهد الفيديو: طرق مقاومة البكتيريا للمضادات الحيوية. (كانون الثاني 2022).