معلومة

بأي طريقة ستتعامل خلية الخميرة مع الكمية الزائدة من الميثيونين في وسط النمو؟

بأي طريقة ستتعامل خلية الخميرة مع الكمية الزائدة من الميثيونين في وسط النمو؟



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أعتقد أنه عندما يكون هناك فائض من الميثيونين في الخلية ، يتم دمجه في دورة TCA باعتباره مادة سوكسينيل CoA ، مع السيستين كمنتج ثانوي. ولكن الآن الخلية لديها فائض من السيستين. ماذا تفعل به؟ كيف تزيل الكبريت الزائد من الخلية؟ هل ستؤثر هذه العملية بطريقة ما على NAD+/ NADH الرصيد؟


في البشر ، يملأ السيستين أولاً تجمع الجلوتاثيون (والذي يعد في حد ذاته خزانًا للسيستين ، بصرف النظر عن معادلات الاختزال والتحول الأحيائي). يمكن أن يذهب السيستين الزائد بثلاث طرق ،

  1. أكسدة السلفوالانين والمزيد من هيبوتورين وتوراين ، عبر إنزيم (إنزيمات) غير معروف
  2. تحلل اللانثيونين والسامة H2س
  3. التحلل إلى السيرين والسامة H2س

نظرًا لأن cystathionine gamma lyase الذي (نشاط L-cysteine ​​desulfhydrase) يحفز 2 و 3 له متماثلات في الخميرة ، أعتقد أن H2يتم إنتاج S هناك أيضًا. مزيد من أكسدة H2يحدث S من خلال مسار ميتوكوندريا قديم محفوظ بشكل كبير أيضًا ، مما ينتج عنه كبريتات وكبريتات. ثم تصنع الكبريتات بيئة حمضية قليلاً ولكنها غير سامة.

لقد قمت بربط إدخالات Reactome.org حيث يمكنك العثور على مراجع. ملء تجمع الجلوتاثيون في الخميرة (إذا حدث) من شأنه أن يحرك NAD+/ توازن NADH إلى جانب NADH ، أي ملء معادلات التخفيض أيضًا.


التحقيق في استجابة الإجهاد الحمضي في مختلف السكريات سلالات

تحتاج خلايا الخميرة إلى الاستجابة لمجموعة متنوعة من الضغوط الموجودة في ظروف مختلفة مثل الجهاز الهضمي بعد تناول البروبيوتيك أو حوض التخمير أثناء إنتاج الإيثانول. في هذه الدراسة ، تم تقييم قدرة تحييد H + ، وتكوين الأحماض الدهنية الغشائية ، ونشاط H + -ATPase ، وتركيز Ca 2+ الخلوي في خلايا الخميرة المستخدمة في البروبيوتيك (السكريات بولاردي) والمختبر (خميرة الخميرة W303) ، وكذلك في بعض سلالات متحولة W303 لـ ENA1 الجين و S. cerevisiae BY4741. أظهرت النتائج أن تركيز الخميرة الداخلي H + ينظمه عدة أنظمة ، بما في ذلك غشاء البلازما H + -ATPase ، وأن Ena1p له دور مهم ولكن غير محدد في الاستجابة الخلوية للحمض. تكوين غشاء من الأحماض الدهنية S. cerevisiae تأثرت سلالة W303 بالتعرض لدرجة الحموضة الحمضية ، ولكن وجود 86 ملي مول كلوريد الصوديوم منع هذا التأثير ، في حين أن تركيب الأحماض الدهنية الغشائية S. boulardii لم يتأثر بالرقم الهيدروجيني الحمضي. أظهرنا أيضًا أن استجابة الإجهاد الحمضي تعتمد على استقلاب الكالسيوم وتم حظرها بواسطة FK 506.

1 المقدمة

للبقاء على قيد الحياة والتكاثر ، يجب أن تتكيف الكائنات الحية الحرة مع التغيرات في بيئتها. التعرض لل خميرة الخميرة للضغوط البيئية ، مثل الأيونات السامة [1 ، 2] ، الإيثانول [3] ، أو التغيرات في درجة الحرارة [4] أو درجة الحموضة [5] ، تؤدي إلى تغيرات في الكيمياء الحيوية والتعبير الجيني [6]. يعد التعرض السريع للخميرة للأحماض غير العضوية أمرًا مهمًا ، لأن هذا التعرض يحدث في الظروف البيئية (على سبيل المثال ، بروبيوتيك الخميرة التي تمر عبر الجهاز الهضمي) والظروف الصناعية (على سبيل المثال ، حمض الكبريتيك للقضاء على التلوث البكتيري في مزارع الخميرة التي يجب إعادة استخدامها للتخمير [ 7]).

خميرة الخميرة ينمو جيدًا فوق نطاق واسع من الأس الهيدروجيني ولكنه ينمو بشكل أفضل في الحمضية منه في الأس الهيدروجيني القلوي [5 ، 8]. أظهرت الدراسات تغييرات في التعبير عن مئات الجينات في S. cerevisiae بعد التعديلات في الرقم الهيدروجيني [9-11]. ردود S. cerevisiae تمت مراجعة الأس الهيدروجيني القلوي بواسطة Ariño [5] وتتضمن مسارات إشارات مختلفة. على وجه الخصوص ، تم اقتراح دور الكالسينيورين في الإجهاد القلوي في وقت مبكر ، وتم الإبلاغ عن مشاركة إشارات الكالسيوم في هذه الاستجابة في الأعمال اللاحقة [5 ، 10 ، 12 ، 13]. كما تم وصف الاستجابات لدرجة الحموضة القلوية المبيضات البيض [14] و نيدولانس الرشاشيات [15, 16].

تمت دراسة ردود الفعل تجاه الإجهاد الحمضي في خلايا الخميرة التي تعرضت صناعياً للأحماض العضوية الضعيفة [9 ، 17] ، المواد الحافظة [17 ، 18] ، ومبيدات الأعشاب [19]. استجابة للتعرض للأحماض الضعيفة ، تظهر خلايا الخميرة نفاذية غشاء منخفضة ، وبثق الأنيون ، وزيادة القدرة على تقويض المواد الحافظة [20] ، وتغيير التعبير الجيني [9]. تشير نتائج التحليل على مستوى الجينوم والفحص الوظيفي للجينات المشاركة في الاستجابة للأحماض اللبنية والأسيتيك والهيدروكلوريك إلى أن الظروف الحمضية تؤثر على بنية جدار الخلية ، والتعبير عن الجينات المشاركة في التمثيل الغذائي للمعادن ، والفجوة H + -ATPase (V-ATPase) ، و مستويات البروتين HOG MAPK [17].

على غرار الاستجابة للأحماض الضعيفة ، تتضمن مقاومة التعرض للأحماض غير العضوية تغييرات في موصلية الغشاء لـ H + ، والبثق النشط للبروتونات من الخلية [21] ، وتعديل التعبير الجيني [8 ، 17]. أظهرت الدراسات السابقة أن مسار بروتين كيناز سي (PKC) يشارك في تكامل الخلية في S. cerevisiae يتم تنشيطه استجابة للإجهاد الحمضي وأن هذا التنشيط يعتمد على مستشعر جدار الخلية Mid2p [22-24]. كلاريت وآخرون. اقترحوا وجود مسارين متميزين ، يشتملان على Mid2p (مستشعر جدار الخلية) أو Rgd1p (مسار الخنزير) يعملان معًا للحث على مسار تكامل الخلية وزيادة التحمل الحمضي [22].

في السكرياتيلعب الكالسيوم العصاري الخلوي دورًا أساسيًا في التحكم في دورة الخلية وعملية التبرعم والتزاوج. بالإضافة إلى ذلك ، الكالسيوم العصاري الخلوي هو رسول ثان مهم في الخلايا حقيقية النواة. تظهر خلايا الخميرة التي تنمو في ظل ظروف معملية قياسية مستويات منخفضة من الكالسيوم في العصارة الخلوية ونشاط أقل من الكالسينيورين [25]. يؤدي التعرض لضغوط بيئية مختلفة ، مثل الملح أو الأكسدة أو القلوية أو الإجهاد الحراري ، إلى تغيرات فورية في الكالسيوم العصاري. تزيد مستويات الكالسيوم أولاً ثم تنخفض بسرعة عندما تتعرض خلايا الخميرة لهذه الظروف [١٠ ، ١٤ ، ٢٦-٢٨]. Crz1 هو المؤثر الرئيسي للتعبير الجيني الذي ينظمه الكالسينيورين في S. cerevisiae، ولكن توجد أيضًا أهداف غير محددة للكالسينيورين مع أدوار في التكيف مع الإجهاد [5]. تشارك بروتينات Cch1 و Mid1 ومكونات قناة الكالسيوم الغشائية ومؤثرات Slt2p (مسار PKC) في بقاء الخلية عند درجة حموضة منخفضة في السكريات [22]. ومع ذلك ، لم يتم دراسة آليات التأشير بوساطة الكالسيوم في ظل استجابة الصدمة الحمضية.

في عمل سابق تم إجراؤه في مختبرنا ، أثبتنا أن التركيزات المنخفضة من أيونات الصوديوم تمنح الحماية لخلايا الخميرة المعرضة للإجهاد الحمضي [29]. اقترحت ملاحظاتنا أيضًا أن الأنظمة المشاركة في الحفاظ على إمكانات غشاء البلازما (PMA1p H + -ATPase وأنظمة النقل الثانوية) كانت مرتبطة باستجابة الإجهاد الحمضي. في هذه الدراسة ، ركزنا التجارب على مشاركة غشاء البلازما H + -ATPase وعلى أحداث إشارات الكالسيوم التي لوحظت في خلايا الخميرة استجابة للإجهاد الحمضي.

2. المواد والأساليب

2.1. ظروف نمو الفطريات

يسرد الجدول 1 سلالات الخميرة المستخدمة في هذه الدراسة. نمت سلالات الخميرة في شاكر مداري (200 دورة في الدقيقة) عند 30 درجة مئوية في وسط YPD يحتوي على (وزن / حجم) 1 ٪ مستخلص الخميرة ، 2 ٪ ببتون ، و 2 ٪ جلوكوز. تمت مراقبة النمو الخلوي بالكثافة البصرية (OD) عند 600 نانومتر.

2.2. فحوصات حالة الإجهاد الحمضي والجدوى

تم حصادها بالطرد المركزي عند 4،750 × جم لمدة 5 دقائق وغسلها مرتين باستخدام وسائط YP. ثم تم تعليق الكريات عند OD 600 نانومتر من 1.0 في محلول مائي ، تم ضبطه مسبقًا على الرقم الهيدروجيني 2.0 مع 1 مولار هيدروكلوريد واستكماله بـ 86 ملي مول كلوريد الصوديوم. تم تطبيق هذه الحالة على كل علاج حمضي تم إجراؤه في هذه الدراسة. ثم تم تحضين عينات الخميرة في شاكر مداري عند 30 درجة مئوية لمدة ساعة واحدة. تم جمع قسامات بعد 0 (خلايا تحكم ، قبل الإجهاد الحمضي) ، 15 ، 30 ، و 60 دقيقة من الحضانة. تم غسل الخلايا على الفور مرتين بحجم متساوٍ من YP وتم تخفيفها بمقدار 20000 ×. ثم 50

تم زرع L من تعليق الخلية على أجار YPD. تم تحضين الصفائح عند 30 درجة مئوية لمدة 48 إلى 72 ساعة. تم التعبير عن النتائج كنسبة مئوية (٪) من وحدات تشكيل المستعمرة (cfu) بالنسبة لعينة التحكم (

تم اختبار نمو خلايا الخميرة في وجود الصوديوم على سلسلة من صفائح YPD مدعمة بتركيزات متزايدة من كلوريد الصوديوم (200-500 ملي مولار). تم تحضير تخفيفات متسلسلة بعشرة أضعاف من المعلقات الخلوية ، وتم رصد 5 لترات من كل منها على ألواح YP. تمت مراقبة النمو على مدى 3 أيام.

2.3 قدرة تحييد خلايا الخميرة H +

تم تحديد قدرة الخلايا على تحييد H + المضاف إلى تعليق الخلية بواسطة تقنية النبض الحمضي بمقياس الأس الهيدروجيني. باختصار ، تم قياس الأس الهيدروجيني بعد إضافة البقول الحمضية [30]. لتقدير القدرة خارج الخلية لتحييد H + المضافة ، نمت الخلايا كما هو موصوف سابقًا ، وغسلها ، وإما تعرض (الخلايا المجهدة) أو لا (خلايا التحكم) للإجهاد الحمضي. تم جمع قسامات مقدارها 50 مل عن طريق الطرد المركزي ، وغسلها مرتين بماء Milli-Q ، وأعيد تعليقها في حجم 2 مل للحصول على تعليق خلية كثيف. تم تعديل الرقم الهيدروجيني لتعليق الخلية مسبقًا في الرقم الهيدروجيني 6.8 باستخدام هيدروكسيد الصوديوم وتم إجراء النبضات الحمضية الأولى بأحجام صغيرة من 10 ملي مولار من حمض الهيدروكلوريك ، لأنه بالقرب من نطاق الأس الهيدروجيني المحايد حتى إضافة كميات صغيرة من البروتونات تؤدي إلى تغيرات كبيرة في درجة الحموضة. لتقدير سعة الخلية الإجمالية لتحييد H + (بمعنى قدرة المجموعات الكيميائية المشتقة من سطح الخلية بالإضافة إلى المستقلبات الداخلية) ، تم تعطيل الخلايا مسبقًا بالنيتروجين السائل في مياه Milli-Q وتم تعليقها كما هو موضح سابقًا.

2.4 تحديد نشاط H + -ATPase

تم إجراء قياسات لنشاط H + -ATPase باستخدام 375 مجم من الخلايا (الوزن الرطب) المزروعة في YPD (4 ٪ جلوكوز) إلى OD600 1.0-1.2 (مجموعة تحكم) أو خلايا نمت في YPD ، مغسولة ، معرضة لضغط الحمض ، كما هو موصوف أعلاه ، وتحصد بعد 10 و 30 و 60 دقيقة. بعد الاسترداد على مرشحات الألياف الزجاجية ، تمت إزالة الخلايا من المرشحات ، وتجميد على الفور في النيتروجين السائل ، وتخزينها حتى الاستخدام. تم إجراء عزل غشاء البلازما وتحديد نشاط ATPase ، في وجود مثبطات ATPase والفوسفاتيز في الميتوكوندريا ، كما هو موضح سابقًا [31]. تم تحديد محتوى البروتين بطريقة لوري [32].

2.5 تركيز الكالسيوم الحر داخل الخلايا

تم قياس تركيز الكالسيوم الخالي من العصارة الخلوية بالطريقة المعتمدة على الأيكورين [33] مع بعض التعديلات. كان البلازميد pVTU-AEQ هدية من ماركو فانيوني (جامعة ميلانو بيكوكا ، ميلان ، إيطاليا). باختصار ، تم حصاد الخلايا المتنامية بشكل أسي والتي تم تحويلها باستخدام pVTU-AEQ متعدد النسخ الذي يعبر عن البلازميد عن طريق الطرد المركزي عند 4،750 × جم لمدة 5 دقائق ، وغسلها ثلاث مرات باستخدام Mes / Tris 0.1 M (درجة الحموضة 6.5) ، وتم تعليقها مرة أخرى بكثافة قدرها

10 9 خلايا / مل. لإعادة تكوين aequorin الوظيفي ، تمت إضافة 50 M coelenterazine (محلول مسابر جزيئي 1 جم / لتر مذاب في ميثانول) إلى معلق الخلية ، وتم حضانة الخلايا لمدة 30 دقيقة في درجة حرارة الغرفة في الظلام. تمت إزالة coelenterazine الزائدة عن طريق غسل الخلايا ثلاث مرات بماء Milli-Q والطرد المركزي عند 3200 × جم لمدة 3 دقائق.

لكل نبضة حمضية (الرقم الهيدروجيني 2.0 زائد 86 ملي كلوريد الصوديوم) ، تم نقل 450 لترًا من تعليق الخلية (في الماء) إلى أنبوب مقياس اللمعان. تمت مراقبة انبعاث الضوء في مقياس الإضاءة Berthold Lumat LB 9501/16 على فترات 2 ثانية تبدأ قبل دقيقة واحدة وتستمر حتى & gt6 دقائق بعد إضافة حمض الهيدروكلوريك إلى التركيز النهائي الموضح في الأشكال. تلخص النتائج ثلاث مكررات ويتم التعبير عنها بوحدات التلألؤ النسبية في الثانية (RLU / s).

2.6. تحليل تكوين الأحماض الدهنية الغشائية

تم استخدام نظام تحديد الجراثيم (MIS، Microbial ID Inc.، Newark، DE، USA) لتحليل تركيبة الأحماض الدهنية للأغشية السيتوبلازمية [34]. تم الحصول على استرات الميثيل وفقًا لطريقة MIDI (Microbial ID Inc.). تم تحديد استرات الميثيل وقياسها بواسطة الكروماتوغرافيا باستخدام حزمة برامج Sherlock (MIDI Inc. ، الإصدار 4.5). تم إجراء تحولات الجذر التربيعي القوسي. تم تحليل البيانات عن طريق تحليل التباين (ANOVA) مع اختبار سكوت نوت عند أهمية 5٪. تم إجراء التحولات والتحليلات باستخدام حزمة برامج الجينات ، الإصدار 2007.0.0 ، والتي تسمح بدراسة التنوع الجيني الميكروبي من تكوين الأحماض الدهنية الغشائية [35]. تم تحليل البيانات من خلال المسافة الإقليدية المعيارية ، وتم استخدام مسافة المصفوفة المحسوبة لتحليل المجموعات بواسطة طريقة UPGMA (طريقة مجموعة الزوج غير الموزونة مع المتوسط ​​الحسابي).

2.7. الطرق البيولوجية الجزيئية

تم إجراء تحضير ومعالجة الأحماض النووية (على سبيل المثال ، استخراج الفينول ، وترسيب الإيثانول ، والرحلان الكهربائي) كما وصفه Sambrook et al. [36].

تم استخدام البلازميدات p417-CYC (نسخة منخفضة) و p427-TEF (نسخة عالية) ، التي تم شراؤها من Dualsystems Biotech AG ، سويسرا ، للتعبير عن ENA1 (YDR040C ، خميرة الخميرة قاعدة بيانات الجينوم ، http://www.yeastgenome.org/). تم تحضير الملحق باستخدام الحمض النووي الجيني للخميرة من سلالة W303 كقالب. كانت البرايمر إلى الأمام ، GACTAGTATG GGCGAAGGAACTACTAAG والعكس ، TCCCCCGGGTCATTGTTTAT ACCAATATTAAC. احتوى التمهيدي PCR الأمامي على موقع Spe1 ، وكان التمهيدي العكسي يحتوي على موقع Sma1. تم قطع منتج PCR باستخدام Spe1 / Sma1 وإدخاله في ناقلات Spe / Sma1 p417-CYC أو p427-TEF لإنتاج البلازميدات المؤتلفة.

مختص الإشريكية القولونية Top10F تم تحويل خلايا السلالة مع البلازميدات المؤتلفة ، للتعبير عن Ena1p أو aequorin. تم تحديد وجود الإدخال المناسب عن طريق استخراج الحمض النووي ، متبوعًا بالهضم والتسلسل باستخدام طريقة إنهاء السلسلة (نظام تحليل التسلسل MegaBace 1000 ومجموعة أدوات إنهاء الصبغة Dynamic TM ET). تمت مقارنة تسلسل الحمض النووي بالتسلسلات في السكريات قاعدة بيانات الجينوم.

بالنسبة لنشاط H + -ATPase ومقايسات التلألؤ الحيوي ، تم تحويل خلايا الخميرة بطريقة الليثيوم [37].

2.8. استنساخ النتائج

تم إجراء جميع التجارب في ثلاث نسخ. يُشار إلى الوسائل ± SD في كل شكل ، باستثناء تجارب معادلة H + وإشارة الكالسيوم.

3. النتائج

3.1. قدرة التحييد + H

أظهرت النتائج السابقة لمختبرنا ذلك S. boulardii (سلالة بروبيوتيك) أكثر مقاومة لانخفاض درجة الحموضة من S. cerevisiae W303 (سلالة مختبرية غير حيوية). لذلك ، قررنا اختبار سلوك هذه السلالات التي تواجه نبضًا حمضيًا (الرقم الهيدروجيني 2.0 زائد 86 ملي كلوريد الصوديوم أو بيئة معدية محاكية بدون بيبسين). كما تم وصفه من قبل ، يبدو أن تركيز كلوريد الصوديوم المنخفض يحمي خلايا الخميرة من إجهاد الحمض غير العضوي الذي يمنع موت الخلايا المتفاقم بسبب الظروف القاسية. يوضح الشكل 1 قدرة التحييد خارج الخلية والإجمالية (خارج الخلية وداخلها) H + S. boulardii و S. cerevisiae نمت خلايا W303 في YPD (مجموعة تحكم) وخلايا تعرضت سابقًا للإجهاد الحمضي. القدرات خارج الخلية S. cerevisiae W303 و S. boulardii لتحييد H + المضافة كانت متشابهة ، لكن S. cerevisiae كان W303 أكثر تأثراً بنبضات الحمض بشكل طفيف من S. boulardii (الشكل 1 (أ)). أظهرت النتائج أيضًا أن السعة خارج الخلية لتحييد H + المضافة كانت أصغر من السعة الإجمالية لكل من سلالات الخميرة (الشكلان 1 (أ) و 1 (ب)). يتضح هذا الاختلاف بشكل خاص عندما نلاحظ الرقم الهيدروجيني الناتج بعد إضافة كمية محددة من H + / mg من الخلايا. السكريات بولاردي كان لديه قدرة أعلى على تحييد H + وربما قدرة أكبر على الحفاظ على توازن الأس الهيدروجيني بعد الإجهاد الحمضي أكثر من S. cerevisiae W303 (الشكل 1 (ب)) ، مما يشير إلى أن السلالتين لهما تركيبات مختلفة من مركبات التخزين المؤقت داخل الخلايا. كان الرقم الهيدروجيني الناتج بعد إضافة 1000 نانومول H + / ملغ من الخلايا 3.3 و 2.8 (في خلايا التحكم أو تعرض لدرجة الحموضة 2.0 + 86 ملي كلوريد الصوديوم ، على التوالي) من أجل S. boulardii و pH 2.6 و 2.2 لـ W303 (الشكل 1 (ب)). آلية التخزين المؤقت هذه مهمة لتعديل الأس الهيدروجيني السريع داخل الخلايا ولكنها لا تستطيع استيعاب التغيرات الشديدة في الأس الهيدروجيني خارج الخلية. في الواقع ، يمثل اختلاف وحدة الأس الهيدروجيني 0.5 في الوسط الخارجي ، في نطاق الأس الهيدروجيني المنخفض ، حالة إجهاد واضحة.


(أ)
(ب)
(أ)
(ب) قدرة تحييد H + لخلايا الخميرة المزروعة في وسط YPD ، وفقًا لتقنية النبض الحمضي. (أ) قدرة تحييد H + خارج الخلية S. boulardii (●), S. boulardii تتعرض لدرجة الحموضة 2.0 + 86 ملي كلوريد الصوديوم (س) ، S. cerevisiae W303 (■) و S. cerevisiae W303 يتعرض لدرجة الحموضة 2.0 + 86 ملي كلوريد الصوديوم (□). (ب) إجمالي H + قدرة تحييد S. boulardii (●), S. boulardii يتعرض لدرجة الحموضة 2.0 + 86 ملي كلوريد الصوديوم (س) ، S. cerevisiae W303 (■) و S. cerevisiae W303 يتعرض لدرجة الحموضة 2.0 + 86 ملي كلوريد الصوديوم (□).
3.2 تكوين الأحماض الدهنية الغشائية

تم تعديل تكوين ومستويات الأحماض الدهنية في غشاء الخلية استجابة للإجهاد الحمضي ، كما هو موضح في مخطط الشجرة الموضح في الشكل 2. قد تفسر الزيادة السلبية في تركيز البروتون داخل الخلايا جزئيًا هذه الاستجابة الخلوية للحمض. كان هذا التأثير واضحًا بشكل خاص في سلالة W303 ، حيث لوحظت تغييرات في ملف تعريف الأحماض الدهنية بعد 30 دقيقة من التعرض للحمض (الرقم الهيدروجيني 2.0). لوحظت زيادات طفيفة في حمض الأوليك وحمض الأراكيد ، في حين أن النسبة المئوية لحمض الجادوليك ، وهو حمض cis-icos-9-enoic المرتبط بحمض الأوليك ولكن يحتوي على 20 ذرة كربون ، قدمت انخفاضًا كبيرًا. يوضح الشكل 2 أيضًا أن إضافة 86 ملي كلوريد الصوديوم حالت دون هذا التأثير في سلالة W303 وتكوين الأحماض الدهنية الغشائية لـ S. boulardii لم يتأثر بالرقم الهيدروجيني الحمضي. من المعروف أن عدم تشبع سلاسل الأحماض الدهنية له تأثير عميق على سيولة الغشاء ، ولكن ستكون هناك حاجة إلى مزيد من العمل لمعرفة ما إذا كانت التغيرات في درجات التشبع وعدم التشبع تؤثر على تحمل الحمض.


Dendrogram لتكوين الأحماض الدهنية لأغشية الخميرة السيتوبلازمية. تم تحليل البيانات من خلال المسافة الإقليدية المعيارية ، وتم استخدام مسافة المصفوفة المحسوبة لتحليل المجموعات بواسطة طريقة UPGMA. تم تعديل تكوين ومستويات الأحماض الدهنية في غشاء الخلية استجابة للإجهاد الحمضي ، خاصة في سلالة W303 ، وتم منع هذا التأثير بإضافة 86 ملي مولار من كلوريد الصوديوم كما هو موضح في مخطط الشجرة.
3.3نشاط H + -ATPase في مسوخ إينا

لتأكيد مشاركة الأنظمة المعنية بالحفاظ على إمكانات غشاء البلازما (PMA1 / H + -ATPase وأنظمة النقل الثانوية) أثناء استجابة الإجهاد الحمضي ، قمنا ببناء سلالات خميرة تعبر عن مستويات مختلفة من Ena1p. بينما يشارك Pma1p في البثق النشط للبروتونات ، تعمل بروتينات ENA في الاستجابات للإجهاد الملحي أو القلوي [38] وتساعد على تنظيم إمكانات غشاء البلازما [29]. خميرة الخميرة يحتوي على العديد من الجينات التي تشفر بروتينات ENA ولكن ENA1 الجين هو العنصر الأكثر صلة وظيفيًا في مجموعة الجينات [38]. يوضح الشكل 3 التنشيط في الجسم الحي لغشاء البلازما H + -ATPase بواسطة حمض النبض (pH 2.0 + 86 mM NaCl) في سلالات الخميرة بمستويات مختلفة من Ena1p. سلالة الحذف (W303 ena1 :: HIS3 :: ena4) ، W303 ena1 :: HIS3 :: ena4 تحولت السلالة مع النواقل الفارغة ، والسلالة التي تعبر عن نسخة واحدة من ENA1 (W303 ena1 :: HIS3 :: ena4 + p417 :: ENA1) أظهر تنشيط H + -ATPase الناجم عن الحمض. في المقابل ، لم يلاحظ أي تنشيط في السكريات سلالات تعبر عن مستويات عالية من Ena1p (W303 و W303 ena1 :: HIS3 :: ena4 + p427 :: ENA1). يوضح الجدول 2 ذلك ena1Δ المسوخ قدم تحملاً أعلى للإجهاد الحمضي عند مقارنة قابلية بقاء السلالات بمستويات مختلفة من Ena1p بالنوع البري S. cerevisiae W303 (تعبير ENA عالي) بمرور الوقت. تم تأكيد هذه النتائج من خلال الاختبارات الموضعية عندما تم رصد تخفيفات متسلسلة بمقدار عشرة أضعاف للخلايا المضغوطة والحمضية على لوحات YPD (النتائج غير معروضة). إمكانات الغشاء الأكثر سلبية في ظل ظروف النمو القياسية اينا يمكن للطفرات والخلايا الخالية من التعبير Ena1p أن تفسر الارتباط بين مستويات ENA1 ، وتنشيط غشاء البلازما الناجم عن الحمض H + -ATPase ، وتحمل الحمض كما هو موضح في دراسة سابقة [29]. في المقابل ، فإن السلالات التي تفرط في التعبير عن Ena1p لها إمكانات غشاء أكثر إيجابية وليست عرضة لتفعيل H + -ATPase الناجم عن الحمض. أظهرت السلالة التي تعبر عن نسخة واحدة (أو نسختين كحد أقصى من ENA1) قابلية أقل للحياة مقارنةً بـ S. boulardii (انخفاض التعبير عن ENA1 ومقاومة الأحماض ، العمل السابق [29]) ربما بسبب W303 ena1 :: HIS3 :: ena4 + p417 :: ENA1 يعرض ملف تعريف تعبير مختلف مقارنة بـ S. boulardii (التعبير خارج الرحم x eutopic). التجارب اللاحقة لفهم العلاقات بين تعبير Ena1p وتنشيط H + -ATPase الناجم عن الحمض ضرورية لتأكيد هذه الفرضية. بالإضافة إلى ذلك ، تشارك عوامل أخرى في استجابة الإجهاد الحمضي.


نشاط H + -ATPase. تنشيط غشاء البلازما H + -ATPase في البرية S. cerevisiae W303 (●) ، ena1-4 متحولة (■) ، ena1-4 متحولة + p417 :: ENA1 (◆), ena1-4 متحولة + p427 :: ENA1 (▲), ena1-4 متحولة + p417 (◊) و ena1-4 متحولة + p427 (
3.4. حمض عصاري خلوي Ca 2 + زيادة عابرة

كانت إشارة الكالسيوم التي يسببها الجلوكوز معروفة جيدًا وتم استخدامها كعنصر تحكم إيجابي في التجربة الحالية [39]. ومع ذلك ، فإن المعلومات حول إشارة الكالسيوم العابرة استجابة للتعرض الحمضي غير متوفرة في الأدبيات. كما هو متوقع ، أظهرت خلايا الخميرة المعلقة في Mes / Tris (0.1 M ، pH 6.5) وعرضها على نبضات الجلوكوز إشارة كالسيوم واضحة ناتجة عن الجلوكوز (الشكل 4 (أ)). من ناحية أخرى ، أنتجت النبضات الحمضية إشارة منخفضة جدًا من الكالسيوم في العصارة الخلوية والتي كانت تعتمد على الرقم الهيدروجيني (الشكل 4 (ب)). تم قياس تأثير النبضات الحمضية المتطابقة أيضًا في معلقات ذات كثافة خلية أقل. لاحظنا إشارة كالسيوم أعلى في هذه المعلقات ، على الأرجح لأن معلقات الخلايا الأكثر كثافة لديها قدرة تخزين أعلى (النتائج غير معروضة). ومع ذلك ، فإن اختبار التلألؤ حساس لدرجة الحموضة ، وقد أظهرت دراسات أخرى وجود علاقة بين الأس الهيدروجيني والتلألؤ في coelenterazine [40]. لتقييم ما إذا كانت إشارات الكالسيوم المستحثة بالحمض كانت نتيجة لتغيرات الأس الهيدروجيني ، أجرينا تجربة مماثلة باستخدام نبضة بوكل بوكل 15 ملي مولار كعنصر تحكم سلبي. لم يحفز نبض KCl تغيير الأس الهيدروجيني أو يحفز التلألؤ (الشكل 4 (ب)).


(أ)
(ب)
(أ)
(ب) الكالسيوم في الإشارات S. cerevisiae BY4741. (أ) إشارات الكالسيوم المستحثة بالجلوكوز عند الأس الهيدروجيني 6.5 (■) ، الرقم الهيدروجيني 3.7 (▲) ، الرقم الهيدروجيني 3.0 (

) ، ودرجة الحموضة 2.0 (□) (ب) إشارات الكالسيوم المستحثة بالحمض عند الرقم الهيدروجيني 5.1 (■) ، الرقم الهيدروجيني 4.2 (▲) ، الرقم الهيدروجيني 3.0 (

يوضح الشكل 5 أن الكالسينورين و CrZ1 كانا مطلوبين للحث على استجابة الإجهاد الحمضي. يشير هذا إلى أن الكالسينورين ، وهو بروتين فوسفاتيز ، يتم تنشيطه عن طريق التعرض للحمض ويعمل عن طريق تعديل التعبير الجيني من خلال نزع الفسفرة لعامل النسخ CrZ1p / Tcn1p وانتقاله إلى النواة [25]. تم حظر هذا المسار بإضافة 1 جم / مل FK 506 (مثبط الكالسينيورين) إلى ثقافة خلايا الخميرة عند 0.5 O.D. تم تطبيق حالة الإجهاد الحمضي فقط عندما وصل تركيز الخلية إلى 1.0 O.D. كانت هذه الخلايا (المحتضنة بـ FK506) أقل مقاومة عند مقارنتها بخلايا التحكم (الشكل 5). ومن المعروف أن S. cerevisiae يولد إشارات كالسيوم عصاري خلوي استجابة لمحفزات متنوعة. تتوسط إشارات الكالسيوم العابرة هذه استجابات مختلفة في الخلايا حقيقية النواة. على سبيل المثال ، يؤدي الإجهاد القلوي إلى تقلب الكالسيوم في S. cerevisiae [5] و C. البيض [14]. كلاريت وآخرون. [22] اقترح مشاركة مكونات قناة الكالسيوم الخلوية Cch1 و Mid1 في حيوية الخلية عند درجة حموضة منخفضة.


تأثير الأس الهيدروجيني 2.0 (حمض الهيدروكلوريك) + 86 ملي مول كلوريد الصوديوم على الكالسينيورين /crz1 المسوخ. تظهر النتائج أن استجابة الإجهاد الحمضي تعتمد على استقلاب الكالسيوم ويتم حظرها بواسطة FK 506.

4. مناقشة

التغيرات في الأس الهيدروجيني خارج الخلية لها تأثير سلبي على دورة حياة الخميرة والحفاظ على توازن الأس الهيدروجيني الداخلي مهم لبقاء الخلية. يمكن لخلايا الخميرة أن تحافظ على درجة حموضة داخلية مناسبة من خلال استخدام أنظمة المخزن الخلوي واستهلاك H + من خلال المسارات الأيضية [41] ، وزيادة بثق البروتون بواسطة غشاء البلازما H + -ATPase [42 ، 43] ، ونقل الحمض بين العصارة الخلوية والعضيات [44] ، 45]. تؤكد نتائجنا أن طاقة المخزن المؤقت للخلية قد تكون جزءًا من آلية توازن الأس الهيدروجيني المتضمنة في استجابة الإجهاد الحمضي. كما تم تعديل تكوين ومستويات الأحماض الدهنية في غشاء الخلية استجابة للإجهاد الحمضي. هنا ، نقترح أن تعديل تكوين ومستوى الأحماض الدهنية الغشائية يتداخل مع توصيل H + في الخلايا. الجينات المشاركة في التخليق الحيوي لدهون غشاء البلازما ، وهي مكونات أساسية في الغشاء الهيكلي ، يتم تعديل تعبيرها تحت الضغط [46 ، 47]. من المحتمل أن تؤثر بنية غشاء البلازما على تحمل الخميرة لانخفاض درجة الحموضة والضغوط الأخرى [47]. أظهرنا أيضًا تأثير الصوديوم على تعديل تركيبة الأحماض الدهنية بعد الإجهاد الحمضي (الشكل 2). تتفق النتائج التي توصلنا إليها مع الملاحظات التي أجراها دوس سانتوس سانتانا وآخرون. [29] ، الذي ذكر أن إضافة الصوديوم يمنح الحماية لخلايا الخميرة ضد الإجهاد الحمضي. في الواقع ، أدت إضافة الصوديوم إلى إبطاء إزالة الاستقطاب الذي يعززه تدفق البروتون. اقترح المؤلفون ، بدلاً من ذلك ، أن تأثير الصوديوم يمكن أن يكون مرتبطًا بأحداث إشارات غير معروفة استجابةً للإجهاد الحمضي. على سبيل المثال ، Bollo et al. [48] ​​أبلغ عن تأثير 120 ملي كلوريد الصوديوم خارج الخلية على تعبئة الكالسيوم 2+ من المتاجر داخل الخلايا في المثقبية الكروزية. أظهر العمل الحالي أن الصوديوم ، من خلال تأثير غير مباشر ، قادر على التأثير في تعديل الأحماض الدهنية الغشائية في حالة الإجهاد الحمضي.

من المعروف أن خلايا معظم الكائنات الحية تحافظ على نسب تركيز عالية من خارج الخلية إلى داخل الخلايا H + عبر غشاء البلازما وأن عوامل الإجهاد تؤدي إلى تبديد تدرج H + عبر غشاء البلازما وإلى تحمض داخل الخلايا يحفز تحفيز غشاء البلازما H + -ATPase النشاط. في هذا العمل قمنا بمقارنة نشاط غشاء البلازما H + -ATPase في سلالات الخميرة المختلفة المعرضة لدرجة الحموضة المنخفضة. تشير النتائج إلى تنشيط H + -ATPase بعد التعرض للحمض. ومع ذلك ، فإن مستوى التنشيط ، كما هو مقترح سابقًا ، والتسامح الكبير للحمض كانا يعتمدان على التعبير عن أنظمة النقل الثانوية المشاركة في الحفاظ على إمكانات غشاء البلازما. يجب توضيح هذه العلاقة بين تنشيط حمض H + -ATPase والأنظمة الثانوية من خلال دراسات الأس الهيدروجيني الداخلي ، وإمكانات الغشاء ، ونشاط H + -ATPase في السلالات التي تعبر عن مستويات مختلفة من عائلة الجينات ، خاصة تلك التي تشفر أهم الناقلات الأيونية .

في الخميرة S. cerevisiae، الكالسينورين ، إنزيم غير متجانس يتكون من وحدة فرعية تحفيزية (أ) ووحدة فرعية تنظيمية (ب) مرتبطة بالكالسيوم ، يتم تنشيطه في ظل ظروف بيئية محددة ويلعب دورًا مهمًا في اقتران إشارات Ca 2+ بالاستجابات الخلوية. تعتمد حساسية الخلايا واستجابتها للضغوط المختلفة على قدرتها على عزل واستخدام Ca 2+ من المخازن الخارجية والداخلية. تظهر نتائجنا أن إشارات الكالسيوم تشارك في استجابة الإجهاد الحمضي وأن استجابة الإجهاد تعتمد على الكالسينيورين. Crz1 ، وهو ركيزة فوسفوبروتين للكالسينيورين ، يعمل في اتجاه مجرى الكالسينيورين للتأثير على الاستجابات المعتمدة على الكالسينيورين. تظهر نتائج اختبار الجدوى أنماطًا ظاهرية متشابهة لـ cnb1Δ و crz1Δ المسوخ.

استجابة الخميرة S. cerevisiae إلى الإجهاد البيئي ينتج عنه إعادة تشكيل التعبير الجيني. في الدراسات السابقة ، تم تقييم استجابة الجينوم للإجهاد الحمضي من خلال تحليل ميكروأري للحمض النووي وفحص وظيفي تم إجراؤه باستخدام مجموعة حذف الجينات [9 ، 17]. أظهر تحليل التعبير أن الجينات تشارك في استجابات الإجهاد ، مثل YGP1, TPS1، و HSP150، تم تنظيمها بعد الصدمة الحمضية وأن الجينات المشاركة في استقلاب المعادن أو التي ينظمها Aft1p تم تحفيزها في ظل التكيف الحمضي [17]. أشارت الدراسة الأخيرة أيضًا إلى أن فقدان بروتينات V-ATPase و Hog-MAPK تسبب في حساسية الحمض. لا يؤثر الضغط المعتدل على الظروف الحمضية (على سبيل المثال ، التحول من الرقم الهيدروجيني 6 إلى الرقم الهيدروجيني 3) S. cerevisiae النمو ولكن بدلا من ذلك قد يكون مفيدا قليلا [8]. ومع ذلك ، فقد ثبت أن البروتينات الموجودة في جدار الخلية يتم تنظيمها استجابةً لانخفاض درجة الحموضة [8 ، 17 ، 49].

تظهر بعض الدراسات حول تأثير الأس الهيدروجيني الحمضي على الخميرة أن مسار سلامة جدار خلية PKC يتم تنشيطه استجابةً لانخفاض درجة الحموضة وأن RGD1p (مسار الخنزير) يلعب دورًا في الاستجابة للأس الهيدروجيني الحمضي [22-24]. في العمل الأكثر حداثة ، باستخدام مسوخ حذف المسح وملف تعريف التعبير الجيني ، de Lucena et al. [50] أظهر أن مسار سلامة جدار الخلية هو الآلية الرئيسية لتحمل الخلية لدرجة حموضة حامض الكبريتيك 2.5 وأن مسار Ca 2+ -calmodulin يستجيب أيضًا لهذا النوع من الإجهاد. هنا ، أظهرنا أن مستويات الكالسيوم الخالية من العصارة الخلوية تزداد تحت الصدمة الحمضية وأن الكالسينيورين هو محول مهم لإشارات الكالسيوم في استجابات الإجهاد الحمضي.

في الختام ، أظهرت نتائج الدراسة الحالية أن تركيز الخميرة الداخلي H + ينظمه عدة أنظمة ، بما في ذلك غشاء البلازما H + -ATPase ، وأن Ena1p له دور مهم ولكنه غير محدد في الاستجابة الخلوية للحمض. أظهرنا أيضًا أن استجابة الإجهاد الحمضي تعتمد على استقلاب الكالسيوم وتم حظرها بواسطة FK 506. دراسات RNA-seq و microarray باستخدام مختلف S. cereviseae سلالات ، بما في ذلك S. boulardii، يتم إجراؤها حاليًا لتوفير بعض الأفكار حول آليات استجابة الإجهاد الحمضي. في موازاة ذلك ، تجري تجارب تهدف إلى توصيف إشارة الكالسيوم (الخارجية أو الداخلية) واعتماد مسار الاستجابة الحمضية على الكالسينيورين / Crz1p.

تضارب المصالح

يعلن المؤلفون أنه لا يوجد تضارب في المصالح فيما يتعلق بنشر هذه الورقة.

شكر وتقدير

تم دعم هذا العمل من خلال المنح المقدمة من Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG) (CBB APQ 00333-10 / CBB APQ 00482/11) ومن Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) إلى Ieso Miranda Castro عملية 304259 / 2011-0). تم دعم جوليو سيزار كامارا روزا وآنا باولا دو كارمو من خلال زمالات من منسقية الشؤون الداخلية Aperfeiçoamento de Pessoal do Ensino Superior (CAPES). تمت مراجعة اللغة الإنجليزية في الورقة من خلال كتابة العلوم الصحيحة (http://www.writescienceright.com/).

مراجع

  1. L. Trabalzini ، A. Paffetti ، A. Scaloni et al. ، "الاستجابة البروتينية لضغوط التخمير الفسيولوجية في سلالة نبيذ من النوع البري خميرة الخميرة,” مجلة الكيمياء الحيوية، المجلد. 370 ، لا. 1، pp.35–46، 2003. عرض على: موقع الناشر | منحة جوجل
  2. إم بلاتارا ، إيه رويز ، ر. سيرانو ، إيه بالومينو ، إف مورينو ، ج. مجلة الكيمياء البيولوجية، المجلد. 281 ، لا. 48، pp.36632–36642، 2006. عرض على: موقع الناشر | منحة جوجل
  3. Y. Araki و H. Wu و H. Kitagaki و T. Akao و H. Takagi و H. Shimoi ، "يحفز إجهاد الإيثانول مسار الكالسيوم / Crz1 بوساطة Ca 2+ في خميرة الخميرة,” مجلة العلوم الحيوية والهندسة الحيوية، المجلد. 107 ، لا. 1، pp.1–6، 2009. عرض على: موقع الناشر | منحة جوجل
  4. A. Daquinag و M. Fadri و S. Y. البيولوجيا الجزيئية والخلوية، المجلد. 27 ، لا. 2، pp.633–650، 2007. عرض على: موقع الناشر | منحة جوجل
  5. J. Ari & # xf1o ، "الاستجابات التكاملية لضغط الأس الهيدروجيني المرتفع في S. cerevisiae,” OMICS مجلة علم الأحياء التكاملي، المجلد. 14 ، لا. 5 ، ص 517-523 ، 2010. عرض على: موقع الناشر | منحة جوجل
  6. A. P. Gasch ، P. T. Spellman ، C.M Kao et al. ، "برامج التعبير الجينومي في استجابة خلايا الخميرة للتغيرات البيئية ،" البيولوجيا الجزيئية للخلية، المجلد. 11 ، لا. 12 ، ص 4241-4257 ، 2000. عرض على: الباحث العلمي من Google
  7. H. F. De Melo ، B. M. Bonini ، J. Thevelein ، D.A Sim & # xf5es ، and M.A Morais Jr. ، "التحليل الفسيولوجي والجزيئي لاستجابة الإجهاد للسكريات الحمضية التي يفرضها حمض غير عضوي قوي مع تضمين التخمر الصناعي ،" مجلة علم الأحياء الدقيقة التطبيقي، المجلد. 109 ، لا. 1، pp. 116–127، 2010. عرض على: موقع الناشر | منحة جوجل
  8. أ.ك.- ل. تشين ، سي. جيلينج ، بي إل روجرز ، آي دبليو دوز ، وب خميرة الخميرة لتحمض خالي من الإجهاد ، " مجلة علم الأحياء الدقيقة، المجلد. 47 ، لا. 1، pp. 1–8، 2009. عرض على: موقع الناشر | منحة جوجل
  9. H.C Causton ، B. Ren ، S. S. K. Sang Seok Koh et al. ، "إعادة تشكيل التعبير الجيني للخميرة استجابة للتغيرات البيئية ،" البيولوجيا الجزيئية للخلية، المجلد. 12 ، لا. 2، pp.323–337، 2001. View at: Google Scholar
  10. R. Serrano و A. Ruiz و D. Bernal و J.R Chambers و J. Ari & # xf1o ، "الاستجابة النسخية للأس الهيدروجيني القلوي في خميرة الخميرة: دليل على وجود إشارات بوساطة الكالسيوم ، " علم الأحياء الدقيقة الجزيئي، المجلد. 46 ، لا. 5، pp. 1319–1333، 2002. عرض على: موقع الناشر | منحة جوجل
  11. R. Serrano و H. Mart & # xedn و A. Casamayor و J. Ari & # xf1o ، "الإشارة إلى إجهاد الأس الهيدروجيني القلوي في الخميرة خميرة الخميرة من خلال مستشعر سطح الخلية Wsc1 ومسار Slt2 MAPK ، " مجلة الكيمياء البيولوجية، المجلد. 281 ، لا. 52، pp. 39785–39795، 2006. عرض على: موقع الناشر | منحة جوجل
  12. فيلاديفال ، ر. سيرانو ، أ. رويز وآخرون ، "توصيف الاستجابة بوساطة الكالسيوم للإجهاد القلوي في خميرة الخميرة,” مجلة الكيمياء البيولوجية، المجلد. 279 ، لا. 42 ، ص 43614-43624 ، 2004. عرض على: موقع الناشر | منحة جوجل
  13. كارابابا ، إي فالنتينو ، جي بارديني ، إيه تي كوست ، جيه بيل ، دي سانجلارد ، "CRZ1 ، هدف مسار الكالسينيورين في المبيضات البيض,” علم الأحياء الدقيقة الجزيئي، المجلد. 59 ، لا. 5، pp.1429–1451، 2006. عرض على: موقع الناشر | منحة جوجل
  14. H. Wang و Y. Liang و B. Zhang و W. Zheng و L. Xing و M. Li ، "يؤدي الإجهاد القلوي إلى تذبذب فوري للكالسيوم في المبيضات البيض بوساطة عوامل النسخ Rim101p و Crz1p ، " أبحاث الخميرة FEMS، المجلد. 11 ، لا. 5، pp. 430–439، 2011. عرض على: موقع الناشر | منحة جوجل
  15. إس إتش دينيسون ، "تنظيم الأس الهيدروجيني للتعبير الجيني في الفطريات ،" علم الوراثة الفطرية وعلم الأحياء، المجلد. 29 ، لا. 2، pp.61–71، 2000. عرض على: موقع الناشر | منحة جوجل
  16. M. A. Pe & # xf1alva و J. Tilburn و E. Bignell و H.N Arst Jr. ، "تنظيم جين الأس الهيدروجيني المحيط في الفطريات: إجراء الاتصالات ،" الاتجاهات في علم الأحياء الدقيقة، المجلد. 16 ، لا. 6 ، ص 291 - 300 ، 2008. عرض على: موقع الناشر | منحة جوجل
  17. Kawahata ، K. Masaki ، T. Fujii ، و H.Iefuji ، "جينات الخميرة المشاركة في الاستجابة لحمض اللاكتيك وحمض الخليك: الظروف الحمضية التي تسببها الأحماض العضوية في خميرة الخميرة تحفز الثقافات على التعبير عن جينات استقلاب المعادن داخل الخلايا التي تنظمها Aft1p ، " أبحاث الخميرة FEMS، المجلد. 6 ، لا. 6 ، ص 924-936 ، 2006. عرض على: موقع الناشر | منحة جوجل
  18. بيبر ، سي أو.كالديرون ، ك. علم الاحياء المجهري، المجلد. 147 ، لا. 10 ، ص 2635-2642 ، 2001. عرض على: الباحث العلمي من Google
  19. M.G Cabral و I. S & # xe1-Correia و C. A. Viegas ، "الاستجابات التكيفية في الخميرة لمبيدات الأعشاب 2-methyl-4-chlorophenoxyacetic acid على مستوى توازن درجة الحموضة داخل الخلايا ،" مجلة علم الأحياء الدقيقة التطبيقي، المجلد. 96 ، لا. 3 ، ص 603-612 ، 2004. عرض على: موقع الناشر | منحة جوجل
  20. M. Mollapour و P. W. Piper ، "الحذف الجيني المستهدف في Zygosaccharomyces bailii,” خميرة، المجلد. 18 ، لا. 10، pp. 173–186، 2001. View at: Google Scholar
  21. P. Eraso و C. Gancedo ، "تنشيط ATPase لغشاء البلازما الخميرة بواسطة الأس الهيدروجيني الحمضي أثناء النمو ،" رسائل FEBS، المجلد. 224 ، لا. 1، pp. 187–192، 1987. View at: Google Scholar
  22. S. كلاريت ، X. جاتي ، إف. خميرة الخميرة,” خلية حقيقية النواة، المجلد. 4 ، لا. 8، pp. 1375–1386، 2005. عرض على: موقع الناشر | منحة جوجل
  23. X. Gatti، G. De Bettignies، S. Claret، F. Doignon، M. Crouzet، and D. Thoraval، “RGD1 ، الذي يشفر RhoGAP المتضمن في بقاء الأس الهيدروجيني المنخفض ، هو جين منظم Msn2p / Msn4p في خميرة الخميرة,” الجين، المجلد. 351 ، ص 159 - 169 ، 2005.عرض على: موقع الناشر | منحة جوجل
  24. H. Fernandes ، O. Roumanie ، S. Claret et al. ، "يتفاعل Rho3 و Rho4 الصغيران GTPases وظيفيًا مع Wsc1p ، وهو مستشعر سطح الخلية لمسار سلامة الخلية البروتين كيناز سي في خميرة الخميرة,” علم الاحياء المجهري، المجلد. 152 ، لا. 3، pp.695–708، 2006. عرض على: موقع الناشر | منحة جوجل
  25. ك. دبليو كننغهام ، "مخازن الكالسيوم الحمضية خميرة الخميرة,” كالسيوم الخلية، المجلد. 50 ، لا. 2، pp.129–138، 2011. عرض على: موقع الناشر | منحة جوجل
  26. T.K Matsumoto ، A.J Ellsmore ، S.G Cessna et al. ، "ينشط عابر Ca 2+ الخلوي المستحث بالتناضح إشارات الكالسينيورين للتوسط في التوازن الأيوني وتحمل الملح في خميرة الخميرة,” مجلة الكيمياء البيولوجية، المجلد. 277 ، لا. 36، pp.33075–33080، 2002. عرض على: موقع الناشر | منحة جوجل
  27. M. Bonilla و K.W. Cunningham ، "تحفيز بروتين كيناز المنشط بالميتوجين لإشارة Ca 2+ مطلوب للبقاء على قيد الحياة من إجهاد الشبكة الإندوبلازمية في الخميرة ،" البيولوجيا الجزيئية للخلية، المجلد. 14 ، لا. 10 ، ص 4296-4305 ، 2003. عرض على: موقع الناشر | منحة جوجل
  28. السيرة الذاتية. Popa، I. Dumitru، L.L Ruta، A.F Danet، and I.C Farcasanu، "الإجهاد التأكسدي الخارجي يحفز إطلاق Ca 2+ في الخميرة خميرة الخميرة,” مجلة FEBS، المجلد. 277 ، لا. 19، pp. 4027–4038، 2010. عرض على: موقع الناشر | منحة جوجل
  29. G. Dos Santos Sant & # x27Ana، L. Da Silva Paes، A.F Vieira Paiva et al.، "التأثير الوقائي للأيونات ضد موت الخلايا الناجم عن الإجهاد الحمضي في السكريات,” أبحاث الخميرة FEMS، المجلد. 9 ، لا. 5، pp. 701–712، 2009. عرض على: موقع الناشر | منحة جوجل
  30. T. A. Krulwich و R. Agus و M. Schneier و A. A. Guffanti ، "قدرة التخزين المؤقت للعصيات التي تنمو في نطاقات مختلفة من الأس الهيدروجيني ،" مجلة علم الجراثيم، المجلد. 162 ، لا. 2 ، ص 768-772 ، 1985. عرض على: الباحث العلمي من Google
  31. J. Becher Dos Passos ، M. Vanhalewyn ، R. Lopes Brandao ، I.M Castro ، J.R Nicoli ، and J.M Thevelein ، "تنشيط الجلوكوز الناجم عن غشاء البلازما H + -ATPase في طفرات الخميرة خميرة الخميرة تتأثر بعملية التمثيل الغذائي لـ cAMP ، فسفرة البروتين المعتمدة على cAMP وبدء تحلل السكر ، " Biochimica et Biophysica Acta: أبحاث الخلايا الجزيئية، المجلد. 1136 ، لا. 1، pp. 57–67، 1992. عرض على: موقع الناشر | منحة جوجل
  32. O. H. Lowry ، N.J. Rosebrough ، A. L. Farr ، and R.J. Randall ، "قياس البروتين باستخدام كاشف Folin phenol ،" مجلة الكيمياء البيولوجية، المجلد. 193 ، لا. 1، pp.265–275، 1951. View at: Google Scholar
  33. R. Tisi و S. Baldassa و F. Belotti و E. Martegani ، "Phospholipase C مطلوب لتدفق الكالسيوم الناجم عن الجلوكوز في الخميرة الناشئة ،" رسائل FEBS، المجلد. 520 ، لا. 1 & # x20133 ، ص 133 - 138 ، 2002. عرض على: موقع الناشر | منحة جوجل
  34. M. C. Pereira ، N. M. Vieira ، M. R. T & # xf3tola ، and M. Epulorhiza spp,” Revista Brasileira de Ciencia do Solo، المجلد. 35 ، لا. 4 ، ص 1159-1165 ، 2011. عرض على: الباحث العلمي من Google
  35. سي دي كروز ، جينات البرنامج: المتنوع genidade gen & # xe9tica [Ph.D. فرضية]، Universidade Federal de Vi & # xe7osa، Vi & # xe7osa، MG، Brazil، 2008.
  36. جيه سامبروك وإي إف فريتش وتي مانياتيس ، الاستنساخ الجزيئي: دليل معمل، مطبعة مختبر كولد سبرينغ هاربور ، كولد سبرينغ هاربور ، نيويورك ، الولايات المتحدة الأمريكية ، الطبعة الثانية ، 1989.
  37. H. Ito و Y. Fukuda و K. Murata و A. Kimura ، "تحويل خلايا الخميرة السليمة المعالجة بالكاتيونات القلوية ،" مجلة علم الجراثيم، المجلد. 153 ، لا. 1، pp. 163–168، 1983. View at: Google Scholar
  38. A. Ruiz و J. Ari & # xf1o ، "وظيفة وتنظيم خميرة الخميرة نظام ENA sodium ATPase ، " خلية حقيقية النواة، المجلد. 6 ، لا. 12 ، ص 2175-2183 ، 2007. عرض على: موقع الناشر | منحة جوجل
  39. M.JM Tr & # xf3pia، A. S. Cardoso، R. Tisi et al. ، "إشارات الكالسيوم والتفعيل الناجم عن السكر لغشاء البلازما H + -ATPase في خميرة الخميرة الخلايا ، " الكيمياء الحيوية والبيوفيزيائية تبحث في الاتصالات، المجلد. 343 ، لا. 4، pp. 1234–1243، 2006. عرض على: موقع الناشر | منحة جوجل
  40. Y. Zang ، و Q. Xie ، و J.B. بلوس واحد، المجلد. 7 ، معرف المقالة 43072 ، 2012. عرض على: الباحث العلمي من Google
  41. إم جيه كارلايل ، إس سي واتكينسون ، جي دبليو جوداي ، الفطريات، المطبعة الأكاديمية ، سان دييغو ، كاليفورنيا ، الولايات المتحدة الأمريكية ، الطبعة الثانية ، 2001.
  42. R. Serrano و M.Cielland-Brandt و G.R Fink ، "يعد ATPase غشاء بلازما الخميرة ضروريًا للنمو وله تماثل مع (Na + ، K +) ، K + و Ca 2+ -ATPases ،" طبيعة سجية، المجلد. 319 ، لا. 6055 ، ص 689-693 ، 1986. عرض على: الباحث العلمي من Google
  43. F. Portillo ، "تنظيم غشاء البلازما H + -ATPase في الفطريات والنباتات ،" Biochimica et Biophysica Acta: مراجعات حول الأغشية الحيوية، المجلد. 1469 ، لا. 1 ، ص 31-42 ، 2000. عرض على: موقع الناشر | منحة جوجل
  44. V. Carmelo و H. Santos و I. S & # xe1-Correia ، "تأثير التحمض خارج الخلية على نشاط غشاء البلازما ATPase وعلى الأس الهيدروجيني الخلوي والفجوي لـ خميرة الخميرة,” Biochimica et Biophysica Acta: الأغشية الحيوية، المجلد. 1325 ، لا. 1، pp.63–70، 1997. عرض على: موقع الناشر | منحة جوجل
  45. G. A. Mart & # xednez-Mu & # xf1oz و P. Kane ، "تتعاون مضخات البروتون بغشاء الفراغ والبلازما لتحقيق توازن الأس الهيدروجيني الخلوي في الخميرة ،" مجلة الكيمياء البيولوجية، المجلد. 283 ، لا. 29، pp.20309–20319، 2008. عرض على: موقع الناشر | منحة جوجل
  46. J. Ding و X. Huang و L. Zhang و N. Zhao و D. Yang و K. Zhang ، "استجابة التسامح والضغط للإيثانول في الخميرة خميرة الخميرة,” علم الأحياء الدقيقة التطبيقي والتكنولوجيا الحيوية، المجلد. 85 ، لا. 2، pp.253–263، 2009. عرض على: موقع الناشر | منحة جوجل
  47. N. P. Mira و M. Palma و J.F Guerreiro و I. S & # xe1-Correia ، "تحديد الجينوم على مستوى خميرة الخميرة الجينات اللازمة لتحمل حمض الأسيتيك ، " مصانع الخلايا الميكروبية، المجلد. 9 ، المادة 79 ، 2010. عرض على: موقع الناشر | منحة جوجل
  48. M. Bollo ، S. Bonansea ، و E. المثقبية الكروزية,” رسائل FEBS، المجلد. 580 ، لا. 11 ، ص 2686-2690 ، 2006. عرض على: موقع الناشر | منحة جوجل
  49. J.C.Kapteyn و B. Ter Riet و E. Vink et al. ، "يؤدي انخفاض درجة الحموضة الخارجية إلى تغييرات تعتمد على HOG1 في تنظيم خميرة الخميرة جدار الخلية " علم الأحياء الدقيقة الجزيئي، المجلد. 39 ، لا. 2 ، ص 469-479 ، 2001. عرض على: موقع الناشر | منحة جوجل
  50. R.M de Lucena و C. Elsztein و D. A. Sim & # xf5es و M. A. Morais Jr ، "مشاركة مسارات CW1 و HOG و calcineurin في تحمل السكريات إلى انخفاض درجة الحموضة بواسطة حمض غير عضوي ، " مجلة علم الأحياء الدقيقة التطبيقي، المجلد. 113 ، لا. 3، pp.629–640، 2012. View at: Google Scholar

حقوق النشر

حقوق النشر & # xA9 2014 Rogelio Lopes Brand & # xe3o et al. هذا مقال مفتوح الوصول يتم توزيعه بموجب ترخيص Creative Commons Attribution License ، والذي يسمح بالاستخدام غير المقيد والتوزيع والاستنساخ في أي وسيط ، بشرط الاستشهاد بالعمل الأصلي بشكل صحيح.


المقدمة

يتمثل التحدي الأساسي على مستوى النظام في فسيولوجيا الخلية ، وخاصة بالنسبة للكائنات الحية الدقيقة ، في تحقيق نمو متوازن في مواجهة بيئة متقلبة. يجب تنسيق مجموعة متنوعة من العمليات الخلوية ، التي تنفذها بروتينات مأخوذة من آلاف الجينات ، للسماح للخلايا بالتكاثر والنمو والتنافس على الموارد بكفاءة. من بين العمليات التي يجب تنسيقها استخراج الطاقة والمستقلبات من التخليق الحيوي للبيئة لكميات مناسبة من مئات الجزيئات الكبيرة والصغيرة وأحداث دورة انقسام الخلية ، بما في ذلك تكرار الحمض النووي وتجميع وفصل العضيات دون الخلوية والهياكل. كل هذا التنسيق يجب أن يتم بطريقة تسمح للخلية بتعديل أنشطتها ، غالبًا على نطاق زمني قصير جدًا ، عندما تتغير البيئة.

الهدف المتمثل في فهم كيفية تحقيق الخلايا للنمو المتوازن (أو استتباب النمو) قد تم متابعته منذ منتصف القرن العشرين ، وتم إحراز تقدم كبير. في الكتب المدرسية اليوم ، يمكن للمرء أن يجد حسابات متماسكة (إن لم تكن شاملة) لتنظيم التمثيل الغذائي بجميع أنواعه: تنظيم التركيب الجزيئي ، والتحكم في دورة الخلية ، وتجميع العضيات وتوزيعها ، واستجابة هذه العمليات لجميع أنواع الاضطرابات البيئية. ويؤكد. ومع ذلك ، حتى وقت قريب ، لم تكن هناك طرق لمتابعة تعبير جميع الجينات في وقت واحد. لذلك ، تم إحراز تقدم بالضرورة من خلال التركيز على أدوار الجينات الفردية في كل عملية ، غالبًا من خلال الطفرات فيها. في العقد الماضي ، سمحت تقنية ميكروأري بدراسات التعبير الجيني على نطاق الجينوم لدورة خلية الخميرة (تشو وآخرون.، 1998 سبيلمان وآخرون.، 1998 براميلا وآخرون.، 2006 كودليكي وآخرون.، 2007) الاستجابة للضغوط المختلفة (Gasch وآخرون.، 2000 جاش وآخرون.، 2001) ، ومجموعة متنوعة من الظروف الأيضية ، مثل التحول diauxic من النمو على الجلوكوز إلى النمو على الإيثانول (DeRisi وآخرون.، 1997 Brauer وآخرون.، 2005) والنمو في حالة ثابتة في مجموعة متنوعة من العناصر الغذائية المحدودة (Boer وآخرون.، 2003 سلدانها وآخرون.، 2004 ريجنبرج وآخرون.، 2006 كاستريلو وآخرون.، 2007). زوجان من الدراسات الحديثة (Klevecz وآخرون.، 2004 Tu وآخرون.، 2005) التعبير الجيني أثناء السلوك التذبذب في الكيموستات ، والذي ظهر منه ارتباط محتمل مع التحكم في دورة الخلية (Futcher ، 2006).

لقد سعينا إلى استكشاف العلاقة بين معدل النمو والأنماط على مستوى الجينوم للتعبير الجيني في ثقافات الخميرة المتزايدة النمو بشكل كبير وغير المجهدة اسميًا. لقد سعينا تحديدًا إلى تحديد جينات الخميرة (إن وجدت) التي يتم التعبير عنها على مستوى (يقاس بتركيز mRNA باستخدام مصفوفات الحمض النووي الدقيقة) يرتبط ببساطة بمعدل نمو الخلية ، بغض النظر عن العوامل البيئية التي تفرض في النهاية معدل النمو اللحظي الملحوظ. بالإضافة إلى التعبير الجيني ، قمنا بقياس جزء الخلايا غير المرحة (أي في مراحل G0 / G1 من دورة الخلية) وتركيزات الجلوكوز والإيثانول في الوسائط.

مثل الدراسات الحديثة الأخرى (Regenberg وآخرون.، 2006 كاستريلو وآخرون.، 2007) ، قمنا باستغلال نظام الاستزراع المستمر الناظم الكيميائي (Monod، 1950 Novick and Szilard، 1950) لتوفير ظروف الحالة المستقرة بمعدلات نمو ثابتة مختلفة في مجموعة متنوعة من الوسائط حيث يُعرف المغذي الذي يحد من معدل النمو. يسمح الكيموستات للفرد بالتحكم في معدل نمو الكائن الحي عن طريق تعديل معدل تدفق الوسط الجديد إلى حجرة النمو مما يوفر بيئة محددة قابلة لتحليلات مقياس الجينوم (Hoskisson and Hobbs ، 2005).

من خلال تحليل بيانات وفرة الرنا المرسال التي حصلنا عليها من 36 مزرعة ناظم كيميائي (ستة مغذيات مختلفة لكل منها عند ستة معدلات نمو مختلفة) ، وجدنا أنه يتم التعبير عن جزء كبير بشكل مدهش (27 ٪) من جميع جينات الخميرة (كما تم قياسه بواسطة وفرة mRNA النسبية) بطريقة ترتبط ارتباطًا وثيقًا (سلبًا أو إيجابيًا) بمعدل نمو الثقافة. لقد تحققنا كميًا ، وامتدنا إلى ظروف ثقافة الحالة المستقرة ، العلاقة بين معدل النمو وجزء الخلايا غير المرغوبة الذي اقترحه أول مرة أنغر وهارتويل (1976). اكتشفنا أيضًا فرقًا مذهلاً بين قيود النمو بواسطة الأمونيوم أو الكبريتات أو الفوسفات ("العناصر الغذائية الطبيعية" راجع Saldanha وآخرون.، 2004) عن العناصر الغذائية الأساسية من خلال الطفرات التي تمنح متطلبات التغذية. عندما يكون نمو الثقافات (إما في حالة ثابتة أو دفعة) مقيدًا بالفوسفات أو الأمونيا أو الكبريتات ، يتم الحفاظ على الجلوكوز غير المستخدم ، كما قد يتوقع المرء ، بينما عندما يكون النمو مقيدًا بمتطلبات التغذية ، يتم استهلاك الجلوكوز الزائد تمامًا.

نفسر هذه النتائج على أنها انعكاسات لآليات تنظيمية على مستوى النظام ، حتى الآن مفهومة جزئيًا فقط ، والتي يجب أن تكمن وراء تنسيق معدل النمو مع التعبير الجيني ، والدخول في دورة انقسام الخلية ، واستجابة الإجهاد ، واستقلاب الطاقة.


صورة متفق عليها لعناصر تحكم دورة الخلية في الخميرة الملصقة

أنشطة كيناز المعتمدة على Cyclin

يتم التحكم في أحداث دورة الخلية الرئيسية في الخميرة الناشئة عن طريق CDK واحد (Cdc28) بالتزامن مع عائلتين من الأعاصير: Cln1–3 و Clb1–6 (Nasmyth، 1993 Mendenhall and Hodge، 1998). يلعب Cln1 / Cdc28 و Cln2 / Cdc28 أدوارًا رئيسية في ازدواجية جسم عمود الدوران في مهدها. يبدو أن Cln3 / Cdc28 يتحكم في الحجم الذي تقوم به الخلايا الوليدة بتنفيذ Start. Clb5 / Cdc28 و Clb6 / Cdc28 ضروريان لتكرار الحمض النووي في الوقت المناسب. يبدو أن Clb3 / Cdc28 و Clb4 / Cdc28 يساعدان في تكرار الحمض النووي وتشكيل المغزل. Clb1 / Cdc28 و Clb2 / Cdc28 ضروريان لإكمال الانقسام بشكل صحيح.

تتداخل أدوار هذه الأعاصير. جميع المسوخات المنفردة قابلة للحياة وتكاد تكون طبيعية ، باستثناء cln3 المسوخات ، التي تنفذ البدء في ضعف حجم الخلايا البرية (Dirick وآخرون.، 1995). (تدوين ، على سبيل المثال ، أليل من النوع البري = CLN3، أليل متحور متنحي = cln3، أليل متحولة سائد = CLN3 D ، والمنتج الجيني = Cln3.) على الرغم من أن ثلاثي-cln متحولةcln1 cln2 cln3، قاتلة (ريتشاردسون وآخرون.، 1989) ، و cln1 cln2 متحولة مزدوجة كبيرة وقابلة للحياة وقادرة على برعم. من الواضح أن أي واحد من Clns يمكنه القيام بالمهام الأساسية للاثنين الآخرين ، إذا كانت الخلية كبيرة بما يكفي. متحولة مزدوجةclb3 clb4 أمر طبيعي (ريتشاردسون وآخرون.، 1992Schwob and Nasmyth ، 1993) ، لذلك يمكن لعب أدوارهم بواسطة Clbs الأخرى. لأن أ clb5 clb6 تقوم الخلية الطافرة بتوليف الحمض النووي (على الرغم من بعض التأخير) ، في حين أن الخلية التي تحتوي على جميع الخلايا الستة CLBالجينات المحذوفة (clb1–6) ، يمكن أن يؤدي Clb1–4 إلى تخليق الحمض النووي في غياب Clb5–6 (Schwob وآخرون.، 1994). يعتبر زوج Clb1–2 فقط مميزًا بمعنى أن واحدًا منهم على الأقل ضروري لاستكمال الانقسام الفتيلي (Surana وآخرون.، 1991). بسبب هذه التكرار ، سيكون كافياً النظر في تفاعل Cdc28 مع أربع فئات فقط من الأعاصير: "Cln2" (تمثل الأنشطة المجمعة لـ Cln1 و Cln2) ، و Cln3 ، و "Clb2" (Clb1 و Clb2 مجتمعين) ، و " Clb5 ”(Clb5 و Clb6 مجتمعين). نحن لا نتتبع Clb3–4 في هذا النموذج.

تنظيم أنشطة كيناز المعتمدة على Cyclin

تأتي أنشطة Cyclin / Cdc28 وتذهب في تسلسل مميز أثناء دورة خلية الخميرة الناشئة. يتم تحقيق التنظيم بشكل أساسي من خلال تخليق وتدهور مكونات السيكلين ومثبط كيناز المعتمد على Clb Sic1. يوجد Cln3 بمستويات منخفضة وثابتة تقريبًا طوال دورة الخلية Cln2 ونشاط كيناز المرتبط به يكون في أقصى درجاته في البداية (Wittenberg وآخرون.، 1990 تايرز وآخرون.، 1993). يشبه نمط Clb5 نمط Cln2 (Schwob and Nasmyth ، 1993) ، في حين أن Clb2 ونشاط كيناز المرتبط به يبلغ ذروته ∼10 دقائق قبل الطور (Surana)وآخرون.، 1991). علاوة على ذلك ، يوجد Sic1 بتركيز عالٍ في G1 وينخفض ​​إلى مستويات منخفضة بعد البدء (Donovanوآخرون.، 1994 Schwob وآخرون., 1994).

في العديد من الكائنات حقيقية النواة ، يتم التحكم في نشاط Cdk أيضًا عن طريق الفسفرة المثبطة في التيروزين المحفوظ في الطرف N من الوحدة الفرعية للكيناز. على الرغم من أن الخميرة في مهدها تحتوي على بقايا التيروزين (Tyr-19 في Cdc28) والكيناز والفوسفاتاز (Swe1 و Mih1) اللذين ينظمان الفسفرة في هذا الموقع ، لا تلعب فسفرة التيروزين دورًا مهمًا في تنظيم أنشطة Cdk أثناء النمو الخضري الطبيعي (Amon وآخرون.، 1992 سورج وموراي ، 1992).

عوامل النسخ

التعبير عن CLN2 الجين (Koch وآخرون.، 1996) بواسطة عامل النسخ SBF (Swi4 / Swi6) (Nasmyth and Dirick ، ​​1991) ، والذي يمكن تنشيطه بواسطة جميع الكينازات الثلاثة المرتبطة بـ Cln وكذلك المرتبطة بـ Clb5 (Cross and Tinkelenberg ، 1991 Schwob and Nasmyth ، 1993) وتم تعطيله بواسطة كيناز المرتبط بـ Clb2 (Amon وآخرون.، 1993). عامل النسخ MBF (Mbp1 / Swi6) لملف CLB5يتم تنشيط الجين ، مثل SBF ، بواسطة كينازات Cln- و Clb5 المرتبطة (Koch وآخرون.، 1993 Schwob and Nasmyth ، 1993) ولكن تم تعطيله في G2 بواسطة آلية غير معروفة حتى الآن بخلاف Clb2 / Cdc28 كيناز (Amon وآخرون.، 1993). نسخ CLB2هو تحفيزي تلقائي ، لأن Clb2 / Cdc28 ينشط عامل النسخ الخاص به (Mcm1 / SFF) (Amon وآخرون.، 1993 ماهر وآخرون.، 1995). أخيرا، SIC1 النسخ ، الذي ينظمه Swi5 ، يبلغ ذروته في الطور (Knapp وآخرون.، 1996). يتم تعطيل Swi5 عن طريق الفسفرة المعتمدة على Clb2 ، مما يمنعه من دخول النواة (Nasmyth وآخرون.، 1990). من ناحية أخرى ، يتم تنشيطه بواسطة الفوسفاتاز ، Cdc14 ، والذي يتم تنشيطه بشكل غير مباشر بواسطة Cdc20 (Visintin وآخرون.، 1998 جاسبرسن وآخرون.، 1999) ، وهو بروتين مساعد لآلية التحلل المعتمدة على APC التي سيتم وصفها في القسم التالي.

تحلل البروتين

تتحلل جميع الأعاصير بواسطة البروتيازومات ، التي تدمر البروتينات التي تم تمييزها بواسطة يوبيكويتين. يتم تنفيذ علامات Ubiquitin بواسطة آلية إنزيمية معقدة تنشط جزيئات اليوبيكويتين ، وتتعرف على البروتينات المناسبة التي يجب تدميرها ، وتنقل اليوبيكويتين المنشط إلى هذه البروتينات المنكوبة (King وآخرون.، 1996 بيترز ، 1998 زكريا ونسميث ، 1999). بالنسبة للأعاصير ، يُعرف مجمعا بروتين يوبيكويتين المترافقين: APC و SCF. يتكون APC من عشرات البروتينات ، بما في ذلك Cdc16 و -23 و -27 (Zachariae وآخرون.، 1996). SCF هو مركب من Skp1 ، Cdc34 ، Cdc53 ، وبروتين يحتوي على صندوق F ، مثل Cdc4 أو Grr1 (Jackson ، 1996 Krek ، 1998). حاملة الجنود المدرعة مسؤولة عن تدمير Clb2 (Irniger وآخرون.، 1995) ، Clb5 (جزئيًا) (Irniger and Nasmyth ، 1997) ، Cdc20 (Shirayama وآخرون.، 1998) ، و Pds1 (Yamamoto وآخرون.، 1996) ، وهو بروتين يعزز تماسك الكروماتيدات الشقيقة حتى الطور. يعد SCF مسؤولاً عن تدمير Cln2 (Deshaies وآخرون.، 1995 فيليمس وآخرون.، 1996) ، Cln3 (Yaglom وآخرون.، 1995) ، و Sic1 (فيلدمان وآخرون.، 1997). لأن Clb5 أكثر استقرارًا فيskp1 المسوخات من الخلايا البرية (باي وآخرون.، 1996) ، قد يتحلل Clb5 جزئيًا بواسطة SCF.

يتطلب كل من APC و SCF بروتينات مساعدة ، وتتمثل مهمتها في التعرف على ركائز البروتين المناسبة وتقديمها إلى آلية اقتران اليوبيكويتين. على سبيل المثال ، يقدم Cdc4 Sic1 ، ويقدم Grr1 Cln2 و Cln3 إلى SCF (Barral وآخرون.، 1995 فيلدمان وآخرون.، 1997 Li and Johnston، 1997 Skowyraوآخرون.، 1997). بطريقة مماثلة ، يقدم Hct1 (يسمى أيضًا Cdh1) Clb2 ، ويقدم Cdc20 Pds1 و Clb5 إلى APC (Schwabوآخرون.، 1997 Visintin وآخرون., 1997).

يبدو أن SCF نشط في جميع الأوقات في دورة الخلية. يتم التحكم في تدهور البروتينات المستهدفة من خلال حالة الفسفرة للهدف (Willems وآخرون.، 1996). على سبيل المثال ، في المرحلة G1 ، يكون Sic1 غير فسفوري ومستقر ، على الرغم من أن SCF نشط. عندما يرتفع نشاط كيناز المرتبط بـ Cln2 في البداية ، يتم فسفرة Sic1 ، ويتم تقديم Sic1P سريعًا بواسطة Cdc4 إلى SCF من أجل التواجد في كل مكان وتحلل البروتين اللاحق (Verma وآخرون.، 1997). وبالمثل ، يجب فسفرة Cln2 قبل أن يتعرف عليه Grr1 (Barral وآخرون.، 1995 Li and Johnston ، 1997).

من ناحية أخرى ، يتم التحكم في تحلل البروتين المعتمد على APC عن طريق الفسفرة لآلية التواجد في كل مكان نفسها ، بدلاً من البروتينات المستهدفة. هناك أدلة في مستخلص البويضات البطلينوس (Lahav-Baratzوآخرون.، 1995 Sudakin وآخرون., 1995),Xenopus مستخلص البيض (فيليكس وآخرون.، 1990 بيترزوآخرون.، 1996) ، وخلايا الثدييات (Kotani وآخرون.، 1998) أن نواة APC يتم تنشيطها عن طريق الفسفرة وأن CDKs قد تشارك في هذا التنشيط بشكل غير مباشر عبر كيناز يشبه البولو (الذي يتماثل في الخميرة الناشئة هو Cdc5) (Descombes and Nigg ، 1998 Kotani وآخرون.، 1998). لكن مثل هذه التأثيرات لم يتم إثباتها جيدًا بعد في الخميرة الناشئة ، لذلك لا نحاول نمذجتها في هذه الورقة.

بدلاً من ذلك ، نركز على البروتينات المساعدة ، والتي يبدو أنها موجودة في أشكال نشطة وغير نشطة. بالنسبة لآلة التحلل المعتمدة على Hct1 ، أظهر Amon (1997) أنه ، في الجسم الحي ، يمكن إيقاف تحلل بروتين cyclin بالتعبير خارج الرحم عن Clb2 (والعودة مرة أخرى بالتعبير عن Sic1). التجارب الحديثة (زكريا وآخرون.، 1998 جاسبرسن وآخرون.، 1999) أنه في المختبر ، يمكن لـ CDKs فسفوريلات Hct1 ، مما يجعلها غير قادرة على التفاعل مع نواة APC. تؤكد هذه النتائج معًا فرضية Nasmyth (1996) القائلة بأن نشاط CDK وانحلال البروتين Clb هما حدثان معاديان: يعمل CDK على تعطيل APC عن طريق الفسفرة ، بينما يدمر APC نشاط CDK عن طريق تدهور مكونات cyclin. إن الفوسفاتاز الذي يقاوم CDK (وبالتالي ينشط Hct1) هو Cdc14. لاحظ أن زوج كيناز-فوسفاتيز ، CDK-Cdc14 ، لا ينظم نشاط Hct1 فحسب ، بل ينظم أيضًا تركيب (Swi5) وتدهور (حالة الفسفرة) لـ Sic1 (Visintin وآخرون.، 1998 جاسبرسن وآخرون., 1999).

لا تزال آلية التحلل المعتمدة على Cdc20 أكثر تعقيدًا. عندما تخرج الخلايا من الانقسام الفتيلي ، فإنها تكون مسؤولة عن تحلل Pds1 ، والذي يقيد تفكك التماسكات عن طريق الارتباط بـ Esp1 ، وهو بروتين ضروري لفصل الكروماتيد الشقيق (Ciosk). وآخرون.، 1998). Cdc20 مسؤول أيضًا عن فقدان مثبط لـ Cdc14 (Novak وآخرون.، 1999) ، مما أدى إلى تنشيط Hct1 و Swi5 (Visintin وآخرون.، 1997 ليم وآخرون.، 1998 شيراياما وآخرون.، 1998). مجمع RENT ، الذي تم تحديده مؤخرًا بواسطة Shou وآخرون. (1999) و Visintin وآخرون. (1999) ، قد يثبط Cdc14 عن طريق العزل القابل للعكس.

نقطة تفتيش ميتوتيك

لقد تم عرضه (Hwang وآخرون.، 1998) أن Cdc20 هو هدف محتمل لإشارات من الكروموسومات غير المحاذية ، والحمض النووي غير المكرر ، والحمض النووي التالف ، وكلها تحافظ على Cdc20 في شكله غير النشط. يبدو أن الحمض النووي غير المكرر ، بالإضافة إلى إبقاء Cdc20 غير نشط ، يؤثر أيضًا على مسار تنشيط APC (Hwang وآخرون.، 1998 كوتاني وآخرون.، 1998). والنتيجة النهائية هي أنه عندما يكتمل تكرار الحمض النووي وتكون جميع الكروموسومات في حالة توتر على لوحة الطور ، يتم فسفرة APC ويتم تنشيط Cdc20 ، مما يؤدي إلى تدهور Pds1 (وبالتالي ، انحلال التماسك) وتفعيل Hct1 (ومن ثم ، تدمير Clb2).


مناقشة

هنا ، قمنا بتحليل التفاعلات الجينية بين الطفرات في الجينات التي ترمز الوحدات الفرعية لـ OST والأليلات الخالية من SCJ1 و JEM1 الجينات التي ترمز إلى متماثلات البكتيرية المرافقة DnaJ. لاحظنا أن إجهاد طي البروتين الناجم عن ارتباط الهيبوجليكوزيل يسبب خللًا في النمو الصناعي في الخلايا التي لا تعبر عن Scj1p. الخلايا التي تفتقر إلى كل من Scj1p و Jem1p حساسة للغاية للارتباط بالجليكوزيل. توفر بياناتنا أول دليل مباشر على أن Scj1p و Jem1p يؤديان دورًا في طي البروتين في تجويف الخميرة ER.

يتم توفير نظرة ثاقبة لدور Scj1p كعامل مساعد تنظيمي لـ Kar2p في تجويف ER من خلال النظر في دورة التفاعل المعتمدة على التحلل المائي ATP لمتناظرات بدائيات النواة DnaJ و DnaK. يتم التحكم في تقارب مجال ربط الببتيد الخاص بـ DnaK لبولي ببتيدات الركيزة بواسطة دورة ATPase لـ DnaK ، والتي يتم تنظيمها بدورها بواسطة DnaJ و GrpE التي تحفز التحلل المائي ATP وتبادل الريبونوكليوتيد ، على التوالي (للمراجعات الأخيرة ، انظر Hartl، 1996 Bukau and Horwich. ، 1998). يربط التشكل المرتبط بـ ATP لـ DnaK ويطلق ركائز البولي ببتيد بسرعة ، في حين أن التشكل المرتبط بـ ADP لـ DnaK يربط الببتيدات بتقارب أعلى بسبب انخفاض معدل تفكك الببتيد. لقد ثبت أن متجانسات DnaJ حقيقية النواة تحفز نشاط ATPase الجوهري لبروتينات Hsp70 (Cyr et al. ، 1992 Braun et al. ، 1996 Schumacker et al. ، 1996) ومن ثم فمن المحتمل أن يحفز Scj1p نشاط ATPase لـ Kar2p. DnaJ قادر على ربط polypeptides غير المطوية وتسليم هذه الركائز إلى التشكل المرتبط بـ ATP لـ DnaK (Szabo et al. ، 1994). تم تعيين مجال ربط الركيزة لـ DnaJ إلى مجال يشبه إصبع الزنك يتم حفظه في العديد (Scj1p و Mdj1p و Ydj1p) ، ولكن ليس كل متماثلات DnaJ حقيقية النواة (Sec63p و Jem1p) (Szabo et al. ، 1996). إن الوجود في Scj1p للمجال الشبيه بإصبع الزنك الغني بالسيستين يجادل بقوة أن Scj1p يتعرف على عديد الببتيدات غير المطوية في تجويف ER ، ويبدأ تفاعلات قابلة للطي من خلال التعاون مع Kar2p. بعد التحلل المائي لـ ATP والتفكك بوساطة GrpE لـ ADP ، ينفصل متعدد الببتيد الركيزة عن DnaK ويستمر على طول مسار قابل للطي أو يرتد بدلاً من ذلك بواسطة DnaJ من أجل تفاعل دوري آخر مع DnaK

التفاعلات الجينية بين طفرات OST و ER Chaperone Mutants

ال ost1-6 الأليل الذي تم تحديده في شاشة الفتك التركيبي يشبه النمط الظاهري الآخر الموصوف سابقًا ost1 المسوخ (Silberstein et al. ، 1995). تمنح الطفرة في Ost1p نمطًا ظاهريًا للنمو حساسًا لدرجة الحرارة على الرغم من أن البروتينات السكرية الوليدة يتم تثبيطها في كل من درجات الحرارة المسموح بها والمقيدة. كما ذكرت سابقا لغيرها ost1 المسوخ (Silberstein et al. ، 1995) ، يتم تحفيز التعبير عن Kar2p في ost1-6 الخلايا في درجة حرارة متساهلة (Silberstein ، S. ، و R.Gilmore ، ملاحظة غير منشورة). بالنظر إلى دور السكريات القليلة المرتبطة بـ N في طي البروتين ، من المتوقع حدوث تفاعل وراثي اصطناعي لسلالات الخميرة التي بها عيوب في وحدة فرعية من OST وبروتين Kar2. في الواقع ، لوحظ نمط ظاهري بطيء النمو في كل حالة لسلالات متحولة مزدوجة تجمع بين أ wbp1 طفره (wbp1-1 أو wbp1-2) مع كار 2 طفره (kar2-1, كار -159 أو كار2-203 هيسن وأيبي ، 1994). هنا ، لاحظنا نمطًا ظاهريًا مميتًا اصطناعيًا لـ ost1-6kar2-159 متحولة مزدوجة.

عيب الارتباط بالجليكوزيل الناجم عن ost1-6 لا يضر بشدة بنمو السلالة الطافرة عند 25 درجة مئوية. ومع ذلك ، لم يتم التسامح مع فقدان Scj1p في ost1-6 الخلفية في أي درجة حرارة. على عكس كار 2 المسوخات المعيبة في مسارات متعددة مرتبطة بـ RER ، Δscj1 لا يوجد لدى المسوخ عيوب تم الإبلاغ عنها سابقًا في انتقال البروتين ، أو اندماج الغشاء النووي أثناء karyogamy ، أو طي البروتين ، أو مقاومة الصدمات الحرارية الشديدة. وبالتالي ، تم النظر في العديد من التفسيرات المختلفة لعدم قابلية وجود Δscj1ost1-6 متحولة. اكتشاف أن Δscj1ost1-6 متحولة قابلة للتطبيق على اللوحات التي تحتوي على عامل استقرار تناضحي يجادل بقوة ضد الخسارة الكارثية لمجمعات OST المجمعة بالكامل في Δscj1ost1-6 متحولة. كما Δscj1 المسوخات هي من النوع البري فيما يتعلق بربط البروتينات بالجليكوزيل المرتبط بـ N ، لا يمكن تفسير النمط الظاهري المميت للطفرة المزدوجة بسهولة من خلال التأثير الإضافي لآفتين في إضافة السكاريد القليل. التفاعلات القاتلة الاصطناعية من النوع الأخير تحدث عندما طفرة OST (على سبيل المثال ، wbp1-2) مع ملف alg (الارتباط بالجليكوزيل المرتبط بالأسباراجين) الذي يمنع تجميع مانح قليل السكاريد المرتبط بالدوليكول بالحجم الكامل من أجل الارتباط بالجليكوزيل (Stagljar et al. ، 1994).

للتحقيق في تأثير حذف Scj1p في سلالة قابلة للحياة مع وجود عيوب في الارتباط بالجليكوزيل ، قمنا ببناء Δost3Δscj1 متحولة. ال Δost3Δscj1 المتحولة تظهر عيبًا في النمو الصناعي ، دون إظهار انخفاض مصاحب في ارتباط البروتينات بالجليكوزيل ، مما يشير إلى أن Scj1p ليس له تأثير مباشر أو غير مباشر على كفاءة تفاعل الارتباط بالجليكوزيل. النمط الظاهري الأكثر تقييدًا لـ Δscj1ost1-6 متحولة قريب Δost3Δscj1 يشير mutant إلى أن متطلبات Scj1p تصبح أكبر مع زيادة شدة ارتباط نقص السكر في الدم.

دور لـ Scj1p في طي البروتين

بالنسبة للعديد من البروتينات التي تدخل المسار الإفرازي ، تعد إضافة السكريات القليلة المرتبطة بـ N تعديلًا مهمًا يسبق الاكتساب الناجح للهيكل الثلاثي. حتى تنثني البروتينات ، لا يتم تعبئتها في حويصلات للنقل داخل الخلايا ، ولكن بدلاً من ذلك يتم الاحتفاظ بها في الشبكة الإندوبلازمية. هنا ، لاحظنا أن معدل تصدير ER لشكل متحور من CPY يفتقر إلى السكريات القليلة المرتبطة بـ N قد انخفض إلى الضعف في الخلايا التي تفتقر إلى Scj1p. كان معدل النقل المخفض لـ unglycosylated-CPY في تناقض ملحوظ مع معدل النقل من النوع البري لـ CPY الكامل الغليكوزيلاتي في الخلايا التي تفتقر إلى Scj1p. يتم الاحتفاظ بالبروتينات التي تعاني من نقص في الطي في ER من خلال التفاعلات المطولة مع Hsp70 chaperone BiP أو Kar2p (De Silva et al. ، 1990). لوحظ سابقًا النضج البطيء لـ CPY غير الغليكوزيلاتي ، ولكن ليس CPY الكامل الغليكوزيلاتي. كار 2 المسوخ (te Heesen and Aebi ، 1994). تم إثبات وجود السلائف غير الجليكوزيلية (pug-CPY) في مجمع يحتوي على بروتينات متحولة Kar2p والتي كانت بها آفات في مجال ATPase (أي ، kar2-159 و كار2-203 هيسن وأيبي ، 1994). هنا ، لاحظنا وجود ارتباط طويل الأمد بين Kar2p و CPY غير الغليكوزيلاتي في الشبكة الإندوبلازمية. تشير نتائجنا إلى أنه بالإضافة إلى Kar2p ، فإن الطي الفعال لـ CPY غير الغليكوزيلاتي يتطلب تجانس DnaJ Scj1p. المصير الرئيسي للبروتينات القابلة للذوبان التي لا تنثني في الخميرة RER هو الخلع مرة أخرى إلى العصارة الخلوية من أجل التحلل اللاحق بواسطة البروتيازوم (Hiller et al. ، 1996). كما ورد سابقًا ، لا يبدو أن المسار التدهور قد تم اتخاذه بواسطة pug-CPY في الخلايا البرية (Winther et al. ، 1991). هنا ، لم نلاحظ خسارة انتقائية لـ pug-CPY أثناء حضانة المطاردة لمدة ساعة في سلالات متحولة تفتقر إلى Scj1p أو Jem1p. لم يكشف الفحص في المختبر عن التحلل البروتوزومي لعامل pro-α غير الغليكوزيلاتي عن دور مهم لـ Scj1p في تدهور هذه الركيزة (McCracken and Brodsky ، 1996).

يوفر النقل المتأخر لبروتينات نقص السكر في الدم إلى جدار الخلية التفسير الأكثر ترجيحًا للأنماط الظاهرية الاصطناعية التي تنشأ عندما Δscj1 جنبا إلى جنب مع الطفرات في OST. يتم توفير الدعم للاستنتاج الأخير من خلال الملاحظة التي Δscj1 الخلايا شديدة الحساسية للتونيكامايسين. في حالة عدم وجود طفرة OST ، Δscj1 تفتقر المسوخات إلى عيب واضح في جدار الخلية. ومع ذلك ، فإن عيب جدار الخلية Δost3 متحولة إلى حد كبير في سلالة الخميرة التي تفتقر إلى Scj1p. تم العثور على أن طي الـ CPY المخفض لـ DTT يتطلب Kar2p ، حيث تحمل السلالات كار 2 الأليلات ذات الطفرات التي ترسم في مجال ATPase (على سبيل المثال ، kar2-159) غير قادرة على تكوين روابط ثنائي كبريتيد أصلية في p1CPY بعد إزالة DTT مما أدى إلى تكوين مجاميع كتلة جزيئية عالية من Kar2p و p1CPY غير مطوي (Simons et al. ، 1995). لم نحصل على دليل على أن Scj1p كان مطلوبًا لنضج CPY بعد إجهاد الأكسدة والاختزال ، مما يشير إلى أن CPY المخفض لـ DTT قد يوجد كوسيط قابل للطي مضغوط يكتسب بسرعة التشكل الأصلي بعد إزالة الاختزال دون تدخل Scj1p. ومع ذلك ، لم يتم طي CPY unglycosylated بشكل صحيح في scj1Δjem1 متحولة بعد إجهاد الأكسدة والاختزال ، ولكن بدلاً من ذلك تم الاحتفاظ بها في الشبكة الإندوبلازمية. ومن المثير للاهتمام أننا لاحظنا ذلك Δost3Δscj1 الخلايا شديدة الحساسية لـ DTT ، مما يشير إلى أن Scj1p لا يعمل حصريًا أثناء طي البروتين السكري ، ولكن بدلاً من ذلك له دور أوسع في نضج البروتينات المعطلة القابلة للطي في RER.

بقاء الخميرة بدون Scj1p

كيف يمكننا حل التناقض الظاهر بين الحالة غير الأساسية لـ SCJ1 الجين والدور المفترض لـ Scj1p كعامل مساعد تنظيمي لبروتين Kar2 الأساسي أثناء طي البروتين في تجويف ER. يحفز مسار UPR التعبير المحسن عن مرافق RER وإنزيمات طي البروتين للسماح بالبقاء في ظل ظروف تتداخل مع طي البروتين في RER. ومن المثير للاهتمام أن مسار الاستعراض الدوري الشامل يمكن الاستغناء عنه من أجل بقاء الخلية في ظل ظروف النمو الطبيعية (كوكس وآخرون ، 1993). قد يكون أحد التفسيرات المحتملة للطبيعة غير الأساسية لـ Scj1p هو أن Scj1p يعمل فقط كوصيف عندما تتراكم البروتينات غير المطوية في RER. ومع ذلك ، وجدنا أن السلالات التي تفتقر إلى Scj1p تعبر عن مستويات مرتفعة من Kar2p و Jem1p في غياب الاضطرابات الأخرى ، مما يشير إلى أن فقدان Scj1p يسبب إجهاد طي البروتين في RER. نقترح أن Scj1p هو المساعد الأساسي لـ Kar2p في تفاعلات طي البروتين في ظل الظروف الفسيولوجية العادية.

تم اقتراح تفسير ثانٍ للطبيعة غير الأساسية لـ Scj1p من خلال وجود متماثل أساسي واحد واثنين من متماثلات DnaJ غير الأساسية في نفس الحجرة الخلوية مما يزيد من احتمال أن تؤدي هذه البروتينات وظائف زائدة عن الحاجة جزئيًا. يمكن استبعاد التكرار الوظيفي الكامل لـ Scj1p و Sec63p و Jem1p لعدة أسباب. من بين متماثلات DnaJ الثلاثة ، فقط Sec63p لديه التوطين الصحيح كمكون من مجمع Sec الكبير (Deshaies et al. ، 1991 Panzner et al. ، 1995) لتجنيد Kar2p في قناة نقل البروتين للتفاعل مع ركائز النقل (Brodsky and شيكمان ، 1993 كورسي وشكمان ، 1997). قبل هذا التقرير ، تم اقتراح تداخل جزئي لوظيفة Scj1p و Jem1p من خلال النمط الظاهري للنمو الحساس لدرجة الحرارة في scj1Δjem1 متحولة ومن خلال ملاحظة أن التعبير عن كلا البروتينين يتحكم فيه مسار UPR (Schlenstedt et al. ، 1995 Nishikawa and Endo ، 1997).

النمط الظاهري للنمو من النوع البري لـ Δscj1 يتم تفسير mutant بسهولة من خلال تحريض مسار UPR الذي يؤدي إلى تحسين التعبير عن مرافق RER بما في ذلك Kar2p و Lhs1p و Jem1p. يربط Kar2p عديد الببتيدات الوليدة عند دخولها تجويف ER عبر قناة Sec61 (Sanders et al. ، 1992) ، ومن ثم يتم توسط التفاعل الأولي بين البروتين غير المطوي و Kar2p بواسطة Sec63p (Corsi and Schekman ، 1997). بالنسبة للبروتينات البرية التي تطوي بسرعة ، قد يكون هذا التفاعل الأولي المستقل عن Scj1p بين Kar2p والأجزاء الكارهة للماء من البولي ببتيد الناشئ كافياً لبدء الطي المنتج في تجويف RER. في حالة عدم وجود طفرات أو اضطرابات تتداخل مع طي البروتين في RER ، قد يعوض التعبير المحسن عن Kar2p و Jem1p عن فقدان Scj1p. من المتصور ، قد يؤدي تركيز التجويف العالي لـ Kar2p إلى ارتباط Kar2p المستقل عن Scj1p بالبروتينات القابلة للطي ببطء في تجويف RER. علاوة على ذلك ، قمع النمط الظاهري للنمو الحساس لدرجة الحرارة لـ Δost3Δscj1 سلالة من نسخة عالية JEM1 يجادل البلازميد بقوة أن الحث بوساطة UPR لتعبير Jem1p سيساعد في التعويض عن فقدان Scj1p.

أدوار متداخلة ولكن غير متطابقة لـ Jem1p و Scj1p

كان تحريض تعبير Kar2p أكبر في Δscj1 متحولة مما كانت عليه في Δjem1 متحولة. بما يتوافق مع الانخفاض الطفيف نسبيًا في معدل النمو عند 37 درجة مئوية لـ Δost3Δjem1 متحولة ، لاحظنا ذلك Δjem1 خلايا الخميرة ليست شديدة الحساسية للتونيكامايسين وهي قادرة على نقل CPY غير الجليكوزيلاتي إلى الفجوة بمعدل من النوع البري. نستنتج أن جدوى Δscj1 لا يمكن تفسير الخلايا بشكل كافٍ من خلال التكرار الكامل لـ Scj1p و Jem1p. ومع ذلك ، تشير العديد من الملاحظات الواردة هنا إلى دور Jem1p في طي البروتين في RER. بالمقارنة مع Δjem1 متحولة scj1Δjem1 يظهر متحولة مزدوجة ارتفاعًا إضافيًا في تعبير Kar2p ، وتأخيرًا أكثر شدة في نقل ug-CPY إلى الفجوة. علاوة على ذلك ، فإن التعبير عن البروتين الضعيف القابل للطي (أي ug-CPY) في scj1Δjem1 يتداخل متحولة مزدوجة مع خروج ER من النوع البري الكامل الغليكوزيلاتي CPY مما يشير إلى أن قدرة طي البروتين في ER قد تم تجاوزها. من المثير للدهشة أن التعبير عن Jem1p من ناقل نسخة عالية يخفف إلى حد كبير عيب النمو الحساس لدرجة الحرارة في Δscj1Δost3 متحولة. قد يكون الإفراط في التعبير عن Jem1p قادرًا على تعويض فقدان Scj1p ، على الرغم من أن Jem1p يفتقر إلى المجال الغني بالسيستين المتورط في التعرف على الركيزة. هذه البيانات ، جنبًا إلى جنب مع ثبات ملف Δost3Δscj1 Δjem1 سلالة ، متوافقة مع Jem1p الذي يعمل كوصيف تنظيمي ثانٍ لطي البروتين بوساطة Kar2p في RER. على الرغم من أن Jem1p كان يُعتقد في البداية أنه بروتين غشائي متكامل من النوع الثاني (Nishikawa and Endo ، 1997) ، فقد أثبتت دراسة حديثة أن كود البدء لـ Jem1p قد تم تعيينه بشكل غير صحيح ، وأن Jem1p هو بروتين غشاء محيطي مرتبط بالوجه التجويفي. من الخميرة RER (Nishikawa and Endo ، 1998). من المتصور أن الدور الأساسي لـ Jem1p كوصيف قد يكون في تجنيد Kar2p (أو Lhs1p) للغشاء للتفاعل مع بروتينات الغشاء غير المطوية. وبالتالي ، قد لا تكون الركيزة القابلة للذوبان مثل proCPY غير الجليكوزيلات هي الركيزة المثلى للكشف عن تأخير الطي الناجم عن فقدان Jem1p.


نقاش

تلعب تفاعلات نقل الكربون الواحد بوساطة عوامل مساعدة حمض الفوليك دورًا أساسيًا في مجموعة متنوعة من التفاعلات الخلوية. على غرار البكتيريا والنباتات S. cerevisiae ينتج حمض الفوليك من بترين ، ص- شقوق أمينو بنزوات وغلوتامات. مسار تخليق حمض الفوليك في الخميرة غير مفهوم تمامًا. في هذا العمل أظهرنا أن S. cerevisiae FOL1 يقوم الجين بترميز الأنشطة الأنزيمية الأساسية DHNA و HPPK و DHPS ، والتي تؤدي ثلاث خطوات لاحقة في التخليق الحيوي للفولات. تشير بياناتنا إلى أن التخليق الحيوي لحامل C1 يبدو أنه يتم في الميتوكوندريا لأن Fol1p مترجم إلى نظام غشاء الميتوكوندريا. ومن المثير للاهتمام أن حذف FOL1 يؤدي إلى تحريض الفتيل ونمو المادة اللاصقة على الوسائط المكملة بحمض الفولينيك في وجود كميات زائدة من الجلوكوز والأمونيوم ، والتي تُعرف باسم مثبطات التبديل ثنائي الشكل. محرض النمو الغازية في ورقة 1& # x00394 سلالات تعتمد على عامل نسخ MAP كيناز Ste12p وكذلك على الالتصاق الرئيسي Flo11p. في الواقع ، يتم زيادة مستويات التعبير Flo11p بطريقة تعتمد على Ste12p في سلالات حيث FOL1 غائب. ومن المثير للاهتمام ، مع ذلك ، أن النمو الخيطي لوحظ في ورقة 1& # x00394 سلالات لا تعتمد على عوامل النسخ Ste12p و Tec1p و Phd1p وأيضًا لا تعتمد على Flo11p ، مما يشير إلى أنه في ورقة 1& # x00394 سلالات بعد آليات / مسارات / مواد لاصقة غير معروفة مطلوبة للنمو الكاذب.

يتم حفظ الطبيعة ثلاثية الوظائف لـ Fol1p في عملية التطور

تم العثور على الأنشطة الأنزيمية الثلاثة المختلفة التي يقوم بها Fol1p في معظم بدائيات النوى ، وحقيقيات النوى الميكروبية ، والنباتات ولكنها غائبة في الثدييات (الشكل 2). في معظم البكتيريا ، يتم ترميز أنشطة الإنزيم الثلاثة بواسطة ثلاثة ORFs مميزة (Slock وآخرون.، 1990 دالاس وآخرون.، 1992 Talarico وآخرون.، 1992 جاردين وآخرون.، 2002). ومع ذلك ، في بعض بدائيات النوى ، ترتبط الأنشطة الأنزيمية HPPK و DHNA كبروتين ثنائي الوظيفة ، بينما يتم ترميز DHPS بواسطة ORF منفصل (Lopez and Lacks ، 1993). في البكتيريا ، غالبًا ما تكون الجينات التي تشفر الإنزيمات المتتالية لمسار التخليق الحيوي متجاورة أو قريبة من بعضها البعض على الكروموسوم ، مما يشير إلى أنها منظمة بطريقة ما (جاردين) وآخرون., 2002 ).

في حقيقيات النوى ، كشف التحليل الكيميائي الحيوي لجينات التخليق الحيوي لحمض الفوليك المميزة حتى الآن أن البروتينات المقابلة لها دائمًا وظائف متعددة ، وتحتوي على أنشطة HPPK و DHPS مدمجة (Allegra وآخرون.، 1990 تريجليا وكومان ، 1994 ريبيلي وآخرون.، 1997) وأنشطة DHNA و HPPK و DHPS المدمجة (Volpe وآخرون.، 1992 ، 1995 هذا العمل). علاوة على ذلك في الخمائر S. بومبي و C. البيض توجد ORFs التي يمكن أن ترمز لبروتين مع التماثل لجميع أنشطة الإنزيم الثلاثة (الشكل 2). ومع ذلك ، في الفطريات الأخرى مثل ن. كراسا أو في الفطريات الممرضة للنبات ماغنابورثي جريسي ، يبدو أن بروتين HPPK / DHPS ثنائي الوظيفة منفصل عن نشاط DHNA. يبدو أن الطبيعة متعددة الوظائف لهذا البروتين شائعة في الأنواع الفطرية والنباتية ، ومع ذلك ، فإن مجموعة فرعية فقط من الفطريات تحتوي على بنية ثلاثية الوظائف. من غير الواضح ما إذا كانت الفطريات والنباتات الأخرى قد نقلت الجين الثالث لأن أحداث الاندماج الأولي قد حدثت أو ما إذا كان الاندماج ثلاثي الوظائف قد حدث لاحقًا في التطور في مجموعة فرعية فقط من الأنواع الفطرية. ما إذا كانت الأنشطة الأنزيمية تأتي من جين واحد أو عدة جينات تؤثر على كل من تنظيم التعبير الجيني وتوطين الإنزيمات (الشكل 2).

في الآونة الأخيرة ، تم استخدام إنزيمات حمض الفوليك التخليقية الحيوية لجذر شجرة حقيقية النواة. استخدم Stechmann and Cavalier-Smith (2002) اندماجًا جينيًا مشتقًا بين اختزال ثنائي هيدروفولات و thymidylate synthase من أجل تحديد موقع جذر شجرة حقيقية النواة بين bikonts و opisthokonts. ومع ذلك ، يجب توضيح موضع Amoebozoa قبل أن يتم تحديد الجذر بدقة. وبالتالي ، فإن تحليل التخليق الحيوي لحمض الفوليك وعلى وجه الخصوص أنشطة DHNA و HPPK و DHPS في Amoebozoa قد يشرع في إجراء مزيد من الدراسات فيما يتعلق بتحديد سلالات حقيقية النواة المتفرعة في وقت مبكر.

Fol1p ضروري للنمو

تظهر بياناتنا أن ملف FOL1 الجين ضروري ل S. cerevisiae دورة الحياة الخضرية ، و ورقة 1& # x00394 سلالات لا يمكن أن تبقى على قيد الحياة إلا بإضافة حمض الفولينيك. تم إظهار هذا أيضًا للحذف الجزئي للجزء C-terminal فقط من FOL1 ترميز الجين لنشاط DHPS (Bayly وآخرون.، 2001). تم الحصول على نتائج مماثلة ل FOL2 (ترميز GTP-cyclohydrolase I) و FOL3 (ترميز مركب ثنائي هيدروفولات نارديز وآخرون.، 1996 شيريست وآخرون.، 2000). حمض الفولينيك هو أحد مشتقات حمض الفوليك ، والذي يكمل تجمع الناقل C1 في موقع متميز عن DHF (Holmes and Appling ، 2002). لم نختبر ما إذا كانت مكملات ورقة 1& # x00394 سلالات مع حمض الفوليك يعيد النمو كما ورد في سلالات أخرى ناقص حمض الفوليك (Cherest وآخرون.، 2000 بيلي وآخرون.، 2001 Bayly and Macreadie، 2002). تبين حقيقة أن تجمع الفولات داخل الخلايا كان بالفعل يحد من النمو من خلال حقيقة أن معدل نمو ورقة 1& # x00394 سلالة تعتمد على كمية حمض الفولينيك خارج الخلية المضافة على الرغم من أنه لا يمكن ملاحظة النمو الشبيه بالوزن (الشكل 3 بيانات غير منشورة). علاوة على ذلك ، تشير حقيقة الحاجة إلى كميات كبيرة من حمض الفولينيك إلى أن خلية الخميرة ربما لا تمتلك نظام نقل امتصاص نشط لمشتقات حمض الفوليك.

النمط الظاهري النهائي لـ a FOL1 الحذف عبارة عن مستعمرة دقيقة من & # x0223c50 خلايا مستطيلة قليلاً تشير إلى أن تجمع الفولات في البوغ المشتق من سلالة حذف ثنائية الصبغة متغايرة الزيجوت كافٍ لعملية التبويض والتقسيمات الخلوية اللاحقة 5 & # x020136. يمكن تفسير هذا الطلب المنخفض جدًا على حمض الفوليك بحقيقة أنه يتم إعادة استخدام مادة كربون واحدة ولا يتم استهلاكها. نظرًا لعدم وجود استهلاك لمشتقات الفولات ، يمكن افتراض ذلك FOL1 التعبير الجيني منخفض. في الواقع القياس الكمي لل FOL1 نسخة وكذلك منطقتنا FOL1 كشفت دراسات المروج (بيانات غير منشورة) عن مستوى منخفض جدًا من الرنا المرسال (Planta وآخرون.، 1999). علاوة على ذلك ، يتم تنظيم تعبير Fol1p كما هو الحال في سلالات الوزن المزروعة في وجود حمض الفولينيك خارج الخلية FOL1 المحفز مكبوت (انظر الشكل 4 ج). بالإضافة إلى ذلك ، ينشط الجلوكوز تعبير Fol1p ، بينما ينتج عن المرحلة الثابتة قمع تعبير Fol1p (Planta وآخرون.، 1999). تشير هذه البيانات إلى تنظيم معقد لـ FOL1 التعبير الجيني ، مما يشير إلى أن مستوى البروتين Fol1 يتم تعديله بشكل مناسب لحالة المغذيات لخلية الخميرة.

من المثير للاهتمام أن التعبير المفرط القوي عن FOL1 سامة للخميرة (الشكل 4 أ) والبكتيريا (بيانات غير منشورة). تم الإبلاغ مؤخرًا عن علاقة عكسية بين FOL1 مستويات التعبير ومعدل نمو سلالات الخميرة المقابلة (Iliades وآخرون.، 2003). زيادة FOL1 يمكن أن يؤدي التعبير إلى إنتاج كميات زائدة من 7،8-dihydropteroate يستنفد تجمع GTP ، وهو أمر ضروري أيضًا لمسارات التخليق الحيوي الأخرى أو لأن الإفراط في إنتاج مركبات الفولات الوسيطة هذه يثبط الإنزيمات المعتمدة على الفولات المشابهة لعمل حمض الفولينيك (Girgis وآخرون.، 1997). بدلا من ذلك ، نمو FOL1 يمكن إعاقة سلالات الإفراط في التعبير لأن زيادة مستويات 7،8-dihydropteroate سامة لخلايا الخميرة (Bayly and Macreadie ، 2002).

يتم ترجمة Fol1p في نظام غشاء الميتوكوندريا

أظهر توطين بروتين الاندماج Fol1 في الجسم الحي نمطًا مشابهًا كما لوحظ في الميتوكوندريا (الشكل 5). أكد الفحص المجهري الإلكتروني توطين الميتوكوندريا لبروتين الانصهار GFP-Fol1 ، لأن أغشية الميتوكوندريا تم تمييزها بشكل حصري تقريبًا بواسطة جزيئات الذهب. ومع ذلك ، نظرًا لأن الإفراط في التعبير عن GFP-Fol1p أدى إلى ظهور الميتوكوندريا المتكتلة ، لم نتمكن من التمييز بين توطين الغشاء الداخلي والخارجي. تم أيضًا تحليل توطين Fol1p من خلال دراسات EM باستخدام الأجسام المضادة الببتيدية المضادة لـ Fol1p ولوحظ مرة أخرى تلطيخ سائد في أغشية الميتوكوندريا (الشكل 6 د).

ما هي الآثار المترتبة على توطين Fol1p المرتبط بغشاء الميتوكوندريا باعتباره المكون المركزي متعدد الوظائف لآلة التخليق الحيوي للفولات لإنتاج حمض الفوليك في S. cerevisiae؟ يحتوي كل من العصارة الخلوية والميتوكوندريا في الخميرة على أنزيمات مساعدة حمض الفوليك وكلا الجزأين يمتلكان مجموعة متوازية من الإنزيمات التي تحفز التحويل البيني لوحدات الفولات في حالات الأكسدة المختلفة (Appling، 1991 McNeil وآخرون.، 1996). استنادًا إلى بياناتنا ، يمكن التكهن الآن بأنه في التخليق الحيوي للخميرة للفولات يرتبط بالميتوكوندريا وأن 7،8-ثنائي هيدروبتروت (لا & # x003b3-غلوتامات بقايا) و / أو DHF / THF (1 & # x003b3- بقايا الجلوتامات انظر الشكل 1) إلى مصفوفة الميتوكوندريا وفي العصارة الخلوية حيث يمكن أن يحدث تحويلها إلى مشتقات oligo ذات الصلة من الناحية الفسيولوجية - & # x003b3-glutamyl. تم الإبلاغ مؤخرًا عن أن نشاط تخليق فوليجلوتامات الميتوكوندريا يتم ترميزه بواسطة MET7 (شيريست وآخرون.، 2000 DeSouza وآخرون., 2000 ).

بالإضافة إلى FOL1 لكونه ضروريًا للتخليق الحيوي لحمض الفوليك ، وجدنا أن فقدان FOL1 يضعف النمو في مصادر الكربون غير القابلة للتخمر (بيانات غير منشورة). وبالمثل ، فقد وجد أن فقدان نشاط اختزال ثنائي هيدروفولات (DHFR) يؤدي أيضًا إلى عدم قدرة طفرة الخميرة على النمو على الجلسرين (هوانغ). وآخرون.، 1992). تشير هذه البيانات إلى أن حامل C1 بشكل مباشر أو غير مباشر ضروري لوظيفة الميتوكوندريا.

يؤدي استنفاد أنزيم الفولات إلى النمو الكاذب وغزو الأجار

تظهر البيانات المقدمة هنا أن نمو أحادي العدد ورقة 1& # x00394 الخلايا الموجودة على الوسائط المكملة بحمض الفولينيك تؤدي إلى نمو خيطي والقدرة على الالتصاق بالأجار. النمط الظاهري بطيء النمو لـ a ورقة 1& # x00394 سلالة متحولة حتى في وجود كميات كبيرة من حمض الفولينيك تشير إلى أن تجويع الخلايا للوحدات الحاملة C1 يحث على التبديل ثنائي الشكل. ومن المثير للاهتمام أن كلا من النمو الخيطي وقدرة ورقة 1& # x00394 الخلايا للالتصاق الركيزة أجار يسبب وجود نسبة عالية من الجلوكوز والأمونيوم. وبالتالي ، تشير بياناتنا إلى أن المجاعة لحامل C1 هي إشارة غذائية أخرى تنشط النمو الخيطي واللاصق.

لاختبار ما إذا كان النمط الظاهري للنمو الغزوي الكاذب أحادي الصيغة الصبغية يعتمد على مسار كيناز MAP وعلى المادة اللاصقة الرئيسية Flo11p ، قمنا ببناء fol1 & # x00394 ste12 & # x00394، Fol1 & # x00394 tec1& # x00394 و fol1 & # x00394 flo11& # x00394 سلالات حذف مزدوج. Ste12p هو عامل النسخ في نهاية سلسلة MAP kinase ، والذي يرتبط مع Tec1p بما يسمى FREs (عناصر الخيوط واستجابة الغزو) في محفزات الجينات ، التي تشارك في التبديل ثنائي الشكل (Madhani and Fink ، 1998b). يوجد أحد عناصر FRE في محفز جين ترميز سطح الخلية floccullin FLO11، وهو أمر ضروري لتكوين الزائفة الكاذبة والغزو (Lo and Dranginis ، 1998). ال FLO11 المروج يدمج MAP kinase cascade ومسارات إشارات الفتيل cAMP / PKA (Pan and Heitman ، 1999 Rupp وآخرون.، 1999). لوحظ النمط الظاهري التصاق أجار ل ورقة 1& # x00394 خلايا تعتمد على عامل النسخ الخاص بـ MAPK Ste12p وعلى بروتين جدار الخلية Flo11p ولكن ليس على عامل النسخ Tec1p. والمثير للدهشة أن fol1 & # x00394 ste12 & # x00394، Fol1 & # x00394 tec1& # x00394 و fol1 & # x00394 flo11& # x00394 سلالات حذف مزدوج أظهرت نفس مدى النمو الخيطي مثل ورقة 1& # x00394 حذف فردي (الشكل 8). هذا يشير إلى أن إشارة الجوع الداخلية التي تم إنشاؤها بواسطة ورقة 1 يؤدي الحذف إلى نمو خيطي مستقل عن Ste12p و Tec1p. وفقًا لهذه النتيجة ، لم نتمكن أيضًا من اكتشاف مستوى الفسفرة المتزايد في كينازات MAP Kss1p و Fus3p ، مما يشير إلى أن Kss1p و Fus3p لم يتم تنشيطهما بشكل أساسي في ورقة 1& # x00394 سلالة الحذف. اختبرنا أيضًا عامل النسخ Phd1p ، والذي يُعتقد أنه يعمل بشكل مستقل عن مسارات كيناز cAMP و MAP (Palecek وآخرون.، 2002) ووجدت أن النمو الخيطي وكذلك الغازي ورقة 1& # x00394 خلايا لا تعتمد على Phd1p. يشير هذا إلى أن مسارات الإشارات الأخرى التي قد تعمل من خلال Flo8p أو بروتينات أخرى قد تكون ذات صلة بالنمو الخيطي كنتيجة لفقدان الناقل C1 وتحتاج إلى اختبار. وبالمثل ، تم العثور على flocullin Flo11p غير ضروري للنمو الخيطي للخلايا المحذوفة من أجل FOL1. تشير حقيقة أن Flo11p غير مطلوب للنمو الخيطي إلى أن الآليات الأخرى للالتصاق بالخلية الخلوية و / أو الحركية الخلوية ذات صلة بالنمط الظاهري للنمو الخيطي. يمكن أن يكون أحد هذه المرشحين هو الشكل 2p وهو مادة لاصقة خاصة بالتزاوج ، والتي عند الإفراط في التعبير يمكن أن تكمل جزئيًا فقدان الالتصاق الموجود في FLO11 سلالة متحولة (Guo وآخرون.، 2000). بدلاً من ذلك ، يمكن أن يؤدي عدم فصل الأم عن الابنة إلى زيادة التصاق الخلية الخلوية ، وقد لوحظ بالفعل وجود صلة بين نضج الحاجز والتصاق الخلية (Pan and Heitman ، 2000).

على عكس النمو الخيطي ورقة 1& # x00394 خلايا النمط الظاهري الالتصاق لـ ورقة 1& # x00394 سلالة متحولة كانت تعتمد على Ste12p و Flo11p ولكن ليس على Tec1p. لذلك اختبرنا ما إذا كان حذف FOL1 يعدل FLO11 نشاط المروج. في الواقع ورقة 1& # x00394 سلالات FLO11 تم تحسين نشاط المروج بطريقة تعتمد على Ste12p مقارنة بسلالات الوزن ، مما يدل على أن إشارة الجوع الداخلية الناتجة عن استنفاد الناقل C1 قادرة على تنشيط التعبير عن أهم الخلايا الخلوية اللاصقة flocculin. بشكل أكثر تحديدًا FLO11 تم تحفيز قطاعات المروج من -800 إلى -1200 و -2000 إلى -2400 عن طريق حذف FOL1. ومن المثير للاهتمام ، أنه تم الإبلاغ عن أن Ste12p يعمل على نفس الأجزاء من ملف FLO11 المروج (Rupp وآخرون.، 1999). ومع ذلك ، يتحكم Ste12p في الجزء الثالث من ملف FLO11 المروج الموجود في الموضع -1600 إلى -2000 ، والذي لم يتم تنشيطه في أ ورقة 1سلالة & # x00394. وبالتالي فإن بياناتنا تعني أن تفعيل FLO11 التعبير عن طريق حذف FOL1 يتضمن بعض وليس كل FLO11 عناصر المروج التي ينظمها مسار Ste12p.

تظهر بياناتنا أن حذف ملف FOL1 ينتج عن الجين نمو لاصق يعتمد على Ste12p و Flo11p ولكن نمو لاصق مستقل عن Tec1p و Phd1p ، في حين أن النمو الخيطي لـ ورقة 1& # x00394 سلالة لا تتطلب Ste12p ، Tec1 ، Phd1p ، ولا Flo11p. هذا السلوك من ورقة 1& # x00394 سلالة تشير إلى أن غزو أجار وفتيل ينتج عن إشارات مختلفة. تم تحديد السلالات التي تعزز غزو الأجار مؤخرًا في شاشة مصممة للعثور على المسوخات التي تظهر زيادة اجتياحية FLO11 تم التعبير عنها على مستوى منخفض بشكل أساسي. على وجه التحديد ، يمكن فصل غزو أجار أحادي الصيغة الصبغية ، والتلبد ، والغزو ثنائي الصيغة الصبغية ، والفتيل ثنائي الصبغة وراثيًا (Palecek وآخرون.، 2000). وهكذا ، على الرغم من تنظيم FLO11 يوفر النسخ آلية مهمة للتحكم في النمو الغازي ، FLO11 الانتفاخ ليس ضروريًا للنمو الباضع ولا يتم تحريضه بعد من قبل جميع الظروف التي تؤدي إلى التبديل ثنائي الشكل. واحد أو أكثر FLO11من المحتمل أن توجد آليات مستقلة للنمو الغازي (Palecek وآخرون.، 2000 روا وآخرون.، 2001). لقد تم اقتراح أن استجابة النمو الغازية يتم تشغيلها بواسطة العديد من المدخلات الفسيولوجية والوراثية المختلفة (Breitkreutz وآخرون.، 2003). وبالمثل ، تشير بياناتنا إلى وجود ملف FLO11- آلية (آليات) مستقلة تؤدي إلى ورقة 1& # x00394 الناجم عن النمو الكاذب.


متلازمة الأيض

متلازمة التمثيل الغذائي هي مصطلح يستخدم لتغليف مجموعة معقدة من الواسمات المرتبطة بزيادة خطر الإصابة بأمراض القلب. يتضمن الملف الشخصي (1) مقاومة الأنسولين وخلل التمثيل الغذائي للجلوكوز في خلايا العضلات (2) زيادة الدهون الثلاثية في مصل الدم (3) المستويات العالية من LDL ، وخاصة LDL الكثيف الصغير ، وهو أسوأ أنواع (4) المستويات المنخفضة من HDL (" الكولسترول الجيد) ومحتوى الكوليسترول المنخفض داخل جزيئات HDL الفردية (5) ارتفاع ضغط الدم و (6) السمنة ، وخاصة الدهون الزائدة في البطن. لقد جادلت سابقًا أن هذه المتلازمة ناتجة عن نظام غذائي غني بالكربوهيدرات الفارغة (خاصة الفركتوز) ومنخفض في الدهون والكوليسترول ، إلى جانب ضعف حالة فيتامين (د). 35 بينما ما زلت أعتقد أن كل هذه العوامل تساهم في المساهمة ، أود الآن إضافة عامل آخر: كبريتات غذائية غير كافية.

لقد وصفت في مقال سابق تفسيري للسمنة على أنها حالة مدفوعة بالحاجة إلى خلايا دهنية وفيرة لتحويل الجلوكوز إلى دهون لأن خلايا العضلات غير قادرة على استخدام الجلوكوز بكفاءة كوقود. مع نقص الكبريت يأتي الجواب عن سبب خلل في خلايا العضلات في إدارة الجلوكوز: لا يمكنهم الحصول على ما يكفي من كبريتات الكوليسترول لبذر طوافة الدهون اللازمة لاستيراد الجلوكوز.

هناك طريقة بديلة للتغلب على خلل التمثيل الغذائي للجلوكوز في خلية العضلات وهي ممارسة الرياضة بقوة ، بحيث يحفز AMPK المتولد (مؤشر لنقص الطاقة) GLUT4 على الانتقال إلى الغشاء حتى في حالة عدم وجود الأنسولين. 27 بمجرد أن يدخل الجلوكوز داخل خلية العضلات ، فإن آلية كبريتات الحديد التي تم وصفها للتو غير فعالة ، وذلك بسبب عدم وجود كبريتات الكوليسترول وعدم وجود بيروكسيد الهيدروجين. بالإضافة إلى ذلك ، مع ممارسة التمارين الرياضية المكثفة ، هناك أيضًا انخفاض في الإمداد بالأكسجين ، لذلك يجب معالجة الجلوكوز بشكل لاهوائي في السيتوبلازم لإنتاج اللاكتات. يتم إطلاق اللاكتات في مجرى الدم وشحنها إلى القلب والدماغ ، وكلاهما قادر على استخدامه كوقود. لكن غشاء الخلية يظل مستنزفًا في الكوليسترول ، وهذا يجعله عرضة للتلف التأكسدي في المستقبل.

هناك طريقة أخرى لتعويض خلل التمثيل الغذائي للجلوكوز في خلايا العضلات وهي زيادة الوزن. يجب أن تقوم الخلايا الدهنية الآن بتحويل الجلوكوز إلى دهون وإطلاقه في مجرى الدم على شكل دهون ثلاثية لتغذية خلايا العضلات. في سياق اتباع نظام غذائي منخفض الدهون ، يؤدي نقص الكبريت إلى تفاقم المشكلة. يتعارض نقص الكبريت مع أيض الجلوكوز ، لذلك فهو خيار أكثر صحة ببساطة لتجنب مصادر الجلوكوز (الكربوهيدرات) في النظام الغذائي ، أي اتباع نظام غذائي منخفض الكربوهيدرات. بعد ذلك ، يمكن للدهون الموجودة في النظام الغذائي أن تمد العضلات بالطاقة ، ولن تكون الخلايا الدهنية مثقلة بالحاجة إلى تخزين الكثير من الدهون الاحتياطية.

يمنع الأنسولين إفراز الدهون من الخلايا الدهنية. 32 وهذا يجبر الخلايا الدهنية على إغراق مجرى الدم بالدهون الثلاثية عندما تكون مستويات الأنسولين منخفضة ، أي بعد فترات طويلة من الصيام ، مثل بين عشية وضحاها. يجب أن تفرز الخلايا الدهنية ما يكفي من الدهون الثلاثية في مجرى الدم خلال فترات الصيام لتغذية العضلات عندما يحافظ الإمداد الغذائي من الكربوهيدرات على ارتفاع مستويات الأنسولين ، ويتم قمع إطلاق الدهون من الخلايا الدهنية. مع دخول الكربوهيدرات الغذائية ، ترتفع مستويات السكر في الدم بشكل كبير لأن خلايا العضلات لا تستطيع الاستفادة منها.

يعالج الكبد أيضًا الجلوكوز الزائد وتحويله إلى دهون ، ويجمعها في LDL ، لتزويد الخلايا العضلية المعيبة بالوقود. نظرًا لأن الكبد مشغول جدًا بمعالجة الجلوكوز والفركتوز إلى LDL ، فإنه يتخلف عن إنتاج HDL ، الكوليسترول "الجيد". وبالتالي فإن النتيجة هي ارتفاع مستويات LDL ، والدهون الثلاثية ، وسكر الدم ، وانخفاض مستويات HDL ، وهي أربعة مكونات رئيسية لمتلازمة التمثيل الغذائي.

يؤدي الوجود المزمن للجلوكوز والفركتوز الزائدين في مجرى الدم إلى مجموعة من المشاكل ، وكلها مرتبطة بتلف بروتينات مجرى الدم الناتج عن الجلوكوز نتيجة التعرض للجلوكوز. أحد البروتينات الرئيسية التي تتضرر هو البروتين الشحمي ، apoB ، المغلف في غشاء جسيمات LDL. يثبط apoB التالف قدرة LDL على توصيل محتوياته بكفاءة (الدهون والكوليسترول) إلى الأنسجة. تعود الخلايا الدهنية للإنقاذ مرة أخرى ، عن طريق تنظيف جزيئات LDL المكسورة (من خلال آلية لا تتطلب أن يكون apoB صحيًا) ، وتفكيكها واستخراج الكولسترول وتجديده. لكي تعمل بشكل صحيح ، يجب أن تحتوي الخلايا الدهنية على apoE سليم ، وهو مضاد للأكسدة ينظف الكوليسترول المؤكسد وينقله إلى غشاء الخلية لتوصيله إلى جزيئات HDL.


نتائج

تثبيط النمو في ظل ارتفاع NH44 + يرتبط بـ NH4 + انفجار ROS الزائد في شتلات الأرز

تحت العلاج المستمر مع ارتفاع NH44 + (20 ملم) لمدة 14 يومًا ، لوحظ تثبيط نمو كبير مقارنة بحالة التحكم (1 ملي مولار NH4 +) (الشكل 1 أ). كان التثبيط أكثر عمقًا في الجذور حيث أظهر انخفاضًا في الكتلة الحيوية يصل إلى 67٪ (الشكل 1 أ) وانخفضت نسبة الجذر / الجذع بشكل كبير من 0.5 تقريبًا إلى 0.2 (الشكل 1 ب). وفي الوقت نفسه ، فإن 7 و 5 أضعاف تركيزات أعلى من NH الحر4 + تم قياسها في الجذور والبراعم على التوالي (الشكل 1 ج). ومع ذلك ، فإن تثبيط قوي لنمو الجذر تحت NH عالية4 + كان الملحق قضية محددة جيدًا اجتذبت العديد من التحقيقات. تم بذل جهود على نطاق واسع لتوضيح الآليات الجزيئية المشاركة في تعديلات بنية الجذر استجابةً لتراكم تأثيرات الإجهاد طويلة الأجل نسبيًا (عدة أيام أو أطول) التي تعترضها NH عالية.4 + العلاجات. هنا للكشف عن ردود الفعل المبكرة المستجيبة التي يمكن أن تكون محفزًا للاستجابات التراكمية (تعديلات النمو) ، حالة فورية من NH الداخلي4 + يجب بالضرورة تحديد الفائض دون التسبب في تغيرات مرئية في نمو النبات (خاصة الجذور). لذلك ، L-methionine-D، L-sulfoximine (MSX) ، مثبط قوي لـ NH الأساسي4 + تم تطبيق مسار الاستيعاب بوساطة نشاط تركيبات الجلوتامين [35] (1 مم) لمدة 4 ساعات في وجود NH عالي4 + (20 ملم). بالنظر إلى السمية القوية لـ MSX ، تم اختبار الظروف المناسبة لاستخدام الدواء مسبقًا لتجنب الآثار المميتة التي تؤدي إلى خلل موت الخلايا المبرمج لمكونات الخلية. في الزراعة المائية لدينا ، يمكن أن ينتج عن حضانة لمدة 4 ساعات مع 1 ملي مولار MSX بشكل فعال NH حاد4 + الزائدة في كل من الجذور والبراعم 5-6 أضعاف ظروف التحكم دون أي ضرر مرئي لشتلات الأرز (الشكل 1 د). وبالتالي فإن الطريقة تسمح بمحاكاة أسرع خلال 4 ساعات ، NH "قابل للإشباع"4 + الظروف الزائدة داخل كل من الجذور والبراعم لمستويات مماثلة من العلاجات طويلة المدى (قارن الشكل 1 ج و أمبير د).

التحليلات البيولوجية والفسيولوجية لـ NH4 + الاستجابات الزائدة للأرز. تعرضت شتلات الأرز البالغة من العمر 7 أيام إلى NH44 + علاجات لمدة 14 د (أ-ج, ه). أ الكتل الحيوية الطازجة من الجذور والبراعم. ب نسب تصوير الجذر. ج NH مجاني4 + المحتوى و ه إجمالي محتوى ROS استجابة لـ NH4 + العلاجات. د NH الحاد4 + المحاكاة الزائدة عن طريق المعالجة مع NH العالي4 + لمدة 4 ساعات في وجود 1 مم MSX. كان عمر شتلات الأرز المستخدمة في هذه التجربة 10 أيام. القيم المشار إليها تعني ± SE لثلاث مكررات مستقلة. ** و *** يمثلان دلالات إحصائية عند p & lt0.01 و 0.001 على التوالي

تمشيا مع تراكم NH الحر4 + ، تمت ملاحظة اندفاعات من أنواع الأكسجين التفاعلية (ROS) (الشكل 1 هـ) ، مما يعني إمكانية حدوث تفاعلات مستحثة بـ ROS ناتجة عن NH الداخلي4 + فائض.

لإثبات مشاركة الأنواع المتطرفة في الاستجابة المبكرة لـ NH4 + الفائض ، أجرينا تلطيخًا كيميائيًا نسجيًا على التوالي DAB (3،3′-diaminobenzidine) و NBT (nitroblue tetrazolium) لتتبع حدوث H2ا2 و O2 - في الجذور حديثة الولادة والأوراق الثانية لنباتات الأرز المعالجة أعلاه. أظهرت النتائج أنه عند التعرض الحاد لارتفاع NH44 + ، تراكم كبير لـ H.2ا2 في كل من الأوراق والجذور تم الكشف عن تلطيخ ملون قوي (ملف إضافي 1 ، الشكل S1 ، a & amp b). تلاشت البقع بسهولة لتقترب من مستويات التحكم بعد تغذية 1 ٪ سكروز (ملف إضافي 1 ، الشكل S1 ، a & amp b) ، مما يشير إلى تراجع H2ا2 تنفجر إلى المستويات الطبيعية. تمشيا مع ملاحظة H.2ا2، NBT الملون O2 - أظهر تغييرات متشابهة إلى حد كبير (ملف إضافي 2 ، الشكل S2 ، a & amp b). أثارت هذه المجموعة من البيانات أسئلة مفادها أن انفجار ROS (ربما يكون مستقلاً عن الأنواع المكونة لها) كان خطوة بداية للسمية بوساطة NH4 + فائض. وبالتالي ، من المتوقع أن تحدث مجموعة من ردود الفعل أو الاستجابات المسببة لـ ROS كما هو موصوف على نطاق واسع لاستجابات الإجهاد اللاأحيائية. في الواقع ، وفقًا لقياسات محتويات الأحماض الأمينية الحرة (ملف إضافي 3 ، الشكل S3) ، ارتفاع NH4 + تسبب أيضًا في تراكم كبير للأحماض الأمينية الحرة في كل من الجذور والأوراق ، وهو ما يشبه الاستجابة الوقائية الشائعة للإجهاد أو إجهاد الملوحة.

تحليل RNA-Seq للتحديد الأولي للجينات المعدلة بواسطة NH4 + فائض

وفقًا للوصف أعلاه ، عولجت شتلات الأرز بارتفاع NH44 + في وجود 1 مم MSX لمدة 4 ساعات لإنشاء بيئة داخلية لـ NH4 + فائض. ثم تم إجراء تحليلات RNA-Seq للبحث عن استجابات جزيئية متعلقة بهذا الظرف. تم الحصول على 1077 و 1040 من الجينات المعبر عنها تفاضليًا (DEGs) على التوالي من الجذور والبراعم ، مع & gt 2 أضعاف التغييرات في مستويات النسخ الخاصة بهم (ملف إضافي 4). بناءً على تصنيف GO ، تنتمي هذه الجينات بشكل أساسي إلى "عملية التمثيل الغذائي" و "الوظيفة الجزيئية" و "الارتباط" و "العملية البيولوجية" (ملف إضافي 5). كشف تحليل مسار KEGG الإضافي عن إمكانية تورط الجينات المستجيبة (DEGs) في استجابة الإجهاد ، وتعديل التمثيل الضوئي ، واستقلاب الكربوهيدرات والأحماض الأمينية ، وإعداد مسارات إشارات الهرمونات وإعادة ضبط NH4 + النقل (ملف إضافي 6). تم تلخيص الجينات المنظمة بشكل كبير أدناه في إطار العمليات الرئيسية التي تشارك فيها.

تفعيل دورة GSH لكسح ROS

بعد NH الحاد4 + الزائد ودفعات ROS (الشكل 1 ج ، د ، هـ) ، كانت الاستجابة الأكثر بروزًا هي الحث القوي لجينات الجلوتاثيون S- ترانسانسز (GST) (الشكل 2). تم تنظيم أحد عشر جينًا من جينات GST بشكل نموذجي لـ & gt 7 أو حتى بعض عشرات إلى مئات أضعاف في كل من الجذور والبراعم (الشكل 2 أب ، الجينات رقم 1-11). من بين تلك GSTs ، كان OsGSTU4 (Os10g0528300 ، الشكل 2 أ ، الجين رقم 11) هو الأكثر استحثاثًا بشدة بواسطة & gt 300 و & gt 600 أضعاف في الجذور والبراعم على التوالي ، تليها جينات GST المفترضة (Os10g0481300 و Os10g0527800) التي تم تنظيمها بواسطة 50-100 أضعاف في كلا الجزأين. بينما أظهر Os10g0525500 (77 طية) و Os03g0785900 (90 ضعفًا) تحريضًا قويًا في الجذور والبراعم على التوالي (الشكل 2 أ ، ب). نظرًا لأن GSTs تحفز نقل الجذور الحرة للأكسيد الفائق إلى الجلوتاثيون الاختزالي (GSH) الذي يؤدي إلى إزالة السموم من المؤكسدات ، فإن هذه التغييرات في التعبير الجيني GST توفر مؤشرات على المشاركة الحاسمة لدورة GSH في تنظيف NH4 + الزائدة المستحثة ROS.

تحليلات التعبير الجيني لجينات الكسح ROS المستجيبة. أ تم توضيح الجينات المعبر عنها تفاضليًا التي تم الحصول عليها بواسطة RNA-Seq فيما يتعلق بالمسارات الرئيسية التي شاركوا فيها. تتوافق الأعمدة الملونة مع تغييرات طي النصوص كما هو موضح في تعريف التدرجات اللونية (أسفل). يمثل الرمز "+" وعمود التدرج الأحمر الجينات المنظمة وطيّة الاستقراء بينما يشير عمود التدرج الأخضر "-" وأعمدة التدرج الأخضر إلى الجينات الخاضعة للتنظيم السفلي. ب التحقق من صحة qRT-PCR لترميز الجينات المختارة عشوائيًا لأنظمة الكسح ROS. تم تطبيع مستويات التعبير النسبي ضد OsActin. كانت القيم المشار إليها وسيلة لثلاث مكررات مستقلة. تم شرح الجينات المستجيبة المرقمة على النحو التالي: 1. Os01g0949700 ، الجلوتاثيون المفترض S-transferase 2. Os03g0785900 ، الجلوتاثيون S-transferase GSTU1 3. Os01g0369700 ، الجلوتاثيون المفترض ترانسفيراز 4 4. Os01g0949800 ، الجلوتاثيون المفترض ، Os01g0949800 S- ترانسفيراز 6. Os10g0365200 ، جلوتاثيون S-ترانسفيراز 7. Os10g0527800 ، جلوتاثيون S-ترانسفيراز OsGSTU12 8. Os10g0481300 ، جلوتاثيون S-ترانسفيراز 9. Os10g0525500 ، جلوتاثيون S-ترانسفيراز بار سي 10. Os01g0372400 ، جلوتاثيون مفترض 2800 ، S-ترانسفير. الجلوتاثيون S-ترانسفيراز OsGSTU4 12. Os10g0415300 ، اختزال الجلوتاثيون 13. Os08g0557600 ، اختزال أحادي هيدرو أسكوربات 14. Os07g0638400 ، 1-Cys بيروكسيريدوكسين ب 15. Os05g0499300 ، بيروكسيداز 1 16.0 Os0 Osg06701300 ، بيروكسيداز 1 16.0 Osg06701300 ، بيروكسيداز 1 16.0 Osg06701300. الفئة الثالثة بيروكسيديز 27 19. Os03g0234900 ، الفئة الثالثة بيروكسيديز 39 20. Os03g0368000 ، الفئة الثالثة بيروكسيديز 42 21. Os06g0695300 ، الفئة الثالثة بيروكسيداز 92 22. Os07g0564500 ، نازعة هيدروجين NADH [EC: 1.6.99.3]

تمشيا مع الطلب المتزايد على خفض الطاقة ، تم تنظيم جين مفترض اختزال الجلوتاثيون (Os10g0415300) المسؤول عن توظيف GSH بشكل معتدل (

8 أضعاف) في الجذور وتعزز بقوة 70 أضعاف في البراعم (الشكل 2 أ). وفي الوقت نفسه ، تم تحفيز جين نازعة الهيدروجين NADH (Os07g0564500) بمقدار 127 ضعفًا في البراعم ، مما يعكس جزئيًا اقتران التنشيط وتقليل الطاقة مع تشغيل دورة GSH (الشكل 2 أ).

بالإضافة إلى التغييرات العميقة المتعلقة بدورة GSH ، تم قمع 7 جينات بيروكسيديز في الجذور بينما تم تحفيز الجين المفترض 1-Cys peroxiredoxin B (Os07g0638400) بشكل كبير في كلا الجذور (19 ضعفًا) والبراعم (179 ضعفًا) (الشكل 2 أ) ) ، المقابلة للأدوار المتناقضة للبيروكسيدات في الحفاظ على الانقسام / التوازن في ROS [36].

قمع مكونات التمثيل الضوئي والتنظيم المتناقض للطاقة المنتجة لعملية التمثيل الغذائي للكربوهيدرات

تشارك بروتينات ربط الكلوروفيل أ / ب لمجمعات حصاد الضوء (LHCs) ، والمعروفة أيضًا باسم بروتينات الهوائي ، في تجميع الطاقة الضوئية (الفوتونات) للتفاعل الأولي لعملية التمثيل الضوئي [37]. ثم يتم نقل الفوتونات والإلكترونات المحاصرة إلى مركز التفاعل لمزيد من التفاعلات الكيميائية الضوئية. من الواضح أن تعطيل هذه العمليات عن طريق التلف الضوئي أو مبيدات الأعشاب أو تراكم الجذور النشطة للغاية سيعوق تقدم عملية التمثيل الضوئي. بناءً على موجه (4 ساعات) NH4 + المعالجة الزائدة ، ترميز 6 جينات لبروتينات هوائي LHC (4 LHC II و 2 LHC I ، على التوالي) ، تم قمع جينات مركز تفاعل PS I و PS II بشكل متساوٍ تقريبًا بحوالي 5 أضعاف (الشكل 3) ، مما يشير إلى بداية الحد من كفاءات تجميع ونقل الفوتون. يمكن الافتراض بسهولة أن القمع الظاهر لعملية التمثيل الضوئي سوف يتراكم على طول تقدم NH4 + سيحدث الإجهاد الزائد وتثبيط النمو. وفي الوقت نفسه ، فإن ترميز Os12G0292400 لسلسلة صغيرة من Rubisco ، يحفز الإنزيم الرئيسي تثبيت / استيعاب ثاني أكسيد الكربون2، تم تخفيضه بواسطة

5 أضعاف (الشكل 3) ، مما يوفر مزيدًا من الدلائل على إنتاج الكربون الضوئي المعرض للخطر. لذلك ، مصنع NH4 + يبدأ الزائد وربما يطور أيضًا اضطراب التمثيل الضوئي عن طريق التدخل في التفاعل الأولي ودورة كالفين.

الجينات المستجيبة المشاركة في التمثيل الضوئي. تم توضيح الجينات المعبر عنها تفاضليًا التي تم الحصول عليها بواسطة RNA-Seq فيما يتعلق بالعمليات الرئيسية التي شاركت فيها. تتوافق الأعمدة الملونة مع تغييرات طي النصوص كما هو موضح في تعريف التدرجات اللونية (أسفل). يمثل الرمز "+" وعمود التدرج الأحمر الجينات المنظمة وطيّة الاستقراء بينما يشير عمود التدرج الأخضر "-" وأعمدة التدرج الأخضر إلى الجينات الخاضعة للتنظيم السفلي. تم شرح الجينات المستجيبة المرقمة على النحو التالي: 23. Os03g0592500 ، مركب حصاد الضوء II بروتين ربط الكلوروفيل أ / ب 2 (LHCB2) 24. Os07g0558400 ، مركب حصاد خفيف II كلوروفيل أ / ب بروتين ربط 4 (LHCB4) 25. Os01g0720500 ، مركب حصاد خفيف II كلوروفيل أ / ب بروتين رابط 1 (LHCB1) 26. Os09g0346500 ، مركب حصاد خفيف II بروتين ربط الكلوروفيل أ / ب 1 (LHCB1) 27. Os03g0333400 ، نظام ضوئي II بروتين Psb27 (psb27) 28. (Os08g0560900) النظام الضوئي 1 الوحدة الفرعية الثانية (psaD) 29. Os06g0320500 ، مركب حصاد الضوء 1 بروتين ربط الكلوروفيل أ / ب 1 (LHCA1) 30. Os02g0197600 ، مركب حصاد خفيف I كلوروفيل أ / ب بروتين رابط 3 (LHCA3) 31. Os12g0292400 ، السلسلة الصغيرة كربوكسيلاز الريبولوز ثنائي الفوسفات [EC: 4.1.1.39] (rbcS)

يتم تنشيط إنزيمات الكسح الجذري وتنشيطها بواسطة عمليات إنتاج ATP بما في ذلك تحلل السكر ومسارات TCA. ومع ذلك ، تم تنظيم العديد من الجينات المشاركة في تحلل السكر ودورة TCA بشكل متباين في الجذور والبراعم (الشكل 4). في الجذور ، ترميز الجينات لـ 2،3-bisphosphoglycerate-مستقل عن phosphoglycerate mutase (Os05g0482700، gene # 33) و fructose-bisphosphate aldolases (Os08g0120600، gene # 34 and Os01g0905800، gene # 35) من تحلل الجلايكولاتي 0،0905800 36) و malate dehydrogenase (Os05g0574400 ، الجين رقم 37) من دورة TCA تم تنظيمها بمقدار 6-10 أضعاف بعد 4 ساعات من NH4 + العلاجات الزائدة (الشكل 4 أ). وفي الوقت نفسه ، تم قمع الجينات المشاركة في انهيار الجليكوجين في الجذور (الشكل 4 أ): فوسفوينول بيروفات كاربوكسيكيناز (Os10g0204400 ، الجين رقم 32 ، - 19 ضعفًا) ، بيتا جلوكوزيداز (Os09g0491100 ، جين # 40 ، - 11 ضعفًا) ، بيتا جلوكوزيداز (Os02g013) ، foldgene # 41، –15 fold)، beta-D-xylosidase 4 (Os04g0640700، gene # 42، −7fold) - 11 أضعاف). على العكس من ذلك ، يمكن الإشارة إلى تحلل الجليكوجين / تحلل الجليكوجين المعزز في البراعم من خلال تنظيم الجينات ذات الصلة (الشكل 4 ب): الجلوكوز 6-فوسفات 1-ديهيدروجينيز (Os02g0600400 ، الجين # 39 ، + 5 أضعاف) ، بيروفوسفاتيز غير عضوي (Os05g0438500 ، جين # 49 ، + 18 أضعاف) ، فوسفوينول بيروفات كربوكسيكيناز (Os10g0204400 ، جين # 32 ، + 34 أضعاف) ، بيتا جلوكوزيداز (Os05g0366600 ، جين # 47 ، + 12 أضعاف) ، بيتا جلوكوزيداز (Os09g0511600 ، جين # 48 ، + 20 أضعاف). والجدير بالذكر أن جين البيروكسيلاز البيروفيت (Os05g0469600 ، الجين رقم 38) لتحلل السكر ، قد تم تحريضه على وجه التحديد في البراعم (الشكل 4 ب). بالإضافة إلى ذلك ، تم إحداث جينين Os06g0222100 و Os08g0445700 لترميز تريهالوز 6-فوسفات سينثاز / فسفاتازات بواسطة 15 و 13 ضعفًا على التوالي في الجذور (الشكل 4 أ ، الجينات رقم 45 ، 46) ، مما يشير إلى تعزيز التخليق الحيوي لـ "مادة البقاء" [32) ] طرهالوز الناجم عن NH4 + الإجهاد الزائد.

الجينات المستجيبة المشاركة في استقلاب الكربوهيدرات في الجذور (أ) ويطلق النار (ب). تم توضيح الجينات المعبر عنها تفاضليًا التي تم الحصول عليها بواسطة RNA-Seq فيما يتعلق بالعمليات الرئيسية التي شاركت فيها. تتوافق الأعمدة الملونة مع تغييرات طي النصوص كما هو موضح في تعريف التدرجات اللونية (أسفل). يمثل الرمز "+" وأعمدة التدرج الأحمر الجينات المنظمة وطيّة الاستقراء بينما يشير "- "وعمود التدرج الأخضر إلى الجينات الخاضعة للتنظيم السفلي. تم شرح الجينات المستجيبة المرقمة على النحو التالي: 32. Os10g0204400 ، phosphoenolpyruvate carboxykinase (ATP) [EC: 4.1.1.49] (pckA) 33. Os05g0482700 ، 2،3-bisphosphoglycerate-مستقل mutase فسفوغليسيرات [EC: 5.4mI.12] 34. Os08g0120600 ، ألدولاز الفركتوز - ثنائي الفوسفات ، الفئة الأولى [EC: 4.1.2.13] (ALDO) 35. Os01g0905800 ، ألدولاز الفركتوز ثنائي الفوسفات ، الفئة الأولى [EC: 4.1.2.13] (ALDO) 36. Os05g0573200 ، نازعة هيدروجين الإيزوسيترات [EC: 4.1.2.13] (ALDO) : 1.1.1.42] (IDH) 37. Os05g0574400 ، مالات ديهيدروجينيز [EC: 1.1.1.37] (MDH2) 38. Os05g0469600 ، بيروفيت ديكاربوكسيلاز [EC: 4.1.1.1] 39. Os02g0600400 ، جلوكوز-6-فوسفات 1-ديهيدروجينيز [ EC: 1.1.1.49] (G6PD) 40. Os09g0491100 ، بيتا جلوكوزيداز [EC: 3.2.1.21] 41. Os02g0131400 ، بيتا جلوكوزيداز [EC: 3.2.1.21] 42. Os04g0640700 ، beta-D-xylosidase 4 [EC: 3.2.1.37] (XYL4) 43. Os03g0401300 ، سينثاز السكروز [EC: 2.4.1.13] 44. Os02g0106100 ، بيتا فروكتوفورانوسيداز [EC: 3.2.1.26] (sacA) 45. Os08g0445700 ، تريهالوز 6-فوسفات سينثيز [EC / فوسفاتيز : 2.4.1.15 3.1.3.12] ( TPS) 46. Os06g0222100 ، تريهالوز 6-فوسفاتيز [EC: 3.1.3.12] (otsB) 47. Os05g0366600 ، بيتا جلوكوزيداز [EC: 3.2.1.21] 48.Os09g0511600 ، بيتا جلوكوزيداز [EC: 3.2.1.21] ، 49. Os05g0438500 ، بيروفوسفاتيز غير عضوي [EC: 3.6.1.1]

تغذية السكروز يخفف NH4 + ردود الإجهاد الزائدة

كشفت التحليلات أعلاه ردود محبطة إلى حد ما على NH4 + الإجهاد الزائد في نبات الأرز المرتبط ارتباطًا وثيقًا باستهلاك الكربوهيدرات للطلب على الطاقة. ومن ثم يمكن أن تؤدي ندرة السكر بشكل تراكمي (إلى دورة زمنية أطول) إلى تثبيط النمو. لاختبار هذه الفرضية ، قمنا بإطعام 1 ٪ من السكروز كتعويض للسكر إلى NH المرتفع4 + (20 ملم) الزراعة المائية لمدة 24 ساعة. عوض هذا العلاج استهلاك السكروز عند ارتفاع NH44 + وسمح لمحتويات السكروز في الجذور والبراعم باستعادة المستويات المكافئة لعنصر التحكم (1 ملي مولار NH4 +) الشروط (الشكل 5 أ). زادت معالجات تغذية السكروز من NH الحر4 + محتويات في الجذور ، لكنها قللت بشكل ملحوظ NH4 + تراكم البراعم (الشكل 5 ب).

آثار تغذية السكروز على NH4 + عمليات التراكم والاستيعاب والاستيعاب. خضعت الشتلات التي يبلغ عمرها 10 أيام للسيطرة (1 ملي مولار NH4 +) ، NH عالية4 + (20 ملم) أو NH عالية4 + + سوك (20 ملي مولار NH4 + + 1٪ سكروز) علاجات لمدة 24 ساعة. أ محتوى السكروز ، ب NH مجاني4 + محتوى ، ج ملفات تعريف التعبير لـ OsAMT11 و OsAMT12 و OsAMT13 المحددة بواسطة qRT-PCR ، د نشاط إنزيم GS ، ه نشاط إنزيم GOGAT. كانت البيانات تعني ± SE لثلاث مكررات مستقلة. تمثل الحروف على القضبان دلالات إحصائية

تحت NH عالية4 + الشروط ، مستويات التعبير عن 3 جينات AMT1 (OsAMT11–Os04g0509600 ، OsAMT12–Os02G0620500 و OsAMT13–Os02G0620600) على التوالي بمقدار 3 و 67 و 6 أضعاف في الجذور ، مما يعني انخفاضًا في NH44 + نشاط الاستيعاب. مع إضافة السكروز (1٪) إلى NH العالي4 + الزراعة المائية (الشكل 5 ج) ، تمت استعادة مستويات تعبيرها لتقترب من المستويات "الطبيعية" (عند 1 ملي مولار NH4 +) .. هذا يعني إطلاق نشاط نقل الأمونيوم من قمع NH44 + الفائض ، وبالتالي ساهم في تعزيز NH4 + تراكم في الجذور تحت NH العالي4 + حالة السكروز. في حين أن NH المجاني المخفض4 + يشير المحتوى تحت نفس الحالة في البراعم إلى الاستخدام الفعال لـ NH4 + عند إضافة السكروز (الشكل 5 ب). وفي الوقت نفسه ، تم تعزيز أنشطة GS (الشكل 5 د) و GOGAT (الشكل 5 هـ) على التوالي بنسبة 17٪ (GS) و 29٪ (GOGAT) في الجذور بعد معاملات التغذية بالسكروز ، مما يشير إلى استعادة NH4 + أنشطة الاستيعاب من القمع الأولي بواسطة NH4 + فائض.

عند تعويض مصدر السكروز ، تم خفض إجمالي محتويات ROS في كل من الجذور والبراعم بنسبة 20-30٪ ، بالقرب من المستويات المحددة عند التحكم (1 ملي مولار NH4 +) الشروط (الشكل 6 أ). وفقًا لذلك ، تم تقليل محتوى GSH ونشاط GST بشكل كبير إلى المستويات الأولية (عند 1 ملي مولار NH4 +) ، لم يعد يُظهر تحريض قوي بواسطة NH4 + فائض (الشكل 6 ب ، ج). بشكل غير متوقع ، لم يلاحظ أي تغييرات كبيرة مع أنشطة إنزيمات الدفاع الكلاسيكية CAT و POD و SOD تحت أي علاج (الشكل 6 د ، هـ ، و). جنبًا إلى جنب مع تحليلات التعبير الجيني (الشكل 2) ، أظهرت نتائجنا أن تنشيط مسار تقليل GSH ربما يكون استجابة مميزة للأرز في التعامل مع NH4 + الفائض وتراكم ROS. أخيرًا ، تمشيا مع المستوى المنخفض لـ ROS ، تم رفع نشاط Rubisco بنسبة 24 ٪ (مقارنة مع NH العالي4 +) في البراعم مع وجود تغذية السكروز (الشكل 6g) ، مما يشير إلى زيادة كفاءة ثاني أكسيد الكربون الأولي2 نشاط التثبيت.

آثار تغذية السكروز على تراكم ROS وأنزيمات الكسح ROS وأنشطة Rubisco. خضعت الشتلات التي يبلغ عمرها 14 يوم للسيطرة (1 ملي مولار NH4 +) ، NH عالية4 + (20 ملم) أو NH عالية4 + + سوك (20 ملي مولار NH4 + + 1٪ سكروز) علاج لمدة 24 ساعة. أ إجمالي تراكم ROS ممثلة بدرجات الفلورة ، ب محتوى GSH ، ج-ز فحوصات نشاط الإنزيمات لـ ج ضريبة السلع والخدمات ، د قط، ه جراب، F SOD و ز روبيسكو. كانت الظروف التجريبية هي نفسها كما هو موضح في الشكل 5. تم التعبير عن البيانات كوسائل ± SE لثلاث مكررات مستقلة. تمثل الحروف على القضبان دلالات إحصائية

مجتمعة ، أشارت هذه المجموعة من التجارب إلى أن تغذية السكروز يمكن أن تخفف بشكل فعال نبات الأرز من ندرة الكربون الناتجة عن NH الداخلي.4 + ضغوط الزائدة و ROS.


النتائج

هناك نوعان من ملفات تعريف mRNA المتعلقة بـ Pbodies بعد تجويع الجلوكوز

من أجل فحص ومتابعة توطين mRNAs محددة في العيش S. cerevisiae الخلايا ، استخدمنا نظام mTAG Haim et al. ، 2007. تم تقديم شرح مفصل لهذه التقنية في مكان آخر HaimVilmovsky and Gerst ، 2009 ، ومع ذلك ، باختصار ، يتم تمييز النسخة الجينومية من تسلسل mRNA داخل 3UTR مع حلقات جذعية MS2 . يسمح هذا بتصور mRNA عبر تعايش بروتين طبقة MS2 المنصهر في ثلاثة بروتينات فلورية خضراء CPGFP3. تم استخدام هذه الأنظمة على نطاق واسع لفحص توطين mRNAs في مجموعة واسعة من الأنظمة البيولوجية Haim et al.، 2007 Hamada et al.، 2003 Sheth and Parker، 2006. تتمثل المزايا الرئيسية لنظام الخميرة هذا في أن عناصر التحكم المرتبطة بـ تظل محفزات نسخ ومعالجة mRNA و UTRs ومواقع polyA والنهايات سليمة ، حيث يتم إدخال مواقع ربط MS2 بشكل مباشر ودقيق في 3UTR للجين الداخلي في موضعه الكروموسومي Haim et al. ، 2007. أحد القيود المحتملة لهذا النهج هو أنه يمكن أن يؤدي إدخال الحلقات الجذعية MS2 إلى تغيير جوانب سلوك mRNA ومع ذلك ، تم تقييم عدد من mRNAs وظيفيًا بعد إدخال MS2 ووجد أنها غير متأثرة Haim et al. ، 2007. وبالتالي ، باستخدام هذا النظام ، تم توطين يمكن تقييم mRNA في الخلايا الحية ، مما يسمح بتقييم الاستجابات لتغيير الإشارات الخارجية.

في البداية ، قمنا بتمييز العديد من متواليات mRNA باستخدام حلقات جذعية MS2 تم اختيار هذه mRNAs لأنها وفيرة للغاية وترتبط منتجات البروتين بمجموعة متنوعة من المواد التكميلية من الجدول S1. يمكن توقع أن إضافة حلقات جذعية MS2 ستزيد من استقرار الرنا المرسال ، ومع ذلك ، أظهرت معظم السلالات الناتجة اختلافًا طفيفًا في مستوى التعبير عن الرنا المرسال الموسوم بعلامة MS2 بالنسبة إلى مستوى الرنا المرسال غير الموسوم في سلالات النوع البري كما تم الحكم عليه من خلال النسخ العكسي الكمي qRTPCR. مستويات PGK1 و RPS16A انخفض الرنا المرسال بالفعل مع إضافة المواد التكميلية لتسلسل MS2 الشكل S1. من غير الواضح حاليًا كيف يحدث هذا الانخفاض في مستوى الرنا المرسال. ومع ذلك ، فإن مستويات mRNAs الموسومة بعلامة MS2 التي يتم اختبارها إما من النوع البري أو أقل من هذا. احتوت سلالات mRNA الموسومة بـ MS2 أيضًا على علامات بروتين الفلورسنت Dcp2pcyan CFP و Cdc33pred RFP. Dcp2p هي الوحدة الفرعية المحفزة لإنزيم decapping وتعمل كعلامة لـ Pbodies ، بينما Cdc33p هو عامل بدء ترجمة eIF4E الذي يربط غطاء mRNA ويدخل كل من حبيبات الإجهاد Pbodies و EGPbodies. لذلك ، في هذه السلالات ذات العلامات ، نحدد أجسام EGPbodies على أنها إيواء eIF4E ولكن ليس علامة Pbody Dcp2p.

منذ البداية ، كان من الواضح أن mRNAs تندرج في فئتين من توطين mRNA. تتميز الفئة الأولى من mRNA التي تمت ملاحظتها باستخدام نظام mTAG بـ mRNAs التي تم تحديد موقعها مع علامة Pbody Dcp2CFP في وقت مبكر بعد تشكل Pbodies ، أي بعد 10 دقائق من جوع الجلوكوز الشكل 1. لم تظهر هذه الرنا المرسال أيضًا أي زيادة حقيقية في مستوى ارتباط الجسم من 10 إلى 50 دقيقة بعد تجويع الجلوكوز. علاوة على ذلك ، كان هناك القليل من الأدلة على أن هذه الرنا المرسال تراكمت في حبيبات تحتوي على eIF4E لكنها تفتقر إلى Dcp2p ، أي حبيبات الإجهاد الجسيم. كشف فحص توطين هذه الرنا المرسال في ظل ظروف عدم الإجهاد أنها كانت موجودة هنا أيضًا في مادة حبيبات الرنا المرسال التكميلية الشكل S2. في ظل ظروف عدم الإجهاد هذه ، لا تظهر مكونات تحلل الرنا المرسال ولا عوامل بدء الترجمة أي توطين حبيبي Hoyle et al. ، 2007 والبيانات غير معروضة. سيتم نشر توصيف تفصيلي وتحليل وظيفي لحبيبات الرنا المرسال الموجودة في الخلايا المتنامية بشكل أسي في مكان آخر. في هذه الدراسة الحالية ، ركزنا على توطين mRNAs إلى Pbodies وحبيبات الإجهاد ، وهذه الفئة من mRNA تدخل Pbodies في وقت مبكر بعد تكوينها. اثنان من هذه mRNAs ، RPS16A و RPS23B، ترميز بروتينات الريبوسوم. يتفق الاستهداف السريع للـ mRNAs الذي يشفر البروتينات الريبوزومية إلى Pbodies ، على الأرجح للتحلل ، مع الأبحاث السابقة التي تظهر أن هذه mRNAs تتضاءل بسرعة في polysomes بعد تجويع الجلوكوز Arribere وآخرون ، 2011. مرنا آخر في هذه الفئة هو PGK1، الذي يشفر إنزيم فوسفوجليسيرات كيناز. في السابق ، باستخدام استراتيجية تحديد موقع mRNA المستندة إلى plasmidU1A ، أظهرنا أن PGK1 مرنا جزئيًا مع eIF4E في حبيبات Hoyle et al. ، 2007. هنا ، باستخدام نظام mTAG في السلالات حيث يمكن تصور كل من eIF4E و Dcp2p في وقت واحد ، قررنا أن PGK1الحبيبات التي تحتوي على mRNA هي أجسام Pbodies تحتوي أيضًا على eIF4E الشكل 1. بشكل عام ، هذه الفئة الأولى من mRNA موجودة في وقت مبكر في Pbodies ولا يتم توطينها في حبيبات EGPbodiesstress.

توجد جزيئات mRNAs في المراحل المبكرة في Pbodies في وقت مبكر بعد استنفاد الجلوكوز. صور مجهرية مضان لخلايا الخميرة في نقطتين زمنيتين مختلفتين بعد استنفاد الجلوكوز. ال RPS16A, RPS23B و PGK1 يتم اتباع mRNAs باستخدام نظام mTAG MS2GFP ، ويتم اتباع مكونات تحلل mRNA باستخدام CFPtagged Dcp2p ويتم اتباع مكونات مجمع الحلقة المغلقة باستخدام RFPtagged eIF4E عبر نفس الخلايا. تصور الصور الملونة المتراكبة الداخلية بعد 50 دقيقة من استنفاد الجلوكوز أمثلة حيث تتجمع الرنا المرسال مع مثلثات Pbodies الصفراء ولكن ليس بأجسام EGPbodies بيضاء. تمثل الرسوم البيانية إلى اليمين النسبة المئوية للأجسام Pbodies أو EGPbodies التي تؤوي كل mRNA بعد 10 دقائق من الأشرطة البيضاء و 50 دقيقة من الأشرطة الرمادية لنضوب الجلوكوز. أشرطة مقياس 5 م.

توجد جزيئات mRNAs في المراحل المبكرة في Pbodies في وقت مبكر بعد استنفاد الجلوكوز. صور مجهرية مضان لخلايا الخميرة في نقطتين زمنيتين مختلفتين بعد استنفاد الجلوكوز. ال RPS16A, RPS23B و PGK1 يتم اتباع mRNAs باستخدام نظام mTAG MS2GFP ، ويتم اتباع مكونات تحلل mRNA باستخدام CFPtagged Dcp2p ويتم اتباع مكونات مجمع الحلقة المغلقة باستخدام RFPtagged eIF4E عبر نفس الخلايا. تصور الصور الملونة المتراكبة بعد 50 دقيقة من استنفاد الجلوكوز أمثلة حيث تتجمع جزيئات الرنا المرسال مع مثلثات Pbodies الصفراء ولكن ليس بأجسام EGPbodies بيضاء. تمثل الرسوم البيانية إلى اليمين النسبة المئوية للأجسام Pbodies أو EGPbodies التي تؤوي كل mRNA بعد 10 دقائق من الأشرطة البيضاء و 50 دقيقة من الأشرطة الرمادية لنضوب الجلوكوز. أشرطة مقياس 5 م.

حددنا أيضًا فئة ثانية من الرنا المرسال تعرض حركيات توطين مختلفة. تم إلغاء تحديد موقع mRNAs في ظل ظروف خالية من الإجهاد للمواد التكميلية الشكل S2 وبعد 10 دقائق من استنفاد الجلوكوز في الوقت الذي تكونت فيه الأجسام Pbodies بالفعل ، وفقًا لتوطين Dcp2pCFP الشكل 2. لذلك ، في هذه المرحلة المبكرة ، تفتقر غالبية Pbodies إلى mRNA الموسومة. ومع ذلك ، بعد 50 دقيقة من تجويع الجلوكوز ، حدث توطين هذه الرنا المرسال إلى أجسام الشكل 2. بالنسبة للفئة المبكرة من الرنا المرسال ، هناك القليل من الأدلة على أن هذه الرنا المرسال تراكمت في حبيبات تؤوي eIF4E ولكنها تفتقر إلى Dcp2p ، أي حبيبات الإجهاد الجسيمي. وبالتالي ، يبدو أن هذه الفئة الثانية من الرنا المرسال تتم ترجمتها إلى Pbodies على مدى فترة طويلة بعد الإجهاد ، ولا تتمركز في حبيبات إجهاد EGPbodies.

تدخل mRNAs Latephase Pbodies بعد فترة طويلة من الجوع الجلوكوز. كما في الشكل 1 ، فيما يلي برنامج SPG4, SUE1, VNX1, TDP1 و سعر التجزئة الموصى به 43 مرنا بالنسبة لاضمحلال mRNA والمكونات المعقدة الحلقة المغلقة. تصور الصور الملونة المتراكبة الداخلية بعد 50 دقيقة من استنفاد الجلوكوز أمثلة حيث تتجمع الرنا المرسال مع مثلثات Pbodies الصفراء ولكن ليس بأجسام EGPbodies بيضاء. توضح الرسوم البيانية إلى اليمين أن النسبة المئوية للأجسام التي تؤوي كل مرنا تزداد من 10 دقائق من الأشرطة البيضاء إلى 50 دقيقة من الأشرطة الرمادية لاستنفاد الجلوكوز ، في حين لوحظ الحد الأدنى من التلألؤ مع الأجسام الجينية. أشرطة مقياس 5 م.

تدخل mRNAs Latephase Pbodies بعد فترة طويلة من الجوع الجلوكوز. كما في الشكل 1 ، فيما يلي برنامج SPG4, SUE1, VNX1, TDP1 و سعر التجزئة الموصى به 43 مرنا بالنسبة لاضمحلال mRNA والمكونات المعقدة الحلقة المغلقة. تصور الصور الملونة المتراكبة بعد 50 دقيقة من استنفاد الجلوكوز أمثلة حيث تتجمع جزيئات الرنا المرسال مع مثلثات Pbodies الصفراء ولكن ليس بأجسام EGPbodies بيضاء. توضح الرسوم البيانية إلى اليمين أن النسبة المئوية للأجسام التي تؤوي كل مرنا تزداد من 10 دقائق من الأشرطة البيضاء إلى 50 دقيقة من الأشرطة الرمادية لنضوب الجلوكوز ، في حين لوحظ الحد الأدنى من التلألؤ مع الأجسام الجينية. أشرطة مقياس 5 م.

يتوافق الإدخال المطول لـ mRNA في Pbodies مع النموذج الحالي للقمع الترجمي بعد تجويع الجلوكوز Castelli et al. ، 2011. في هذا النموذج ، فإن فقدان eIF4A RNA Helicase من mRNA سيمنع بدء الترجمة. ومع ذلك ، خلال فترة قصيرة بعد الضغط ، فإن خسارة eIF4A قد تتسبب في تراكم مجمع التأسيس 48S. على مدى فترة أطول ، سيتفكك مجمع 48S المتوقف ، مما يسمح بالإفراج البطيء عن mRNA المرتبط بمكونات مجمع الحلقة المغلقة. هذا يمكن أن يفسر سبب توطين eIF4E فقط لـ Pbodies في 50 دقيقة ، ولكن ليس 10 دقائق ، إجهاد ما بعد الجلوكوز الشكل 2 هويل وآخرون ، 2007. واقترح تقدير أكثر تفصيلاً لارتباط mRNAs بعلامة MS2 و eIF4E مع Pbodies أنه بالنسبة لجميع MS2 الموسومة بعلامات تم تقييم mRNAs في هذه الدراسة ، وكانت نسبة صغيرة فقط من mRNA الموسومة موجودة في Pbodies التي تحتوي أيضًا على مادة eIF4E التكميلية الشكل S3. على الرغم من أنه لا يزال من الممكن أن تدخل mRNAs Pbodies كجزء من مجمع الحلقة المغلقة ، فإن هذا التحديد الكمي أبرز أيضًا إمكانية بديلة لانهيار مجمع الحلقة المغلقة قبل أو أثناء حركة mRNAs إلى Pbodies.

من أجل مقارنة توقيت إدخال eIF4E و latephase mRNA إلى Pbodies ، تم إجراء دورة زمنية أكثر شمولية باستخدام TDP1 مرنا. هنا ، أقرب نقطة زمنية يمكن فيها ملاحظة الترجمة إلى Pbodies ، إما لـ eIF4E أو TDP1 مرنا ، كان 30 دقيقة بعد تجويع الجلوكوز الشكل 3. هذه المصادفة الواضحة في توقيت الحركة لعوامل بدء الترجمة المعقدة ذات الحلقة المغلقة وطور mRNA الطورية تدعم نموذجًا حيث يتحرك بعض من الرنا المرسال على الأقل إلى Pbodies بينما لا يزال مرتبطًا بمركب الحلقة المغلقة ، بعد ارتباط مطول مع آلية الترجمة بعد تجويع الجلوكوز. سؤال واضح من هذه المقارنة لدخول mRNA المتأخر و eIF4E إلى Pbodies هو لماذا لا ينتقل eIF4E إلى Pbodies مع mRNAs المبكرة. التفسير المحتمل هو أن معقد جزيء mRNP الرسول المكبوت انتقاليًا للـ mRNAs المبكر يختلف عن مثيله في الرنا المرسال المتأخر ، ونتيجة لذلك ، تختلف آلية النقل إلى الأجسام Pbodies.

الدورة الزمنية لتوطين الطور البعيد من الرنا المرسال إلى Pbodies بالنسبة إلى eIF4E. صور مجهرية مضان لخلايا الخميرة على مدار فترة زمنية بعد استنفاد الجلوكوز. ال TDP1 يتم اتباع mRNA باستخدام نظام mTAG عبر الصف الأوسط MS2GFP ، ويتم اتباع مكونات اضمحلال mRNA باستخدام الصف العلوي Dcp2p بعلامات CFP ويتم اتباع مكونات مجمع الحلقة المغلقة باستخدام RFPtagged eIF4E الصف السفلي. يبرز المثلث الأبيض النقطة الزمنية التي يتم فيها ملاحظة eIF4E و mRNA لأول مرة مع علامة Pbody. شريط مقياس 5 م.

الدورة الزمنية لتوطين الطور البعيد من الرنا المرسال إلى Pbodies بالنسبة إلى eIF4E. صور مجهرية مضان لخلايا الخميرة على مدار فترة زمنية بعد استنفاد الجلوكوز. ال TDP1 يتم اتباع mRNA باستخدام نظام mTAG عبر الصف الأوسط MS2GFP ، ويتم اتباع مكونات اضمحلال mRNA باستخدام الصف العلوي Dcp2p بعلامات CFP ويتم اتباع مكونات مجمع الحلقة المغلقة باستخدام RFPtagged eIF4E الصف السفلي. يبرز المثلث الأبيض النقطة الزمنية التي يتم فيها ملاحظة eIF4E و mRNA لأول مرة مع علامة Pbody. شريط مقياس 5 م.

يتطلب توطين mRNAs latephase Pbodies

من أجل استكشاف المتطلبات الميكانيكية لهاتين المرحلتين في توظيف mRNA في Pbodies ، استخدمنا lsm4c edc3 متحولة ، والتي تفشل في تكوين Pbodies. تحتوي بروتينات Lsm4p و Edc3p على مجالات محددة ضرورية لتكوين الجسم ، ويفترض أنه نتيجة لإمكانية تجميعها Decker et al. ، 2007. لذلك ، تم تهجين السلالات التي تحمل مختلف mRNAs بعلامة MS2 بشكل فردي إلى lsm4c edc3 سلالات متحولة. كما هو متوقع ، لجميع النتائج lsm4c edc3 سلالات متحولة ، لم تتشكل Pbodies بعد 10 أو 50 دقيقة من استنفاد الجلوكوز. Latephase mRNAs ، مثل TDP1 و VNX1، لم تكن مترجمة في أي من النقاط الزمنية المبكرة أو المتأخرة بعد تجويع الجلوكوز في الخلفية المتحولة. تشير هذه النتيجة إلى أن توطين هذه الرنا المرسال في الطور المتأخر يعتمد على تكوين أجسام Pbodies الشكل 4. فى المقابل، RPS16A لوحظ mRNA في الحبيبات في حالة الغياب التام لتكوين الجسم. ترتبط هذه الملاحظة على الأرجح بتوطين هذه الرنا المرسال في حبيبات في الخلايا غير المجهدة ، حيث لا يتم ملاحظة الأجسام المضادة. تشير هذه النتائج إلى أن التمييز بين الرنا المرسال المبكر والطور البعيد لا يكمن فقط في توقيت التوطين ولكن أيضًا في الآليات الجزيئية الدقيقة لتوطين الرنا المرسال لكل فئة من الرنا المرسال.

يعتمد توطين Latephase mRNA على تكوين الجسم. صور مضان لخلايا الخميرة بعد 50 دقيقة من نضوب الجلوكوز. lsm4c edc3 تم إنشاء سلالات متحولة تحمل علامات MS2 mRNAs المسمى على اليسار. هذا المسخ معيب في تكوين الجسم ، كما يتضح من عدم توطين Dcp2pCFP. ال RPS16A يوفر mRNA مثالاً حيث لا تزال مجموعة mRNAs في المراحل المبكرة تتجمع ، في حين لا يتم ملاحظة التوطين لاثنين من mRNAs في الطور المتأخر ، VNX1 و TDP1. أشرطة مقياس 5 م.

يعتمد توطين Latephase mRNA على تكوين الجسم. صور مضان لخلايا الخميرة بعد 50 دقيقة من نضوب الجلوكوز. lsm4c edc3 تم إنشاء سلالات متحولة تحمل علامات MS2 mRNAs المسمى على اليسار. هذا المسخ قاصر في تكوين Pbody ، كما يتضح من عدم توطين Dcp2pCFP. ال RPS16A يوفر mRNA مثالاً حيث لا تزال تتجمع في المراحل المبكرة من mRNAs ، في حين لا يتم ملاحظة التوطين لاثنين من mRNAs في الطور المتأخر ، VNX1 و TDP1. أشرطة مقياس 5 م.

Bfr1p هو بروتين Pbody الدخول المتأخر

من أجل فحص العوامل المشتركة مع عوامل تحلل الرنا المرسال Xrn1p و Dcp2p ، استخدمنا كروماتوغرافيا TAP لتنقية التقارب الترادفي لسحب Dcp2pTAP و Xrn1pTAP من سلالات TAPtagged المناسبة.تم تحديد العديد من البروتينات المتفاعلة التي لها صلات مع الحمض النووي الريبي ، أو مرتبطة بأجسام Pbodies ، وسيتم تقديمها بمزيد من التفصيل في مكان آخر. كان Bfr1p Table1 بروتينًا بارزًا بشكل خاص تم تحديده بواسطة مطياف الكتلة في عمليات السحب هذه. Bfr1p هو بروتين رابط mRNA تم تحديده في البداية على أنه مثبط عالي النسخ لمضاد حيوي لاكتون brefeldinA Jackson and Kps ، 1994. وقد أظهرت الدراسات الحديثة أن Bfr1p يتفاعل مع مركب ربط mRNA يحتوي على بروتينات ربط الحمض النووي الريبي ، مثل Scp160p Lang et al.، 2001 Scheuner وآخرون ، 2001 Sezen وآخرون ، 2009. يتحد كل من Scp160p و Bfr1p مع الشبكة الإندوبلازمية الخميرة ER في نمط مميز حول النواة القشرية ER وتحت غشاء الخلية المحيطي ER Mitchell et al. ، 2013 Sezen et al. ، 2009. وقد ثبت أيضًا أن المركب المحتوي على Bfr1 يتم توطينه في تعدد الخلايا في الخلايا المتزايدة بشكل كبير ، مما يشير إلى أنه يشارك بنشاط في تنظيم الترجمة Sezen et al. ، 2009. على هذا الأساس ، فإن التفاعل المحتمل بين عوامل تحلل Bfr1p و mRNA موجودة في تم إجراء مزيد من التحقيق في Pbodies.


شكر وتقدير

نشكر جوليان جانيور على الاقتراحات حول التطبيع والنماذج الخطية المعممة Arnaud Bonnaffoux و Florent Chuffart و Pascal Hersen و Abderrahman Khila و Sébastien Lemaire و Serge Pelet و Alexandre Soulard للمناقشات Julien Gagneur و Steve Garvis و Jun-Yi Leu و Stephen Proulx و Mark Siegal و Henrique Teotonio لقراءة نقدية للمخطوطة Audrey Barthelaix للاختبارات الأولية على المنصة الروبوتية David Stillman للبلازميدات Sandrine Mouradian و SFR Biosciences Gerland-Lyon Sud (UMS3444 / US8) للوصول إلى مقاييس التدفق الخلوي والمساعدة الفنية BioSyL Federation و Ecofect LabEx ( ANR-11-LABX-0048) لإلهام مطوري الأحداث العلمية من R / Bioconductor و Ubuntu لبرامجهم وثلاثة مراجعين مجهولين لتعليقاتهم. تم دعم هذا العمل من قبل مجلس البحوث الأوروبي في إطار برنامج الاتحاد الأوروبي الإطاري السابع FP7 / 2007-2013 اتفاقية المنحة رقم 281359 ومؤسسة ARC من أجل البحث عن السرطان.


شاهد الفيديو: Scene han Gisèle fast and furious (أغسطس 2022).