معلومة

إنشاء قالب تعبير من PCR: ما درجة حرارة التلدين التي يجب استخدامها؟


أقوم بإنشاء قالب نسخ للتعبير في PURExpress وكان مرتبكًا بشأن درجة حرارة التلدين التي يجب استخدامها.

لديّ اثنين من البادئات مع مروج T7 و RBS على التمهيدي الأمامي وتسلسل إنهاء على التمهيدي العكسي. درجة حرارة انصهار هذه البادئات هي 84.4 و 83.8 درجة مئوية. درجة حرارة انصهار المناطق المكملة للجين الذي أريد تضخيمه بواسطة تفاعل البوليميراز المتسلسل هي حوالي 65 درجة مئوية.

ما هي درجة حرارة التلدين التي يجب أن أستخدمها h؟ منذ بداية تفاعل PCR ، سيكون لدي قالب في الغالب يحتوي على التسلسلات التكميلية للبادئات المرتبطة بـ GOI وليس الامتدادات 5 'و 3'.


يبدو أن الإجابة ، والتي قد تكون خاصة بالسياق ، هي استخدام درجة حرارة التلدين حوالي 5 درجات تحت درجة حرارة انصهار القلة الكاملة. لم أحصل على أي عصابات في درجات حرارة منخفضة.


تحديد درجات حرارة التلدين لتفاعل البلمرة المتسلسل.

يعد تحليل الحمض النووي بواسطة تفاعل البلمرة المتسلسل (PCR) تقنية بسيطة بشكل ملحوظ تسمح بتضخيم كميات دقيقة من الحمض النووي. أدى التوافر التجاري للمجموعات إلى جعل المختبرات التي تستخدم تفاعل البوليميراز المتسلسل أكثر شيوعًا في فصول العلوم بالمدارس الثانوية والجامعية. يستخدم الطلاب تفاعل البوليميراز المتسلسل لتحديد نوع الحمض النووي وبصمات الأصابع (Baker et al. ، 2002) ، لتحديد الملوثات البكتيرية (Baker et al. ، 1999) ، والاستنساخ لجين معين مهم (Dong et al. ، 2008). غالبًا ما تكون معلمات هذه التجارب قياسية ومحددة مسبقًا. يدير الطلاب التفاعلات دون أن يكون لديهم تقدير حقيقي للتفاصيل التجريبية الهامة المطلوبة لتضخيم جزء معين من الحمض النووي.

تتضمن دورة PCR ثلاث خطوات: التمسخ ، التلدين التمهيدي ، وتمديد التمهيدي. تتطلب كل خطوة من هذه الخطوات حضانة خليط التفاعل عند درجات حرارة مختلفة. في الخطوة الأولى ، التمسخ ، يتم تحضين الحمض النووي عند 93-95 درجة مئوية من 30 ثانية إلى دقيقتين. هذا يكسر الروابط الهيدروجينية بين أزواج قاعدة النيوكليوتيدات (bp) ويفصل بين خيوط الحمض النووي. في الخطوة الثانية ، التلدين التمهيدي ، يتم تحضين التفاعل عند 45-65 درجة مئوية لمدة 45 ثانية إلى دقيقة واحدة ، ويسمح وجود البادئات التكميلية بالتهجين لاستهداف الحمض النووي. الخطوة الثالثة ، التمديد التمهيدي ، يتم إجراؤها عند 72 درجة مئوية من 15 ثانية إلى دقيقة واحدة وتتضمن تخليق الحمض النووي ، حيث يتم استخدام البادئات لتجميع خيطين ابنتيين جديدين مكملين للخيوط الأم الأصلية. ستقوم دورات PCR اللاحقة بتكرار كل منتج PCR في خليط التفاعل ، مما يؤدي إلى التضخيم الأسي لتسلسل هدف DNA.

احتاج المبتكرون الأوائل لـ PCR إلى تحسين هذا الإجراء. في البداية ، يجب إضافة بوليميراز DNA جديد بعد كل خطوة تمسخ. في النهاية ، تم اكتشاف شكل مستقر حرارياً في بكتيريا الينابيع الساخنة Thermus aquaticus (Taq) ، ومن هنا جاء مصطلح Taq DNA polymerase. تتطلب كل فترة حضانة نقل أنابيب الاختبار يدويًا من درجة حرارة إلى أخرى حتى ظهور الدوار الحراري ، الذي ينظم درجات حرارة الدراجات تلقائيًا.

حتى في "العالم الحقيقي" للبحث العلمي ، يتم استخدام مجموعات تفاعل البوليميراز المتسلسل المتاحة تجارياً ، ولكن عادةً ما يتم توفير مكونين هامين من مكونات تفاعل البوليميراز المتسلسل من قبل العالم. يقوم الباحثون بتزويد البادئات الخاصة بهم ، والتي تم تصميمها لتصلب تسلسل DNA محدد ، وتضخيم قالب الحمض النووي. سيكون PCR المثالي محددًا ، مما ينتج عنه منتج تضخيم واحد فقط ، ويكون فعالًا ، وينتج عنه زيادة نظريتين في المنتج لكل دورة PCR ، ولديه الدقة ، ويعيد إنتاج التسلسل الدقيق للقالب. تتأثر كل من هذه المعلمات بالمتغيرات داخل خليط تفاعل PCR مثل مكونات المخزن المؤقت ، ورقم التدوير ، ودرجة الحرارة ، ومدة كل خطوة دورة ، وتكوين التمهيدي ، وقالب الحمض النووي. في هذا التمرين المختبري ، يستخدم الطلاب مجموعتين من البادئات لتحديد درجة حرارة التلدين المثلى في تكوين منتج PCR لتحسين كفاءة التضخيم. نستخدم هذا التمرين في دورة مختبر فسيولوجيا الخلية لطلاب المرحلة الجامعية العليا. كما أنه مناسب لدورات AP Biology ، حيث قد يتوفر التمويل لمزيد من التدريبات المعملية المتقدمة.

تركز هذه المجموعة من التجارب على تضخيم منتجي تفاعل البوليميراز المتسلسل (PCR): أحدهما لكلودين 2 والآخر لكلودين 12. الكلودين عبارة عن مكونات لتقاطعات ضيقة موجودة بين خلايا الأمعاء وتشارك في إنشاء حاجز نفاذية بحيث لا يمكن للمواد أن تنتقل من تجويف الأمعاء إلى الدم. في هذه التجارب ، الطلاب

1. دراسة المعلمات العامة التي تؤثر على PCR ،

2. حساب وتقدير درجة حرارة التلدين المثلى للبادئات من claudin-2 و claudin-12 تسلسل DNA ،

3. قم بتشغيل PCR باستخدام مجموعة من درجات حرارة التلدين التي يحددها الطلاب ،

4. تصور نواتج تفاعل البوليميراز المتسلسل في رحلان أفقي من هلام الاغاروز ،

5. تحديد كمية وحجم منتج PCR لكل مجموعة من البادئات ، و

6. قارن درجة حرارة التلدين الملحوظة مع درجة حرارة التلدين المحسوبة.

** المعلمات التي تؤثر على تفاعل البوليميراز المتسلسل

الخصوصية والكفاءة والإخلاص: يتطلب تحسين هذه المعلمات الثلاثة معرفة الغرض من تفاعل تفاعل البوليميراز المتسلسل (Cha & amp Thilly ، 1993). يمتلك PCR المثالي خصوصية عالية (منتج واحد فقط) ، وكفاءة (عائد أسي جيد) ، ودقة (منتج دقيق). تتأثر هذه المعلمات بعدد من المتغيرات بما في ذلك ظروف المخزن المؤقت مثل تركيز [Mg.sup. ++] ووقت الدوران ودرجة حرارة التلدين والمدة الزمنية. سيؤدي تعديل هذه المتغيرات إلى تعظيم معلمة واحدة على أخرى ، وبالتالي هناك حل وسط اعتمادًا على الغرض الخاص بك. الإخلاص له أهمية قصوى عندما يكون الغرض هو تسلسل DNA معين. في PCR الكمي ، المستخدم لتقييم التعبير الجيني ، تعتبر الخصوصية والكفاءة مهمة أيضًا.

** درجة حرارة تلدين مثالية وتصميم برايمر أمبير

يعد طول التمهيدي وتسلسله أمرًا بالغ الأهمية في تضخيم منتجات PCR بالخصوصية والكفاءة (Dieffenbach et al. ، 1993). يقاس ثبات قالب الدنا المزدوج التمهيدي من خلال درجة حرارة انصهاره ([T.sub.m]) ، وهي درجة الحرارة التي ينفصل عندها نصف طبقة الدنا المزدوجة الأولية لتصبح DNA أحادي الجديلة. يلعب طول التمهيدي ومحتوى G و C لمزدوج قالب DNA التمهيدي أدوارًا حاسمة في تحديد [T.sub.m] ، والذي يتم حسابه بواسطة الصيغة 4 (G + C) + 2 (A + T) ، وهذه هي القاعدة الأساسية لحساب درجة حرارة التلدين. عادة ما تكون درجة حرارة التلدين الملحوظة أقل من درجة حرارة التلدين المحسوبة ببضع درجات وتتأثر بالمتغيرات الأخرى لـ PCR ، مثل التركيز [Mg.sup. ++] والتركيز [K. sup. +]. يتراوح طول التمهيدي عادة بين 18 و 22 نيوكليوتيدات.

يوضح الجدول 1 الاشعال المستخدمة في هذا التمرين لتضخيم (كدنا) المعوي لكلودين 2 وكلودين 12. يمكن للطلاب حساب درجة حرارة التلدين المثلى على أساس التكوينات الأولية وتصميم تجربة لاختبار نطاقات درجات حرارة مختلفة من أجل تحديد درجة حرارة التلدين المثلى. يتم وصف البروتوكول التجريبي لاختبار درجة حرارة التلدين الفعلية أدناه ، ويتم اقتراح الاختلافات بحيث يمكن للمدرسين توجيه الطلاب لإنشاء فرضياتهم الخاصة وتكييف التجربة لاختبار المتغيرات الأخرى التي يمكن للطلاب معالجتها. يمكن تجميع الطلاب في مجموعات لاختبار فرضيات مختلفة ، أو يمكن الوصول إلى توافق في الآراء حيث يتم اختبار فرضية واحدة من قبل جميع المجموعات.

ينقسم المختبر إلى ثلاث وحدات. في الوحدة الأولى ، يستخدم الفصل RNA لتجميع (كدنا) بواسطة إنزيم النسخ العكسي (RT). في الوحدة الثانية ، يتم استخدام (كدنا) في تفاعل البوليميراز المتسلسل لتضخيم (كدنا) لكلودين 2 وكلودين 12 في درجات حرارة متفاوتة للتلدين. في الوحدة الثالثة ، يتم تحليل منتجات تفاعل البوليميراز المتسلسل (PCR) عن طريق الفصل من خلال مواد هلامية الاغاروز. ينقسم الفصل إلى مجموعات من اثنين أو ثلاثة طلاب ، حسب حجم الفصل. يستغرق التمرين المختبري بأكمله 3-4 أسابيع ، بافتراض وجود مختبر لمدة 3 ساعات في الأسبوع ، ولكن يمكن إجراء كل وحدة على حدة بحيث يمكن أن ينقضي الوقت بين الوحدات. يتم تمثيل الرسم التخطيطي للتمرين في الشكل 1.

الوحدة 1: تحضير أول حبلا (كدنا) باستخدام النسخ العكسي (RT)

نقوم بإعداد الحمض النووي الريبي الخاص بنا من أنسجة أمعاء الفأر ، باستخدام غوانيدينيوم أيزوثيوسيانات (Chomczynski & amp Sacchi ، 2006). بدلاً من ذلك ، يمكن شراء الحمض النووي الريبي المعوي للفأر من الموردين (Amsbio ، كتالوج رقم M1334226 أو Zyagen ، كتالوج رقم MR-307). يتم استخدام مجموعة من Invitrogen (كتالوج رقم 18080-051) توفر جميع الكواشف المطلوبة لتفاعلات 50 لتكوين cDNA. يضاف RNA (2 [ميكرو] جم) إلى مزيج 1 [ميكرو] L oligo dT و 1 [ميكرو] L dNTP ويتم إحضاره حتى 10 [ميكرو] لتر مع ماء معالج DEPC. تحتوي مياه DEPC على ثنائي إيثيل بيروكربونات ، مما يؤدي إلى تدهور أي أثر لـ RNases. يُسخن المزيج بأكمله بعد ذلك إلى 65 درجة مئوية لمدة 5 دقائق ، متبوعًا بـ 4 درجات مئوية لمدة 7 دقائق. هذا يسمح oligo dT أن يصلب إلى mRNA وأن يكون بمثابة التمهيدي الذي يتم من خلاله تصنيع أول خيط من cDNA. في الخطوة الثانية ، يضاف مزيج تخليق (كدنا) (10 [ميكرو] لتر) إلى عينة الحمض النووي الريبي ، ويتم تسخين العينة عند 50 درجة مئوية لمدة 50 دقيقة ، تليها 85 درجة مئوية لمدة 5 دقائق. ينتج عن هذا تمديد التمهيدي عن طريق النسخ العكسي (RT) وتوليف أول حبلا (كدنا) باستخدام مرنا كقالب (الشكل 1 أ). يتم تخزين cDNA عند 4 درجات مئوية للاستخدام الفوري أو عند -20 درجة مئوية للاستخدام المستقبلي. بدلاً من ذلك ، يمكن للمدرب أن يختار تخطي الوحدة 1 وشراء cDNA للماوس (Zymogen mouse cecum dDNA ، الكتالوج رقم MD-310 أو الفأر القولون cDNA ، الكتالوج رقم MD-311) واستخدامه بتركيز 10 نانوغرام لكل خليط PCR.

الوحدة 2: تحضير cDNA الثاني وتضخيم cDNA الخاص بالجينات باستخدام PCR

يتم استخدام (كدنا) الذي تم إنشاؤه من الحمض النووي الريبي في PCR القياسي مع بوليميريز Taq والبادئات الخاصة بالجينات لكلودين 2 وكلودين 12. يتم عرض تسلسل التمهيدي لكلودين 2 وكلودين 12 في الجدول 1 ، مع تفاصيل تتعلق بالتركيب ودرجات حرارة التلدين. يمكن إعطاء الطلاب تكوين البادئات وحساب ٪ GC و [T.sub.m]. على أساس المناقشات الصفية ، يمكنهم إعداد نطاق درجات حرارة التلدين ليتم اختبارها لتحديد درجة حرارة التلدين الفعلية لكل مجموعة من البادئات. PrimerBank (http://pga.mgh.harvard.edu/primerbank/index.html) هو مصدر عام للبادئات لـ & gt 300000 جينات بشرية وفأرية ، وأداة مفيدة للغاية للبحث عن مجموعات مختلفة من التمهيدي لجينات محددة ذات أهمية (سبانديوس وآخرون ، 2010). يمكن استخدام قاعدة البيانات لتزويد الطلاب بقائمة من البادئات لحساب درجات حرارة التلدين ، ويمكن أيضًا استخدامها لاختيار مجموعات مختلفة من البادئات ليتم اختبارها بواسطة مجموعات مختلفة من الطلاب.

تم إجراء توليف cDNA من الدرجة الثانية وتضخيم cDNA الخاص بالجينات (الشكل 1B) عن طريق إضافة 2 [micro] L من RT-cDNA ، 1 [micro] L إلى الأمام ، 1 [micro] L تمهيدي عكسي (50 pmoles لكل منهما) ، و 12.5 [ميكرو] L Taq polymerase (كتالوج Premix Taq Polymerase TaKaRa رقم RR003) في أنبوب PCR سعة 0.2 مل وما يكفي من الماء المعالج بـ DEPC لجلب التفاعل إلى 25 [ميكرو] لتر. في تمريننا ، قمنا باختبار 12 درجة حرارة مختلفة للتلدين ، لذلك قمنا بإعداد خليط تفاعل 12X في أنبوب ميكروفيوج سعة 1.5 مل ووزعنا 25- [ميكرو] L قسامات في 12 أنبوب PCR. تم تضخيم (كدنا) باستخدام دورة إيبندورف المتدرجة PCR الحرارية باستخدام المعلمات التالية: تمسخ الحمض النووي الأولي عند 95 درجة مئوية لمدة 5 دقائق ، متبوعًا بـ 35 دورة من 95 درجة مئوية تمسخ لمدة دقيقة واحدة ، ودرجات حرارة صلبة تتراوح من 51 [درجات] درجة مئوية إلى 71 [درجة] مئوية لمدة دقيقة واحدة ، واستطالة عند 72 درجة مئوية لمدة دقيقة واحدة ، واستطالة نهائية تبلغ 72 درجة مئوية لمدة 7 دقائق ، يتبعها تبريد عند 4 درجات مئوية. يمكن تخزين منتجات تفاعل البوليميراز المتسلسل عند 4 درجات مئوية حتى التحليل المستقبلي. يمكن للطلاب ضبط عدد درجات حرارة التلدين المختارة ، اعتمادًا على المواد الأولية المستخدمة. في حالة عدم توفر دورة التدرج اللوني ، يمكن إجراء التفاعل عدة مرات في دورة PCR عادية عن طريق تغيير درجة حرارة التلدين لكل دورة. بعد دراسة أساسيات تخليق الحمض النووي و PCR ، هناك العديد من الاختلافات في التمرين التي قد يتحدى المدرسون الطلاب لفحصها. بالإضافة إلى درجة حرارة التلدين ، يمكن أيضًا اختبار المتغيرات مثل طول التمهيدي وتركيز البادئات و cDNA ورقم الدورة.

الوحدة 3: Agarose gel الكهربائي لمنتجات PCR

يتم تحضير جل الاغاروز بنسبة 1٪ (الشكل 1C) بإضافة 1 جرام من الاغاروز (كتالوج BioRad رقم 161-3104) إلى 100 مل 1X TAE عازلة (40 مم تريس ، 1 مم EDTA ، الرقم الهيدروجيني 7.6) (كتالوج BioRad رقم 161- 0743) والغليان لإذابة الاغاروز. يبرد المحلول إلى حوالي 60 درجة مئوية ويصب في حامل الهلام بمشط لتشكيل الآبار. يتم تحضير عينات تفاعل البوليميراز المتسلسل (PCR) المراد تشغيلها على الجل بإضافة 5 لترات [ميكرو] من 6X صبغة تحميل DNA (0.25٪ بروموفينول أزرق ، 0.25٪ زيلين سيانول ، 30٪ جلسرين في الماء) إلى تفاعلات تفاعل البوليميراز المتسلسل 25 [ميكرو] لتر و دوامة. بعد ترسيخ هلام الاغاروز ، يتم وضعه في غرفة عازلة مملوءة بمخزن مؤقت 1X TAE بحيث يتم غمر الجل وإزالة المشط بلطف. يتم تحميل سلم DNA (5 [ميكرو] L Phenix Research Products 100-bp DNA ladder) في البئر الأول في الآبار اللاحقة ، يتم تحميل 20 [ميكرو] لترًا من PCR ومخاليط صبغ التحميل. يتم وضع الغطاء على الحجرة ، وتوصيل الأقطاب الكهربائية بشكل مناسب (أحمر موجب ، أسود سالب) ، ويتم تشغيل الجل عند 90 فولت لمدة 90 دقيقة أو حتى تصبح الصبغة الزرقاء ثلاثة أرباع الطريق نحو نهاية هلام. نقوم بتلطيخ الجل باستخدام ورق InstaStain Ethidium Bromide (Edvotek) لأن هذا يقلل من التعرض المحتمل لبروميد الإيثيديوم وهو أكثر أمانًا لاستخدام الطلاب. يتم وضع هلام الاغاروز على طبقة من بروميد إيثيديوم ، ويتم وضع طبقة ثانية فوق الجل ، ويتم وضع وزن خفيف فوق الجل. بعد 10-15 دقيقة ، تتم إزالة الأوراق وتصور الجل تحت الضوء فوق البنفسجي.

يُظهر فصل منتجات PCR من خلال هلام agarose وتلطيخها ببروميد الإيثيديوم (الشكل 2) نطاقًا واضحًا واحدًا بالطول المتوقع لكل مجموعة من مجموعات التمهيدي: 692 نقطة أساس لكلودين 2 و 604 نقطة أساس لكلودين -12. تُظهر كل مجموعة من البادئات منتج PCR محسنًا أقل بقليل من درجة حرارة التلدين المحسوبة (60 درجة مئوية لكلودين 2 و 67 درجة مئوية لكلودين 12). نظرًا لانحراف درجة الحرارة عن درجة حرارة التلدين المثلى الملحوظة ، إما أن تتناقص أو تزيد ، تقل كمية المنتج بشكل متناسب. كانت بادئات claudin-12 قادرة على إنتاج منتج PCR المتوقع على مدى أوسع من درجات حرارة التلدين من بادئات claudin-2 لأن بادئات claudin-12 تحتوي على [T.sub.m] أعلى ، مما سمح بتمهيدي أكثر استقرارًا. - الحمض النووي المزدوج على الوجهين من بادئات claudin-2 ، وبالتالي دعم استطالة التمهيدي في درجات حرارة أعلى.

** تقييم فهم الطالب

لتقييم تعلم الطلاب ، يبدأ المختبر الأول باختبار تمهيدي يتكون من 20 سؤالًا متعدد الخيارات مصممة لاختبار معرفة الطالب بالحمض النووي و PCR. يترتب على مناقشة متعمقة لتعليم الطلاب أساسيات تخليق الحمض النووي وكيف يمكن تضخيم التسلسلات الجينية المحددة للحمض النووي باستخدام تفاعل البوليميراز المتسلسل. يتم وصف تفاصيل كل وحدة معملية ، ويتم سرد المتغيرات التي تؤثر على تفاعل البوليميراز المتسلسل حسب الفصل. يتيح ذلك للطلاب فهم أهمية التحسين في البروتوكولات التجريبية. غالبًا ما يقوم الطلاب بإجراء تمارين معملية دون التفكير في العمل المضني الذي ينطوي عليه تطوير البروتوكول ، ودون الفهم الكامل لنتائج تجاربهم وتحليلها (Phillips et al.، 2008). يجب على المعلم والطلاب استكشاف المتغيرات التي ستختبرها كل مجموعة وأساس فرضيتها. يتم إعطاء اختبار لاحق يتكون من نفس الأسئلة في بداية الوحدة 1 لتقييم كل من فهم المفاهيم والإعداد للتمرين المعملي. تتضمن الأسئلة حسابات عددية لنسبة CG ودرجة حرارة التلدين. بالإضافة إلى ذلك ، في نهاية الوحدة 3 ، يُطلب من كل مجموعة معملية تقديم تقرير معمل مكتوب بتنسيق علمي يتضمن بيانات محسوبة عن البادئات المستخدمة وصور المواد الهلامية agarose.

تُعرّف هذه المجموعة من التمارين المعملية الطلاب على تضخيم الحمض النووي باستخدام تفاعل البوليميراز المتسلسل بطريقة توضح المبادئ الأساسية لـ PCR مع التركيز على المعلمات التي تؤثر عليه. يتعلم الطلاب كيف يؤثر التصميم التمهيدي على درجة حرارة التلدين وكيف أن هذه ليست سوى واحدة من العديد من المعلمات التي يمكن أن تغير بشكل كبير نتيجة التجربة. يشجع تسليط الضوء على هذه المتغيرات الطلاب على التفكير خارج بروتوكول "كتاب الطبخ" القياسي لـ PCR وبالتالي يعزز مهارات التفكير النقدي الضرورية للتعلم والنجاح مدى الحياة.

تم دعم هذا العمل من خلال منحة المعاهد الوطنية للصحة رقم R15DK088052 إلى A.R.P.

بيكر جيه سي ، كروملي ، R.E. & amp Eckdahl ، T.T. (2002). تضخيم عشوائي DNA polypesrphic DNA PCR في مختبر تدريس علم الأحياء الدقيقة: تحديد المجهول البكتيري. تعليم الكيمياء الحيوية والبيولوجيا الجزيئية. 30. 394-397.

Baker، W.P.، Jarman M.، Ronstadt-Moore، C. & amp Rhodess، S. (1999). تعريف الطلاب الجامعيين بعلم الفيروسات التشخيصي باستخدام تفاعل البوليميراز المتسلسل. مجلة تدريس العلوم بالكلية ، 28 ، 423-426.

تشا ، ر. & amp Thilly ، WG (1993). الخصوصية والكفاءة والإخلاص

من PCR. إعادة البحث الجينومي ، 3 ، S18-S29.

Chomczynski، P. & amp Sacchi، N. (2006). الطريقة أحادية الخطوة لعزل الحمض النووي الريبي عن طريق حمض الغوانيدينيوم ثيوسيانات - الفينول - استخلاص الكلوروفورم: بعد عشرين عامًا. بروتوكولات الطبيعة ، 1 ، 581-585.

ديفنباخ ، سي دبليو ، لوي ، ت. & amp Dvekskler، GS (1993). المفاهيم العامة لتصميم PCR التمهيدي. أبحاث الجينوم ، 3 ، S30-S37.

Dong ، Y. ، Guerrero ، S. & amp Moran ، MA (2008). استخدام تقنية الحمض النووي لاستكشاف التنوع البكتيري البحري في مستنقعات ملح جورجيا الساحلية. مدرس أحياء أمريكي ، 70) ، 278-283.

فيليبس ، AR ، روبرتسون ، AL ، Batzli J. ، Harris ، M. & amp Miller ، S. (2008). مواءمة الأهداف والتقييمات والأنشطة: نهج لتدريس PCR والهلام الكهربائي. CBE تعليم علوم الحياة ، 7،96-106.

Spandidos، A.، Wang، X.، Wang، H. & amp Wang، H. Seed، B. (2010). PrimerBank: مورد من أزواج PCR الأولية للإنسان والفأر لاكتشاف التعبير الجيني وتحديد أبحاث الأحماض النووية ، 38 ، D792-D799.


إنشاء قالب تعبير من PCR: ما درجة حرارة التلدين التي يجب استخدامها؟ - مادة الاحياء

لقد طلبت ترجمة آلية لمحتوى محدد من قواعد البيانات الخاصة بنا. يتم توفير هذه الوظيفة لراحتك فقط ولا يُقصد بها بأي حال من الأحوال أن تحل محل الترجمة البشرية. لا تقدم BioOne ولا مالكو وناشر المحتوى ، وهم يتنصلون صراحةً من مسؤوليتهم ، أي تعهدات أو ضمانات صريحة أو ضمنية من أي نوع ، بما في ذلك ، على سبيل المثال لا الحصر ، الإقرارات والضمانات فيما يتعلق بوظيفة ميزة الترجمة أو دقة أو اكتمال الترجمات.

لا يتم الاحتفاظ بالترجمات في نظامنا. يخضع استخدامك لهذه الميزة والترجمات لجميع قيود الاستخدام الواردة في شروط وأحكام استخدام موقع BioOne.

تحديد درجات حرارة التلدين لتفاعل البلمرة المتسلسل

أنجيلا آر بورتا ، إدوارد إنرز *


* أنجيلا آر بورتا أستاذة مميزة في قسم العلوم البيولوجية وإدوارد إنرز هو طالب دراسات عليا في برنامج الماجستير في التكنولوجيا الحيوية في مركز نيو جيرسي لتعليم العلوم والتكنولوجيا والرياضيات في جامعة كين ، 1000 موريس أفينيو ، يونيون ، نيو جيرسي 07083. البريد الإلكتروني: [email protected] و [email protected]

يتضمن PDF و HTML ، عند توفره

هذه المقالة متاحة فقط لـ مشتركين.
انها ليست متاحة للبيع الفردي.

تفاعل البلمرة المتسلسل (PCR) هو أسلوب شائع يستخدم في تدريس العلوم في المدارس الثانوية والجامعية. غالبًا لا يفهم الطلاب تمامًا المبادئ الأساسية للتقنية وكيف يؤثر تحسين البروتوكول على النتيجة والتحليل. في مختبر البيولوجيا الجزيئية هذا ، يتعلم الطلاب خطوات تفاعل البوليميراز المتسلسل مع التركيز على تكوين التمهيدي ودرجة حرارة التلدين ، والتي يتلاعبون بها لاختبار التأثير على تضخيم الحمض النووي الناجح. يصمم الطلاب تجارب لاختبار فرضياتهم ، وتعزيز نهج قائم على الاكتشاف للتدريس المختبري وتطوير مهارات التفكير النقدي والاستدلال.


دليل استكشاف أخطاء PCR وإصلاحها

ترتبط المشكلات الشائعة في تفاعل البوليميراز المتسلسل بشكل أساسي بظروف التفاعل ودقة التسلسل وإنتاجية التضخيم والخصوصية. في هذه الصفحة ، تعرف على أسبابها المحتملة وتوصياتنا حول كيفية حل هذه المشكلات.

على هذه الصفحة:

  • تقليل تقطيع وخدش الحمض النووي أثناء العزل. تقييم تكامل الحمض النووي للقالب عن طريق الرحلان الكهربائي للهلام ، إذا لزم الأمر.
  • تخزين الحمض النووي في الماء الجزيئي أو المخزن المؤقت TE (درجة الحموضة 8.0) لمنع التحلل بواسطة نوكليازات.
  • اتبع توصيات الشركة المصنعة بشكل صارم عند استخدام مجموعات التنقية لعزل الحمض النووي للقالب. راجع دليل المستخدم وأدلة استكشاف الأخطاء وإصلاحها للتخفيف من سوء جودة الحمض النووي.
  • تأكد من عدم وجود مثبطات PCR متبقية مثل الفينول ، EDTA ، وبروتيناز K في حالة اتباع بروتوكولات تنقية الحمض النووي الكيميائية أو الأنزيمية.
  • إعادة تنقية أو ترسيب وغسل الحمض النووي بنسبة 70٪ من الإيثانول ، لإزالة الأملاح أو الأيونات المتبقية (على سبيل المثال ، K + ، Na + ، إلخ) التي قد تثبط بوليميرات الحمض النووي.
  • اختر بوليميرات الحمض النووي ذات الإنتاجية العالية ، والتي تظهر تحمل عاليًا لمثبطات تفاعل البوليميراز المتسلسل الشائعة المنقولة من التربة والدم والأنسجة النباتية ، إلخ.
  • افحص كمية إدخال الحمض النووي وقم بزيادة الكمية إذا لزم الأمر.
  • اختر بوليميرات الحمض النووي ذات الحساسية العالية للتضخيم.
  • إذا كان ذلك مناسبًا ، قم بزيادة عدد دورات تفاعل البوليميراز المتسلسل.
  • اختر بوليميرات الحمض النووي ذات المعالجة العالية ، والتي تظهر تقاربًا كبيرًا لقوالب الحمض النووي وتكون أكثر ملاءمة لتضخيم الأهداف الصعبة.
  • استخدم مادة مضافة PCR أو مذيب مشترك للمساعدة في تغيير طبيعة الحمض النووي الغني بالـ GC والتسلسلات ذات الهياكل الثانوية.
  • قم بزيادة وقت التمسخ و / أو درجة الحرارة لفصل قوالب الحمض النووي مزدوجة الشريطة بكفاءة.
  • تحقق من قدرة طول التضخيم لبوليميرات الحمض النووي المحدد. استخدم بوليميرات الحمض النووي المصممة خصيصًا لتفاعل البوليميراز المتسلسل الطويل.
  • اختر بوليميرات الحمض النووي عالية المعالجة ، والتي يمكنها تضخيم الأهداف الطويلة في وقت أقصر.
  • تقليل درجات حرارة التلدين والتمديد للمساعدة في ربط التمهيدي وثبات الإنزيم بالحرارة.
  • قم بإطالة وقت التمديد وفقًا لأطوال أمبليكون.
  • مراجعة التصميم التمهيدي. استخدم أدوات التصميم التمهيدي عبر الإنترنت عندما يكون ذلك مناسبًا.
  • تأكد من أن البادئات خاصة بالهدف محل الاهتمام.
  • تحقق من أن البادئات مكملة للخيوط الصحيحة للحمض النووي المستهدف.
  • البادئات الكوة بعد إعادة التعليق وتخزينها بشكل صحيح.
  • أعد تكوين قسامات أولية جديدة أو احصل على مواد أولية جديدة إذا لزم الأمر.
  • تحسين تركيزات التمهيدي (عادة في نطاق 0.1-1 ميكرومتر).
  • بالنسبة إلى تفاعل البوليميراز المتسلسل (PCR) الطويل و تفاعل البوليميراز المتسلسل (PCR) مع بادئات متدهورة ، ابدأ بتركيز لا يقل عن 0.5 ميكرومتر.
  • استخدم بوليمرات الدنا ذات البداية الساخنة لمنع تدهور البادئات من خلال نشاط نوكلياز خارجي 3'→ 5 'لتصحيح التجارب المطبعية لبوليميرات الحمض النووي. تزيد بلمرات الدنا ذات البدء الساخن أيضًا من إنتاجية منتجات PCR المرغوبة من خلال القضاء على التضخيم غير المحدد.
  • بدلاً من ذلك ، قم بإعداد PCR على الجليد ، أو أضف بوليميريز DNA أخيرًا إلى خليط التفاعل.
  • اختر بوليميرات الحمض النووي ذات الحساسية العالية للتضخيم.
  • مراجعة التوصيات بشأن كمية بوليميريز الحمض النووي لاستخدامها في تفاعل البوليميراز المتسلسل ، وتحسينها حسب الضرورة.
  • قم بزيادة كمية بوليميريز الحمض النووي إذا كان خليط التفاعل يحتوي على تركيز عالٍ من مادة مضافة (على سبيل المثال ، DMSO ، فورماميد) أو مثبطات من مصادر العينة.
  • تحسين تركيز Mg 2+ لتحقيق أقصى عوائد PCR. قد يتطلب وجود EDTA ، أو خالب المعادن الأخرى ، أو تركيزات عالية غير معتادة من dNTPs تركيز Mg 2+ أعلى.
  • تحقق من تفضيل بوليميريز الحمض النووي لمحاليل ملح المغنيسيوم. على سبيل المثال، Pfu يعمل بوليميراز الحمض النووي بشكل أفضل مع MgSO4 من MgCl2.
  • راجع التركيزات الموصى بها لمضافات تفاعل البوليميراز المتسلسل أو المذيبات المشتركة. استخدم أقل تركيز ممكن عند الاقتضاء.
  • اضبط درجات حرارة التلدين ، حيث تضعف التركيزات العالية من إضافات PCR أو المذيبات المشتركة ارتباط التمهيدي بالهدف.
  • زيادة كمية بوليميراز الحمض النووي ، أو استخدام بوليميرات الحمض النووي عالية المعالجة.
  • ضع في اعتبارك استخدام مادة مضافة أو مذيب مشترك تمت صياغته خصيصًا لبوليميراز DNA معين (على سبيل المثال ، GC Enhancer المزود ببوليميراز Invitrogen Platinum DNA).
  • تأكد من أن بوليمرات الحمض النووي المحددة قادرة على دمج النيوكليوتيدات المعدلة.
  • تحسين نسبة النيوكليوتيدات المعدلة إلى dNTP لزيادة كفاءة PCR.
  • قم بخلط مخزون الكاشف والتفاعلات المحضرة جيدًا للتخلص من تدرجات الكثافة التي قد تكون قد تشكلت أثناء التخزين والإعداد.
  • تحسين وقت تمسخ الحمض النووي ودرجة الحرارة. قد لا تفصل فترات تغيير الطبيعة القصيرة ودرجات الحرارة المنخفضة بين قوالب الحمض النووي المزدوج الشريطة جيدًا. من ناحية أخرى ، قد تؤدي أوقات التمسخ الطويلة ودرجات الحرارة المرتفعة إلى تقليل نشاط الإنزيم.
  • قم بتحسين درجة حرارة التلدين تدريجياً بزيادات 1-2 درجة مئوية ، باستخدام جهاز تدوير متدرج عند توفره. عادة ما تكون درجة حرارة التلدين المثلى 3-5 درجات مئوية تحت أدنى درجة حرارة تمهيدي Tم.
  • ضبط درجة حرارة التلدين عند استخدام مادة مضافة PCR أو مذيب مشترك.
  • استخدم درجة حرارة التلدين الموصى بها لبوليميراز DNA معين في المخزن المؤقت الأمثل. يمكن أن تختلف قواعد درجة حرارة التلدين لمجموعات التمهيدي بين بوليميرات الحمض النووي المختلفة.
  • حدد فترة تمديد مناسبة لطول amplicon.
  • قم بتقليل درجة حرارة الامتداد (على سبيل المثال ، إلى 68 درجة مئوية) للحفاظ على نشاط الإنزيم أثناء تضخيم الأهداف الطويلة (على سبيل المثال ، gt10 kb).
  • استخدم بوليميرات الحمض النووي ذات المعالجة العالية لتضخيم قوي حتى مع فترات التمديد القصيرة.
  • اضبط عدد الدورات (بشكل عام إلى 25-35 دورة) لإنتاج عائد مناسب من منتجات تفاعل البوليميراز المتسلسل. قم بتمديد عدد الدورات إلى 40 إذا كان إدخال الحمض النووي أقل من 10 نسخ.
  • راجع الكميات المثلى من مدخلات الحمض النووي. قلل الكمية لتقليل توليد منتجات PCR غير محددة.
  • قد يظهر الحمض النووي المتحلل على شكل مسحات أو يؤدي إلى خلفية عالية في الرحلان الكهربائي للهلام. تقليل تقطيع وخدش الحمض النووي أثناء العزل.
  • تقييم سلامة قالب DNA قبل PCR بواسطة الرحلان الكهربائي للهلام ، إذا لزم الأمر. قم بتخزين الحمض النووي في الماء الجزيئي أو المخزن المؤقت TE (درجة الحموضة 8.0) لمنع التحلل بواسطة نوكليازات.
  • اختر بوليميرات الحمض النووي ذات المعالجة العالية ، والتي تظهر تقاربًا كبيرًا لقوالب الحمض النووي وتكون أكثر ملاءمة لتضخيم الأهداف الصعبة.
  • استخدم مادة مضافة PCR أو مذيب مشترك للمساعدة في تغيير طبيعة الحمض النووي الغني بالـ GC والتسلسلات ذات الهياكل الثانوية. قم بزيادة وقت التمسخ و / أو درجة الحرارة لفصل قوالب الحمض النووي مزدوجة الشريطة بكفاءة.
  • تحقق من قدرة طول التضخيم لبوليميرات الحمض النووي المحدد. استخدم بوليميرات الحمض النووي المصممة خصيصًا للـ PCR الطويل.
  • اختر بوليميرات الحمض النووي عالية المعالجة ، والتي يمكنها تضخيم الأهداف الطويلة في وقت أقصر.
  • تقليل درجات حرارة التلدين والتمديد للمساعدة في ربط التمهيدي وثبات الإنزيم بالحرارة. قم بإطالة وقت التمديد وفقًا لأطوال أمبليكون.
  • مراجعة التصميم التمهيدي. استخدم أدوات التصميم التمهيدي عبر الإنترنت عندما يكون ذلك مناسبًا. تحقق من أن البادئات خاصة بالهدف ، مع الحد الأدنى من التشابه مع المناطق الأخرى في القالب.
  • تأكد من أن البادئات لا تحتوي على متواليات تكميلية أو نيوكليوتيدات G أو C متتالية في النهايات 3 ، لمنع تكوين ثنائي التمهيدي.
  • تجنب التكرار المباشر في البادئات لمنع المحاذاة الخاطئة في الارتباط بالهدف. ضع في اعتبارك استخدام مواد أولية أطول لتعزيز الخصوصية.
  • ضع في اعتبارك تفاعل البوليميراز المتسلسل المتداخل لتحسين الخصوصية.
  • تحسين تركيزات التمهيدي (عادة في نطاق 0.1-1 ميكرومتر). تعمل التركيزات العالية من البرايمر على تعزيز تكوين التمهيدي - الثنائى.
  • مراجعة التوصيات بشأن كمية بوليميريز الحمض النووي لاستخدامها في تفاعل البوليميراز المتسلسل ، وتقليلها حسب الضرورة.
  • استخدم بوليميرات الحمض النووي ذات البداية الساخنة التي ليس لها نشاط في درجة حرارة الغرفة ولكنها تعمل فقط بعد خطوة تنشيط عالية الحرارة ، لتعزيز الخصوصية. باستخدام بوليميرات الحمض النووي غير الساخنة ، قم بإعداد PCR على الجليد للحفاظ على نشاط الإنزيم منخفضًا.
  • راجع تركيزات Mg 2+ وخفضها حسب الاقتضاء لمنع منتجات PCR غير المحددة. تحسين تركيزات Mg 2+ لكل مجموعة أولية والحمض النووي المستهدف.
  • قم بزيادة وقت التمسخ و / أو درجة الحرارة لفصل الحمض النووي بكفاءة عند العمل مع قوالب وتسلسلات غنية بالـ GC مع الهياكل الثانوية.
  • استخدم درجة حرارة التلدين الموصى بها لبوليميراز DNA معين في المخزن المؤقت الأمثل. يمكن أن تختلف قواعد درجة حرارة التلدين لمجموعات التمهيدي بين بوليميرات الحمض النووي المختلفة.
  • زيادة درجة حرارة التلدين لتحسين النوعية. تكون درجة حرارة التلدين المثلى عادة ما لا تقل عن 3-5 درجات مئوية تحت أدنى درجة حرارة تمهيدي Tم.
  • قم بتحسين درجة حرارة التلدين تدريجياً بزيادات 1-2 درجة مئوية ، باستخدام جهاز تدوير متدرج عند توفره.
  • النظر في عملية اللمس PCR لتعزيز الخصوصية.
  • تقصير وقت التلدين لتقليل ارتباط التمهيدي بالتسلسلات غير المحددة.
  • خفض درجة حرارة التمديد 3-4 درجات مئوية لمساعدة بوليميريز الحمض النووي بالحرارة ، خاصة بالنسبة لتفاعل البوليميراز المتسلسل الطويل.
  • إطالة وقت التمديد عند تضخيم أهداف الحمض النووي الطويلة.
  • قم بتضمين خطوة تمديد نهائية بوقت كافٍ (5-15 دقيقة) لتمديد الهدف بأكمله.
  • تقليل عدد الدورات ، دون خفض كبير في إنتاجية منتجات PCR المرغوبة ، لمنع تراكم أمبليكونات غير محددة.
  • استخدم بوليميرات الحمض النووي بدقة عالية بشكل استثنائي لتوليد أجزاء PCR للتطبيقات النهائية مثل الاستنساخ والتسلسل والطفرات الموجهة للموقع.
  • راجع تركيزات Mg 2+ وقللها حسب الضرورة. التركيزات المفرطة تفضل التضمين الخاطئ للنيوكليوتيدات بواسطة بوليميراز الحمض النووي.
  • تأكد من تركيزات متساوية من dATP و dCTP و dGTP و dTTP في التفاعل. تزيد تركيزات النوكليوتيدات غير المتوازنة من معدل خطأ تفاعل البوليميراز المتسلسل.
  • تقليل عدد الدورات دون خفض كبير في إنتاجية منتجات PCR المطلوبة. تزيد الأعداد الكبيرة من الدورات من دمج النيوكليوتيدات غير المتطابقة.
  • قم بزيادة كمية إدخال الحمض النووي عندما يكون ذلك مناسبًا لتجنب تشغيل عدد مفرط من الدورات.
  • استخدم صندوق ضوء الأشعة فوق البنفسجية طويل الموجة (360 نانومتر) لتصور الشظايا في المواد الهلامية ، والحد من وقت الإضاءة قدر الإمكان.
  • إذا كنت تستخدم صندوق ضوء قصير الموجة (254-312 نانومتر) ، فحد من إضاءة الأشعة فوق البنفسجية لبضع ثوانٍ واحتفظ بالجيل على لوح زجاجي أو بلاستيكي.
  • بدلاً من ذلك ، استخدم الأصباغ ذات الطول الموجي الأطول (أقل ضررًا) لإثارة تصور الحمض النووي.
  • تسلسل كل من خيوط الحمض النووي للتحقق من موثوقية نتائج التسلسل. استخدم عينات مكررة عند الاقتضاء.
  • تجنب التكرارات المباشرة داخل تسلسلات التمهيدي ، حيث قد تظهر التكرارات المتعددة من اختلال التسلسل في نهايات منتجات PCR.
  • اطلب بادئات تفاعل البوليميراز المتسلسل مع التنقية لإزالة قليل من الحمض النووي غير كامل الطول ، والتي يتم اقتطاعها في نهاياتها الخمسة.
  • استخدم الكواشف الجزيئية الخالية من نوكلياز في إعداد PCR. قم بإعداد ردود الفعل على الجليد للحفاظ على نشاط نوكليازات خارجية ملوثة منخفضة.
  • استخدم مربع ضوء طويل الموجة فوق البنفسجية (360 نانومتر) لتصور الأجزاء الهلامية ، والحد من وقت الإضاءة قدر الإمكان.
  • إذا كنت تستخدم صندوق ضوء قصير الموجة (254-312 نانومتر) ، فحد من إضاءة الأشعة فوق البنفسجية لبضع ثوان واحتفظ بالجيل على لوح زجاجي أو بلاستيكي.
  • بدلاً من ذلك ، استخدم الأصباغ ذات الطول الموجي الأطول (أقل ضررًا) لإثارة تصور الحمض النووي.
  • تسلسل كل من خيوط الحمض النووي للتحقق من موثوقية نتائج التسلسل. استخدم عينات مكررة عند الاقتضاء.
  • تجنب البادئات التي تحتوي على متواليات مكملة وذاتية التكميلية ، والتي تفضل تكوين البادئة الثنائيه وقلة القلة الذاتية وتضخيمها اللاحق.
  • تجنب تلوث الحمض النووي في بيئة العمل باتباع التوصيات العامة لإعداد PCR.
  • Use pipette tips with aerosol barriers. Dedicate a separate work area and decontaminate the area after each use.
  • Follow PCR carryover control techniques such as dUTP incorporation with UDG treatment.

For more troubleshooting assistance, please visit our End-Point PCR and PCR Primers Support Center or contact our technical support team.


PrimerDigital

  • Primer Tm and annealing temperatures (Ta) values should be determined using PrimerDigital’s Tools
  • Non-specific product formation can often be avoided by optimizing the annealing temperature or by switching to a hot start enzyme
  • Ta can be optimized by doing a temperature gradient PCR, starting at 5°C below the lowest Tm of the primer pair
  • Ideally, primer Tm values should be near to the extension temperature. If Tm values are calculated to be greater than the extension temperature, a two-step PCR program (combining annealing and extension into one step) can be employed
  • The most important values for estimating the Ta is Tm and the length of PCR fragment (L)
  • Primers with high Tm's (> 60°C) can be used in PCRs with a wide Ta range compared to primers with low Tm's ( min ):
    أين إل is length of PCR fragment.

Extension

  • Extension temperature recommendations range from 65°–75°C and are specific to each PCR polymerase
  • Extension rates are specific to each PCR polymerase. In general, extension rates range from 10–60 seconds per kb
  • Longer than recommended extension times can result in higher error rates, spurious banding patterns and/or reduction of amplicon yields

Protocols

حقوق النشر

You are authorized to view the materials at this website only for your internal information purposes provided that you:
(i) retain all notices contained in the original materials
(ii) only use images with surrounding text relating to the images and
(iii) include the following copyright notice.


3 basic steps of PCR process

The polymerase chain reaction is a three step cycling process consisting of defined sets of times and temperatures.

3 basic PCR steps include:

Each of these polymerase chain reaction steps is repeated 30–40 times (cycles).

In the course of each cycle, the PCR reaction mixture is transferred between three temperatures.

Profile of 3 basic PCR steps

During successive cycles of basic PCR steps (denaturation, annealing, and extension) all the new strands will act as DNA templates causing an exponential increase in the amount of DNA produced.

Each cycle doubles the number of DNA molecules (amplicons) amplified from the DNA template.

First polymerase chain reaction step – DNA denaturation

The first of 3 PCR steps is a denaturation step.

During the denaturation step, the hydrogen bonds that hold together the two strands of the double-stranded nucleic acids are broken and the strands unwind from each other.

This process releases single-stranded DNA to act as templates in the final PCR extension step.

The denaturation temperature is above 90°C (usually 94°C) and the time is up to one minute (usually 30 seconds).

Polymerase chain reaction steps

Second polymerase chain reaction step – DNA Primer annealing

At the annealing step, DNA primers line up on exposed nucleotide sequences at the DNA target according to base-pairing rules. This is a typical temperature-dependent DNA : DNA hybridization reaction and has to be optimized.

This is the only temperature in a PCR cycle steps that can be widely varied.

The temperature depends on the exact sequence and length of the primers.

Usually, the PCR reaction mixture is cooled down to 40–60°C. However, annealing temperatures for DNA templates with a high GC content can be as high as 72°C (the normal temperature of the extension step).

The temperature for this PCR step is chosen for the optimum binding of the DNA primers to the correct DNA template and depends on primer’s melting temperature. The wrong annealing temperature can result in false products, or in no detectable products at all.

Since the primers are relatively short, and at high molar concentrations, duration of the annealing step is around 30 seconds.

At this step, the annealed oligonucleotides provide a free 3’ hydroxyl group for Taq polymerase and act as primers for synthesis of nucleic acids.

Final polymerase chain reaction step – DNA synthesis

The last of 3 basic PCR steps is called extension or elongation step.

It is the DNA synthesis step and carried out by a thermostable DNA polymerase (usually Taq polymerase).

The temperature of the elongation step is usually set at 72°C. It is slightly below the optimum for Taq polymerase.

The Taq polymerase produces complementary DNA strands starting from the primers.

The synthesis proceeds at approximately 1000 bases per minute.

Therefore, to amplify a DNA template that is 500 bases in length, under normal conditions a time of the PCR extension step should be at least 30 seconds.

Usually, PCR extension time is 30 seconds for every 500 bp (base pair) of product.


PCR: The Polymerase Chain Reaction

The polymerase chain reaction, or PCR, is a technique used to amplify DNA through thermocycling – cyles of temperature changes at fixed time intervals. Using a thermostable DNA polymerase, PCR can create numerous copies of DNA from DNA building blocks called dNTPs. There are three steps in PCR: denaturation, annealing, and elongation. Denaturation is the first step in the cycle and causes the DNA to melt by disrupting hydrogen bonds between the bases resulting in single-stranded DNA. Annealing lowers the temperature enough to allow the binding of oligonucleotide primers to the DNA template. During the elongation step DNA polymerase will synthesize new double-stranded DNA.

This video provides an introduction to the PCR procedure. The basic principles of PCR are described as well as a step-by-step procedure for setting up a generalized PCR reaction. The video shows the necessary components for a PCR reaction, includes instruction for primer design, and provides helpful hints for ensuring successful PCR reactions.

إجراء

The polymerase chain reaction or PCR is a widely used method for amplifying DNA fragments. PCR uses thermocycling, which is the repeated heating and cooling of the reaction via three distinct temperatures called denaturation, annealing and extension or elongation.

The thermocycling reaction begins once the PCR reagents are put into a thermocycler a machine, which is programmed to precisely heat and cool the reaction.

The PCR cycle begins with denaturation, which occurs for 20 to 30 seconds at 95 °C, well above the melting temperature of DNA. The melting temperature is a state where half of the DNA is a double stranded helix and the other is a single stranded random coil. The denaturation temperature is well above the melting temperature, in order to ensure that all the hydrogen bonds between complementary base pairs are broken yielding only single stranded DNAs. Paired single strands are termed the sense and antisense strands. The sequence of the sense, or coding strand, is identical to the sequence of mRNA, which will ultimately code for protein. Therefore, it makes sense. When read from left to right it begins with the 5’ phosphate and ends with the 3’ hydroxyl. The antisense strand is also called the complementary strand and begins with 3’ hydroxyl and ends with the 5’ phosphate when read from left to right.

In the second step, annealing, short pieces of DNA called primers, which are specific to the sense or antisense strands bind via hydrogen bonds. The primer that binds to the antisense strand and has the same sequence as the sense strand is the forward or sense primer. The primer that binds to the sense strand and has a sequence that is reverse and complementary to the sense strand is your reverse or antisense primer. Depending on the length of primers used the annealing temperature for this step is usually 3 to 5 °C below the lower melting temperature of your two primers. Annealing tends to occur between 50 and 65 °C and lasts for 20 to 40 seconds.

Once the primers bind to DNA they prime the reaction by creating a 3’ hydroxyl group end to which a polymerase, an enzyme that replicates DNA, will bind.

The next step called elongation or extension occurs at 72 °C, which is optimal for polymerase activity. Once bound the polymerase begins to add free nucleotide triphosphates, or dNTPs, to the ends of the primer one at a time in the 5’ to 3’ direction to make double stranded DNA.

Once elongation completes the next cycle begins. In the next cycle primers will bind to single stranded DNA formed via previous extension. The short fragment you are trying to amplify, the amplicon, will ultimately form when the polymerase extends from the forward primer on a strand that was generated by amplification from the reverse primer or vice versa. Once generated, the amount of amplicon will increase exponentially in subsequent cycles. Depending on the goal of your reaction, 20 to 40 cycles will be needed.

For long amplicons, a final elongation step is typically run at 72 °C for 5 to 15 minutes in order to ensure all DNA is double stranded. Usually, a final hold step at 4 °C is programmed into the thermocycler as a precautionary step to ensure that the DNA remains stable until taken out of the thermocycler.

The PCR reaction requires several key reagents. First is the DNA template, which is the DNA sample from which your fragment will be amplified. Then there are your primers, which are the short pieces of DNA or oligonucleotides that prime the polymerase reaction.

There are several important considerations that need to be taken when choosing your primers. First, they must be complementary to the 5’ and 3’ regions of your DNA template that flank the sequence you want to amplify. Second, they should be between 15 and 30 base pairs long and be comprised of about 50% guanines and cytosines. Third, the melting temperatures of both primers should be above 50 °C and within one to two degrees of each other so they can efficiently bind at the same annealing temperature. Fourth, they can’t be complementary to each other and form primer dimers. And fifth, they should not contain secondary structure, which is form by self-annealing within one of the primers.

In addition to the primers and DNA template, DNA polymerase is essential for the PCR reaction. The enzyme most commonly used in PCR is Taq polymerase, which is a thermostable enzyme isolated from the bacterium Thermus aquaticus that makes its home in hot springs. Taq polymerase can withstand temperatures greater than 90 °C.

dNTPs, which will comprise the base pairs in the growing strands, must also be added to the reaction. A reaction buffer, which maintains pH and contains important ions like manganese, magnesium and potassium, is also a necessary reaction component that stabilizes the reaction and provides important cofactors to the polymerase enzyme. Like all reactions, PCR needs a solvent, and so PCR grade water, which is free of ions that can inhibit the reaction, is used.

Before beginning the PCR make sure the working environment is clean to avoid contamination. Gloves must always be worn.

To help with keeping track of the various reaction components that you will need. Make a table of reagent volumes and concentrations for each of your samples including controls. In terms of volumes a typical reaction should contain 5μL of 10X reaction buffer, 4μL of 25 mM MgCl2, 1μL of dNTPs at 10 mM, 2μL of forward and reverse primers at 50 ng/μL, and 0.3μL of Taq polymerase at 5 U/μL. You want to add enough template so that 100 ng is present in the reaction. Finally, most PCR reactions are conducted in a total volume of 50μL. So a volume of PCR grade water must be used to ensure the total volume is indeed, 50μL.

Once your reaction is planned on paper assemble your reagents on ice.

Next, add your reagents to the PCR tube. First add water, then your template, your primers, buffer, magnesium chloride, and dNTPs, add Taq polymerase last and mix thoroughly.

After your reaction is setup place your sample in a thermocycler and start your PCR program. Briefly, parts of the machine consist of a thermoblock, where the PCR tube or plate is inserted and subject to precise temperature changes. A heated lid, which prevents condensation so no sample is lost and an interface with a display for programming PCR temperatures and cycle durations. Always setup your program before assembling the reaction.

Once the thermocycler has done its job. Take out your reaction and verify the PCR product with gel electrophoresis. If the PCR is successful, you should see the amplicon at the correct base pair size.

And now for some helpful hints when working with PCR. When you are trying to amplify the same PCR product from a number of different templates and therefore have a lot of different reactions to setup. It is useful to scale up the reaction to create a master mix. The PCR master mix is a large volume mixture of all the reagents shared among your samples, which is later distributed into multiple reaction tubes.

Most PCR reactions begin with an initial denaturation step, which occurs at 95°C for 1 to 9 minutes. This step ensures that all of the template is single stranded for the first amplification cycle.

Often it is desirable to use a PCR cabinet when the risk of contaminating your sample is high. To check for any contamination in your reaction it is beneficial to setup a negative control, which has no DNA template and shouldn’t produce a product in your DNA gel.

Often PCR must be optimized by adjusting temperatures, magnesium chloride concentration, or trying new primers. Once you have your PCR working. It’s a good idea to always run a positive control template, which you know will produce a product.

Many variations and applications of PCR exist for a variety of purposes.

One variation of PCR, hot start PCR, involves withholding the polymerase from the reaction until after the first denaturation step, which prevents nonspecific amplification that might occur before cycling.

PCR can also be modified to simultaneously amplify multiple DNA sequences by employing multiple primers in a single PCR reaction called multiplex PCR.

In combination with fluorescent oligonucleotide probes, PCR can actually become a technique that can measure relative or absolute levels of gene expression or how much mRNA is produced for a given gene or group of genes. This method is referred to as qPCR.

PCR can also be used to determine the presence of a particular DNA sequence in an organism. This procedure is referred to as genotyping. For example, genotyping can be used to determine the authenticity of fish samples by figuring out if a species specific sequence is present in the sample. Genotyping is also used in forensic analysis to determine if DNA found at the scene of a crime matches a suspect.

You’ve just watched JoVE’s introduction to PCR. In this video we reviewed what PCR is and how it works, the many components of the PCR reaction, the mechanism by which PCR can amplify DNA and the many variations and applications of this highly useful technique. Thanks for watching!


Creating expression template from PCR: What annealing temperature to use? - مادة الاحياء

The polymerase chain reaction (PCR) 1 is a trick for producing relatively large amounts of a specific DNA or RNA sequence from only a few molecules of template. (Keep in mind that "relatively large amounts" typically means µg of the DNA or RNA.) Thus, PCR is said to "amplify" a particular sequence. PCR has a enormous number of practical applications. For example, PCR can be used for cloning specific genes, for sequencing genes, for studying gene expression, for mapping mutations, and for making mutations. Because of its broad impact on biology, Kary Mullis recieved a Nobel Prize in 1993 for his insight in developing this technique.

PCR amplification of DNA occurs by repeated cycles of three temperature dependent steps: (1) the double-stranded DNA (dsDNA) template is denatured (2) oligonucleotide primers are annealed to the single-stranded DNA (ssDNA) template (one primer is designed to anneal to a specific region on the left side of one of the strands of DNA and the other primer is designed to anneal to a specific region on the right side of the complementary strand of DNA) and (3) DNA polymerase extends each primer in the 5' to 3' direction, duplicating the DNA fragment between the primers. With each cycle of denaturing, annealing, and synthesis the specific DNA fragment is amplified exponentially. The basic idea is shown in the following figure.

DNA synthesized during the first cycle has the 5' end of the primers and a variable 3' end. When these strands are denatured, the parental strand will rehybridize to the primer, so the product with a variable 3' end will continue to be synthesized during subsequent cycles of PCR. (Only one copy of each of the products with a variable 3' end will accumulate with each cycle.) The second cycle of denaturation, annealing, and primer extension produces discrete products with the 5' end of one primer and the 3' end of the other primer. Each strand of this discrete product is complementary to one of the two primers and thus acts as a template in subsequent cycles. Therefore, these products with defined 5' and 3' ends accumulate exponentially with each round of DNA amplification -- that is, for every ن cycles of PCR there will be 2 ن -fold amplification of the specific DNA fragment.

PCR reactions.

The purity and yield of the PCR products depend on each of the reaction conditions: the temperature during each step of the cycle the purity and sequence of the DNA template the length and sequence of the oligonucleotide primers the DNA polymerase used the concentration of Mg ++ , the buffer, and other chemicals added to the reaction and the number of cycles of PCR.

    Denature. The first step requires a high temperature to denature the dsDNA. This is typically done by briefly heating the sample to 92-94 o C.

1 The PCR process is patented by Hoffmann-La Roche Inc. Use of the PCR process requires a license. For an interesting discussion of the legal controversy over this patent, check out the article on the patent dispute from The Scientist.


Kansas State University

* Check to make sure that this isn’t already in the buffer – if it is, don’t add separately! Mg is one of the first things to change if your PCR does not work, after trying a temperature gradient. Do a gradient of 0.5mM increments.

Cycle Conditions

When you are first trying a PCR, it is often useful to do a temperature gradient. Use the following guidelines for designing your program.

Temp: 95°C. Time: 5 min on initial cycle 30 seconds to 1 min on rest

Temp: 5°C below Tm of primers no lower than 40°C. Time: 30-45 seconds. This is the step where you would use a gradient.

1 min/kb of expected product 5-10 min on last cycle.

Here is a sample PCR Program, using a wide gradient, for an expected product of about 1kb. The first step of 95 forever is just to heat the block before you add your tubes, and you would then press enter or proceed to continue to step 2. Step 8 is just to hold your PCR at a low temperature until you take it out. Do not leave in overnight!

Temperature (°ج)

The temperature gradient goes from left to right, left being the low end and right being the high end. For example, in the above gradient, all of column one is 45°C, and all of column 12 is 65°C, with the columns in between being equally spaced between that.

If, after you have tried both temperature and magnesium gradients (and checked all your reagents) your PCR still does not work, you can try using one of the following additives, listed in the order you should try them:

  • Bovine serum albumin (BSA): 10-100ug/ml
  • DMSO: 1-10%
  • Formamide: 1.25-10%
  • PEG-6000: 5-15%
  • Glycerol: 5-20%

For specific instructions on how to enter your program into the thermocycler, see the manual for the thermocycler you want to use. They are kept in the drawer to right of the machines.


Primer sequences for a taste receptor gene

Here is an example based on the human TAS2R38 gene, which encodes a taste receptor protein. In Bio 6B (assuming that you're not taking the class online), you'll use PCR to amplify a segment of this gene from your own genome. The goal of that experiment will be to examine sequence differences from one person to another (see the experiment here).

Here is the complete sequence of the protein-coding region of the TAS2R38 gene from GenBank:

The target sequence (the region you will try to amplify using PCR) is highlighted in yellow.

Here is the sequence of the entire 303-bp (base pairs, or nucleotide pairs) PCR product shown above:

AACT GGCAGAATAA AGATCTCAAT TTAT TTTATT CCTTTCTCTT CTGCTATCTG TGGTCTGTGC CTCCTTTCCT ATTGTTTCTG GTTTCTTCTG GGATGCTGAC TGTCTCCCTG GGAAGGCACA TGAGGACAAT GAAGGTCTAT ACCAGAAACT CTCGTGACCC CAGCCTGGAG GCCCACATTA AAGCCCTCAA GTCTCTTGTC TCCTTTTTCT GCTTCTTTGT GATATCATCC TGTGTTGCCT TCATCTCTGT GCCCCTACTG ATTCTGTGGC GCGAC AAAAT AGGGGTGATG GTTTGTGTT

The primer binding regions are highlighted in orange. To show how the primers fit this template sequence, here is a version of the PCR product showing only the primer binding regions, with the rest of the nucleotides represented by dots:

5' AACTGGCAGAATAAAGATCTCAATTTAT. AAAATAGGGGTGATGGTTTGTGTT 3'

As usual, this nucleotide sequence shows only one of the two strands of the DNA. It's easier to visualize the primers if you see the sequence as double-stranded, like this:

5' AACTGGCAGAATAAAGATCTCAATTTAT . AAAATAGGGGTGATGGTTTGTGTT 3'
3' TTGACCGTCTTATTTCTAGAGTTAAATA. TTTTATCCCCACTACCAAACACAA 5'

The primer sequences used in this experiment, shown in red, are:

Forward Primer 5′ AACTGGCAGAATAAAGATCTCAATTTAT 3′

Reverse Primer 5′ AACACAAACCATCACCCCTATTTT 3′ .

Take a moment to study how the primers relate to the template sequence. Each primer is the reverse complement of one of the strands of DNA and identical to the other strand. This example is like the simplified one at the top of the page, but with more realistic sequences.

Keep in mind that primer sequences, like other nucleotide sequences, are normally given from 5' to 3'. The template DNA is double-stranded, but the primers are single-stranded.

Ready for a quiz?

Soon I will give you a quiz on this, and one of the questions will ask you to determine the correct primer sequences for a given target sequence. The way to answer that quiz question is simple:

  • First (left) primer: Copy the start of the target sequence. For the quiz, I'd have to tell you how many nucleotides long the primer should be. (This is sometimes referred to as the forward primer.)
  • Second (right) primer: take the reverse complement of the 3' end of the target sequence. (This is sometimes referred to as the reverse primer.)

How to figure out the reverse complement: I hope you can do this yourself, following the example shown above. It's easy to make a mistake, though if I was doing it, I'd probably use the Reverse Complement tool at Bioinformatics.org.

Keep in mind, I wouldn't be giving you such explicit instructions if I hadn't seen a lot of students get it wrong!


مراجع

ملخص

أشرطة فيديو

PCR Education from ThermoFisher. Watch the video, "Introduction to PCR."

PCR (Polymerase Chain Reaction) Tutorial - An Introduction from Applied Biological Materials. a manufacturer of PCR products. 8:50. Starts with a good basic overview, then goes into specifics of planning PCR experiments (maybe more than you want to know on Day 1).

PCR - Polymerase Chain Reaction (IQOG-CSIC) from CanalDivulgación. Visualization of PCR steps with dramatic music and no narration.

PCR Method Video from LabXchange. Walks you through the steps of performing PCR in the lab, along with the basic concepts.

Deep background

Role of MgCl2 in PCR Reaction. Genetic Education. Magnesium ions are important in PCR for several reasons, as explained in this article.


شاهد الفيديو: Squla uitlegfilmpje Taal spreekwoorden groep 5 HD (كانون الثاني 2022).