معلومة

1.4.16.11: لماذا يهم - الفقاريات - علم الأحياء


لماذا نصنف الأنواع المختلفة من الفقاريات؟

تعتبر الفقاريات من أكثر الكائنات الحية شهرة في مملكة الحيوان. على الرغم من أنه من غير المعروف على وجه اليقين سبب انقراضها ، إلا أنه يُعرف الكثير عن تشريح الديناصورات ، نظرًا للحفاظ على العناصر الهيكلية في السجل الأحفوري.

في الوقت الحالي ، يواجه عدد من أنواع الفقاريات خطر الانقراض بسبب فقدان الموائل والتلوث. وفقًا للاتحاد الدولي للحفاظ على الطبيعة ، تم تصنيف أكثر من 6000 نوع من الفقاريات على أنها مهددة. البرمائيات والثدييات هي الفئات التي بها أكبر نسبة من الأنواع المهددة ، حيث تم تصنيف 29 في المائة من جميع البرمائيات و 21 في المائة من جميع الثدييات على أنها مهددة. تبذل محاولات في جميع أنحاء العالم لمنع انقراض الأنواع المهددة. على سبيل المثال ، خطة عمل التنوع البيولوجي هي برنامج دولي ، صادقت عليه 188 دولة ، وهي مصممة لحماية الأنواع والموائل.

بالإضافة إلى ذلك ، فإن معظم حيواناتنا الأليفة من الفقاريات: الطيور ، والثعابين ، والقطط ، والكلاب ، وما إلى ذلك. يحب البشر رفقائهم من الحيوانات ، ومن المهم فهمهم واحتياجاتهم.


القرار في الفحص المجهري

00: 00: 11.25 للضوء نفسه حبة جوهرية. وهذا هو ، يمكنك أن تأخذ
00: 00: 16.07 صورة بدقة عالية جدًا ، ولكن إذا واصلت النفخ
00: 00: 18.19 يتم تكبيرها أكثر فأكثر ، أنت لا تفعل ذلك في الواقع
00: 00: 21.08 الحصول على مزيد من المعلومات. وأود أن أتحدث عن سبب ذلك ،
00: 00: 26.03 لأن هذا له أشكال تقليدية محدودة من الفحص المجهري
00: 00: 29.28 بحد متعلق بانحراف الضوء.
00: 00: 34.07 سأشرح ما هذا. وهذا الانعراج حد
00: 00: 36.17 يقودنا في النهاية إلى بقعة ضوء صغيرة لا يمكن حلها ،
00: 00: 41.20 والتي تستند إلى شيء يعرف باسم وظيفة انتشار النقطة.
00: 00: 45.19 هذا يحد من دقة الأشكال التقليدية للفحص المجهري.
00: 00: 48.22 لذا للبدء ، أعتقد أن علينا التحدث عن سبب عدم وجود الضوء
00: 00: 54.23 تتصرف بطريقة تسمح فقط بالتكبير اللامتناهي.
00: 00: 57.16 وهذا بالنسبة لمعظمنا ، أي شخص يحمل مؤشر ليزر ،
00: 01: 01.12 تحصل على انطباع بأن الضوء ينتقل في خطوط مستقيمة. و
00: 01: 04.17 يجب أن يكون واضحًا جدًا لفهم مكان الضوء
يذهب 00: 01: 09.19 ، وأفضل مثال على ذلك للتصوير هو الأبسط
00: 01: 14.02 لجميع أجهزة التصوير ، الكاميرا ذات الثقب. انا فقط اريد ان اريك
00: 01: 18.01 صورة للكاميرا ذات الثقب هنا. الكاميرا ذات الثقب هي أ
00: 01: 22.17 جهاز به صندوق ، وهذا الصندوق به ثقب
00: 01: 29.05 فيه. وعادة ما يحتوي الصندوق على قطعة من الصور الفوتوغرافية
00: 01: 32.28 ورق داخل الصندوق. الصندوق مغلق ، لم أعرض الجوانب
00: 01: 37.22 من الصندوق. والورقة الفوتوغرافية تنظر إلى العالم
00: 01: 41.14 ويتم رؤية العالم من خلال ثقب واحد.
00: 01: 44.10 في هذه الحالة ، يتكون العالم من عمود إنارة واحد ،
00: 01: 47.17 كما هو موضح على الجانب الآخر من هذه الصورة. وفكرة
00: 01: 51.24 الكاميرا ذات الثقب واضحة جدًا. هذا الضوء من
00: 01: 54.15 يذهب كل جزء من عمود الإنارة في كل الاتجاهات ، ولكن لأن
00: 02: 00.09 الثقب موجود في مكان واحد فقط ، شعاع ضوء واحد فقط من كل جزء
00: 02: 04.04 عمود المصباح يمر عبر الثقب. لذا فإن الجزء العلوي من
00: 02: 07.12 عمود المصباح به ضوء يسير في اتجاهات عديدة ، الخطان المنقطان
00: 02: 10.24 اتجاهان يسير الضوء فيهما ويصطدم بـ
00: 02: 14.04 جدار الصندوق. لكن أحد الأشعة ، الذي هو صلب
00: 02: 18.00 يمر عبر الثقب وينتهي في الأسفل هنا.
00: 02: 21.11 وبالمثل ، يدخل الضوء من أسفل عمود الإنارة كله
00: 02: 24.22 الاتجاهات ، ولكن الضوء الوحيد الذي يمر عبر الثقب
00: 02: 27.16 هو الجزء الذي ينتهي هنا. وهكذا ينطبق الأمر على كل شيء
00: 02: 32.13 في الفضاء. لذلك إذا تركت ورق التصوير داخل ملف
00: 02: 37.07 الكاميرا ذات الثقب طويلة بما يكفي ، ستحصل على صورة جميلة جدًا
00: 02: 40.08 من العالم. وإذا كانت هذه هي الطريقة التي يتصرف بها الضوء بالفعل ، إذن
00: 02: 47.05 يجب أن نكون قادرين على عمل دقة عالية جدًا. لأن الضوء فقط
00: 02: 51.01 يتحرك في خطوط مستقيمة ، ويجب أن نكون قادرين على توسيع الكائنات.
00: 02: 54.19 على سبيل المثال ، إذا قمنا بتحريك قطعة ورق التصوير الفوتوغرافي
00: 02: 58.10 بعيدًا عن الثقب ، يكبر هذا الجسم ويصبح
00: 03: 01.20 يجب أن تكبر وتكبر ويجب أن نحصل على المزيد والمزيد
00: 03: 04.08 القرار. لذلك في النهاية ، كل حقيقة صغيرة من حقائق الحياة في
00: 03: 09.16 يجب أن ينتهي العالم الحقيقي على تلك القطعة من الورق. انه يتحول
00: 03: 12.26 ، مع ذلك ، هناك مشاكل معينة في الكاميرا ذات الثقب.
00: 03: 17.07 وهذا ما يحد من الدقة ، وأريد ذلك
00: 03: 21.09 يعطيك مثالًا واحدًا واضحًا. يمكنك أن ترى أن الثقب
00: 03: 24.19 كانت أكبر ، ستصبح هذه الصورة مشوشة لأنه سيكون هناك المزيد
00: 03: 29.12 من شعاع ضوء واحد من أعلى عمود المصباح الذي يمر
00: 03: 33.26 الثقب. وسيؤدي إلى تشويش الصورة هنا. وبالتالي
00: 03: 36.21 لن يعمل الثقب الكبير على الإطلاق. وفي الواقع ، إذا لم يكن هناك ثقب
00: 03: 40.04 على الإطلاق ، لن تحصل على صورة للعالم ، ستحصل فقط على
00: 03: 42.13 قم بإضاءة هذه القطعة من الورق. ومع ذلك ، قد تتخيل أننا يجب أن نحصل عليه
00: 03: 47.00 دقة أفضل إذا قلبنا الثقب لأسفل. سيكون أكثر حدة
00: 03: 50.16 الصورة حيث أصبح الثقب أصغر وأصغر ، مقيدًا
00: 03: 53.21 من الحصول على شعاع واحد فقط من الضوء من كل موضع
من 00: 03: 57.17 حتى. لكن الشيء المدهش في الكاميرا ذات الثقب هو
00: 04: 00.09 أنه إذا جعلت الثقب صغيرًا جدًا ، كما هو موضح هنا ،
00: 04: 02.10 والآن بعد مرور كمية صغيرة جدًا من الضوء ،
00: 04: 07.18 ثم فجأة تصبح الصورة ضبابية مرة أخرى. وهذا التشويش
00: 04: 11.04 يرجع في النهاية إلى أن الضوء لا ينتقل في خطوط مستقيمة.
00: 04: 16.12 الضوء عازم عند هذا الثقب ، إنه منحرف. وهذا الانحناء
00: 04: 21.09 الضوء هو في النهاية ما يحد من مجهر الضوء. لذلك أريد أن
00: 04: 25.04 اشرح سبب انحناء الضوء ، لأنني أعتقد أنك إذا فهمت السبب
00: 04: 29.00 ينحني الضوء ، ستفهم سبب وجود المجاهر
00: 04: 32.00 دقة محدودة. إنه ينحني لأن الضوء ليس كذلك في الواقع
00: 04: 36.19 السفر في خطوط مستقيمة ، على الرغم من حقيقة ذلك.
00: 04: 39.24 هو في الواقع أن الضوء عبارة عن موجة وتنتقل في مجملها
00: 04: 43.02 الاتجاهات. هذه ليست فكرة بديهية لمعظم الناس.
00: 04: 46.27 وفي الحقيقة ، تطلب الأمر عبقريًا عظيمًا ، رجل يُدعى كريستيان هيغنز ،
00: 04: 51.22 لاكتشاف هذه الحقيقة أولاً. كان كريستيان هويجنز هولنديًا
00: 04: 57.18 بوليماث. لقد فعل أشياء كثيرة. اخترع أشياء كثيرة.
00: 05: 00.24 كان عبقريًا في العديد من المجالات المختلفة ، وأحد مجالاته
00: 05: 04.12 كانت المزاعم العظيمة للشهرة هي البصريات الموجية. فكرة أن
00: 05: 07.26 ينتقل الضوء على شكل موجات وليس في خطوط. كانت هذه فكرته الكبيرة
00: 05: 11.07 وقد تم موازنتها بفكرة نيوتن الرائعة أن الضوء موجود
00: 05: 16.25 مصنوع في الواقع من جسيمات ، النظرية الجسيمية للضوء.
00: 05: 19.17 وبالطبع ، كلنا نعرف عن الفوتونات ، وتلك الكلمة
00: 05: 22.27 استخدم نيوتن الفوتون لأول مرة. اتضح أنهم كانوا
00: 05: 27.04 كلاهما صحيح ، وفي بعض النواحي ، كان كريستيان هويجنز كذلك
00: 05: 30.01 أقرب إلى الواقع ، على ما أعتقد ، من رؤية نيوتن للضوء.
00: 05: 33.20 لكن هذه قصة طويلة. أريد أن أخبرك ما هي نظرية الموجة
00: 05: 38.00 يقول أن الضوء في الواقع ، بدلاً من أن يكون خطًا مستقيمًا ،
00: 05: 41.09 أن الضوء يمكن اعتباره مسافرًا كموجة.
00: 05: 44.26 وقد يُنظر إلى الموجة على أنها موجة مستوية مستقيمة ،
00: 05: 52.19 وبواسطة موجة مستوية ، سيكون لديك ضوء يتحرك
00: 05: 56.04 في اتجاه مستقيم معين كما تقول هذه الأسهم. وذلك
00: 05: 59.08 تكون واجهة الموجة مثل الحاجز على الشاطئ. على امتداد
00: 06: 03.13 موجة خطية تتحرك للأمام وخلفها مباشرة بطول موجتها ،
00: 06: 09.03 موجة أخرى وخلفها موجة أخرى. لذلك كل من هؤلاء
00: 06: 12.09 خطوط عمودية تتكون من إحدى هذه الموجات. و صحيح
00: 06: 15.17 أسفل ذلك الجيب الصغير هو وسيلة لتمثيلها في بعدين ،
00: 06: 20.16 هو اتجاه الموجة فقط. الموجة صعودا وهبوطا ، ولكن الضوء
00: 06: 26.00 يتحرك يسارًا ويمينًا. إنها تسمى موجة مستوية لأنه ، في الواقع ،
00: 06: 30.19 ليس خطًا واحدًا يتحرك. لكنها في الواقع طائرة تلوح
00: 06: 35.14 وخلفها مباشرة طائرة أخرى تلوح. لهذا السبب يطلق عليه
00: 06: 38.23 موجة مستوية. تقول بصريات الموجة أنه بالإضافة إلى الموجات المستوية ،
00: 06: 42.16 يمكن للضوء أن ينتقل في اتجاهات تتقارب مع نقطة ما
00: 06: 46.15 أو تباعد. وتعرف هذه بالموجات الكروية ، أين
00: 06: 49.29 مقدمة الموجة ، بدلاً من أن تكون خطًا مستقيمًا ، هي الآن a
00: 06: 53.11 سطح منحني ، بل يمكن أن يكون كرة يسير الضوء عليها
00: 06: 56.20 للخروج من نقطة واحدة أو الالتقاء باتجاه نقطة واحدة.
00: 07: 00.07 وهناك يمكنك رسمها بهذه الطريقة. هكذا موجات كروية
00: 07: 04.10 هي انحناء دائرة أو كرة وموجات مستوية
00: 07: 09.24 سطح مستو. الآن ، كانت فكرة Huygens أن
00: 07: 16.29 لم تكن الوحدة الأولية للضوء هي الموجات المستوية هذه ، بل الموجات المستوية
00: 07: 22.03 وكانت الموجات الكروية مكونة من خانات صغيرة جدًا
00: 07: 27.12 كائنات صغيرة تسمى الآن موجات Huygens ، وهي
00: 07: 32.00 نقاط ضوئية صغيرة توزع ضوءها في كل الاتجاهات
00: 07: 35.26 ليس لها اتجاه على الإطلاق. دعا هذه المويجات
00: 07: 39.11 وحتى يومنا هذا ، نستخدم هذا المصطلح. جوانب كثيرة من طريقة أ
00: 07: 42.23 يتصرف الفوتون في الفضاء قبل أن يتفاعل مع المادة
00: 07: 45.26 يشبه إلى حد كبير موجة Huygens ، أي أن الضوء يسافر
00: 07: 49.23 في كل الاتجاهات وأين ينتهي الأمر له علاقة كبيرة بالمكان
00: 07: 53.07 لا يوجد تداخل. على عكس المكان الذي لا يوجد فيه
00: 07: 55.25 في النهاية هي مواقع يتداخل فيها الضوء. الآن سأشرح ذلك
00: 07: 59.26 في الثانية. لذلك يمكن اعتبار مويجة Huygens على أنها a
00: 08: 03.04 ينبض بنقطة صغيرة من الضوء. أعرض هنا نوعًا من الرسم التخطيطي
00: 08: 06.12 من ذلك النبض. حيث ستكون هناك نقطة ضوء وهذا النبض
00: 08: 09.28 هذا نوع من تذبذب الموجة حيث المسافة
00: 08: 14.01 بين قمم هذه الموجات هي أساسًا
00: 08: 17.16 الطول الموجي للضوء. هذه هي وحدة الضوء ، إنها صغيرة للغاية
00: 08: 21.28 وحدة. والضوء ذو الطول الموجي الأقصر يجعل المسافة أقرب
00: 08: 27.08 معًا ، وتردد النبض أعلى.
00: 08: 30.01 في أي لحظة ، قد تبدو الموجة كما هو موضح في
00: 08: 37.05 هذا الجانب على اليسار هنا ، مع سلسلة من الحلقات ، كل منها
00: 08: 42.10 والتي لها نفس كمية الطاقة. ولكن
00: 08: 44.09 كل حلقة أكبر ، واتساع الموجة يصبح أصغر
00: 08: 47.16 وأصغر حيث يخرج المرء في أي نقطة.
00: 08: 51.00 الشدة التي يراها المرء هي مربع سعة الموجة ، و
00: 08: 57.26 ثم على المرء أن يدمج ذلك على طول موجي واحد على الأقل.
00: 09: 01.16 لذلك يكون للمرء نقطة مضيئة جدًا ، ثم تصبح باهتة بشكل تدريجي
00: 09: 04.10 ضوء إذا قمت بدمج تأثير الموجة بمرور الوقت.
00: 09: 08.26 إذن كيف تفسر هذه الموجات الموجات المستوية والموجات الكروية؟
00: 09: 13.18 من السهل رؤية رسومات Huygens الأصلية ، وهنا
00: 09: 18.21 نسخة أكثر حداثة من هذه الرسومات. وهو أن أ
00: 09: 21.21 موجة مستوية ، كما هو موضح هنا في هذا الرسم البياني ، هي مجرد سلسلة
00: 09: 25.24 من الموجات المصطفة في خط مستقيم ، كما هو موضح هنا.
00: 09: 30.04 وهذه الموجات لها حافة مقدمة ، وهي مقدمة الموجة
00: 09: 35.16 لكل منهم. وهذا خط من تلك الحواف الأمامية
00: 09: 40.16 يعطي خطاً مستقيماً. وفي هذا الاتجاه ، لا يوجد شيء
00: 09: 43.19 للتدخل معهم ، بحيث يتحرك للأمام والتالي
00: 09: 46.16 تأتي الموجة خلفها مباشرة. الموجات الكروية متشابهة
00: 09: 51.28 فكرة ، ولكن بدلاً من أن تكون خطًا مستقيمًا من الموجات ، فإن
00: 09: 55.11 توجد موجات على سطح الكرة. ويمكنهم أن يكونوا كذلك
00: 09: 59.29 متباعد ، لذلك يترك الضوء نقطة وينتشر
00: 10: 02.15 في الفضاء ، أو متقاربة كما لو كان الليزر مركّزًا على بقعة
00: 10: 07.06 في عينة. وراء البقعة ، يتباعد الضوء. لذا أ
00: 10: 11.05 تولد الموجة الكروية المتقاربة موجة كروية متباعدة.
00: 10: 14.21 هناك موجات كروية وموجات مستوية. حاليا،
00: 10: 18.01 كيف يساعدنا هذا في فهم كيفية حدوث الثقب عند حدوثه
00: 10: 21.28 صغير لا يعمل؟ هذا موضح هنا. عندما يكون لديك ملف
00: 10: 27.04 الافتتاح ، ولديك موجة مستوية مع مجموعة من الموجات
00: 10: 31.18 مصطفًا أسفل هذا الثقب ، إذا كان الثقب صغيرًا جدًا
00: 10: 35.27 يمر عدد قليل فقط ، ربما موجة واحدة فقط. وذلك
00: 10: 39.12 تنشر الموجة ضوءها في كل الاتجاهات. و
00: 10: 43.01 وهو ما يعرف بالحيود. وهذا الانعراج يفسر
00: 10: 46.29 لماذا إذا أصبح الثقب صغيرًا جدًا ، فلن ينتقل الضوء
00: 10: 49.24 في خط مستقيم ، ينحني في كل هذه الاتجاهات المختلفة.
00: 10: 53.08 وهذا تقريب نظري ، ومع ذلك كل التجارب
00: 10: 58.20 يقترح أن هذه هي الطريقة التي يتصرف بها الضوء في الواقع.
00: 11: 01.17 الآن ، هناك شيء مثير للاهتمام وهو إذا كان لديك اثنان من الموجات
00: 11: 05.18 أو أكثر من نفس المصدر ، والتي تعد جزءًا من
00: 11: 08.28 نفس الضوء النابض الأصلي ، وبالتالي فهي متماسكة.
00: 11: 13.15 أطوالهم الموجية متزامنة مع بعضها البعض. ثم يمكن للمرء أن يكون
00: 11: 17.13 أنماط تداخل مكونة من عدة أطوال موجية.
00: 11: 21.04 أولاً في المثال ذي الثقب الواحد ، سوف يضيء الصندوق
00: 11: 26.07 تسير في كل الاتجاهات. لكن الضوء الخارج سوف ينحني ،
00: 11: 28.26 هذا هو الحيود. ثم في المثال الثاني ، إذا كان هناك أحد
00: 11: 33.18 أكثر من مصدر واحد ، على سبيل المثال ، مصدر الضوء الذي
00: 11: 36.29 ثم يمر عبر شقين ، أحدهما يرى في الطرف الآخر
00: 11: 40.25 بدلاً من مجرد إضاءة موحدة ، نمط نطاقات مضحك.
00: 11: 44.19 تدخل هدام وبناء. يمر الضوء
00: 11: 47.26 ثقب واحد ثم بعد أن يمر عبر ثقبين آخرين ،
00: 11: 53.00 تحصل على هذا التفاعل الغريب للأماكن التي توجد فيها الشارة
00: 11: 58.01 فوق بعضها البعض ، حيث يتم جمع القيعان معًا
00: 12: 01.23 في اتجاه سلبي والأماكن التي يكون فيها أحد القاع
00: 12: 04.19 وواحد قمة ، ويبطلان معًا. حتى هنا في
00: 12: 08.29 الوقت اللحظي هو نمط معقد من الموجات
00: 12: 12.28 بناءً على تفاعلات موجتين مختلفتين.
00: 12: 16.11 وأريد تفريغ هذه الفكرة أكثر قليلاً ، حتى تتمكن من ذلك
00: 12: 19.13 كيف تعمل المجاهر الضوئية. لذلك إذا كان لدينا ضوء
مصدر 00: 12: 23.07 ، كما هو موضح ، يرسل ضوءه في كل الاتجاهات ،
00: 12: 28.13 ثم يولد ذلك موجة كروية مكونة من
00: 12: 31.13 مجموعة من الموجات ، قد تمر إحدى المويجات
00: 12: 34.25 طفيفًا هنا ويولد نمطًا مويجًا على الآخر
00: 12: 39.29 جانب هذا الثقب. هناك شق ثان في هذا الصندوق ، وهناك
00: 12: 46.20 ثانية مويجة مرت. ومعا تلك الموجات
00: 12: 51.02 تتفاعل بطرق تجمع أو تطرح من بعضها البعض.
00: 12: 55.09 وهناك نمط التفاعل هذا. لذلك دعونا نلقي نظرة على هذا النمط
00: 12: 59.28 بتفاصيل أكثر بقليل. إذا ذهبنا إلى موضع يكون فيه الاثنان
00: 13: 04.21 فتحات المويجات على مسافة متساوية تمامًا من تلك النقطة ،
00: 13: 09.26 عندئذٍ سيكون كلاهما متوجًا أو منخفضًا في تلك المسافة.
00: 13: 14.13 ولذا سيكون هناك تداخل بناء. إذا ذهبنا إلى موقف
00: 13: 19.12 حيث يكون أحد المسافات بالضبط نصف طول موجي
00: 13: 22.29 أطول من الآخر ، سيكون لأحدهما تداخل مدمر.
00: 13: 26.14 لذلك سيكون هناك ضوء ساطع حيث تتداخل بشكل بناء و
00: 13: 30.26 لا يوجد ضوء حيث تتداخل بشكل مدمر. وهذا هو السبب
00: 13: 35.08 ينتهي بهذا النمط من الأشرطة الساطعة والمظلمة ، لأن واحدًا
00: 13: 38.28 يمكن أن يكون الطول الموجي بعيدًا عن بعضهما البعض ، ويمكن أن يكون واحدًا واحدًا
00: 13: 42.15 الطول الموجي أطول من الآخر ، وستظل تحصل عليه
00: 13: 45.11 تداخل بناء. ولكن إذا كان الطول الموجي 1.5
00: 13: 48.22 الاختلاف في طول المسار ، فسيكون أحدهم مدمرًا
00: 13: 52.05 بالنسبة للآخر. لذلك واحد لديه عصابات الضوء والظلام ذلك
00: 13: 54.23 انتقل إلى نطاق واسع هنا. فكيف يساعدنا هذا
00: 13: 59.04 فهم المجاهر؟ حسنًا ، دعنا نراجع الطريقة لثانية
00: 14: 02.13 تم تصميم مجهر. لذلك يأخذ المجهر
00: 14: 05.23 ضوء من عينة ، معروض هنا ، وفي هذه الحالة ،
00: 14: 09.19 هناك نقطة واحدة فقط من الضوء تولد شكلًا كرويًا
00: 14: 12.09 موجة. وما يفعله المجهر هو تلك النقطة
مصدر 00: 14: 17.29 ، الذي يولد موجة كروية تتباعد ،
00: 14: 21.05 هو أن العدسة الشيئية تجمع بعد ذلك جزءًا فرعيًا من ذلك
00: 14: 27.22 موجة كروية وتحول هذا الضوء إلى موجة مستوية.
00: 14: 33.00 لأن المجهر مصمم بحيث تكون العينة
00: 14: 36.26 يقع المستوى بالضبط على البعد البؤري لتلك العدسة. وبالتالي
00: 14: 40.13 تتحول تلك الموجات الكروية إلى موجات مستوية ، وهذه الموجات المستوية
00: 14: 44.08 موجات ثم تنتقل عبر أنبوب المجهر حتى تصل
00: 14: 49.10 تصل إلى العدسة الأنبوبية ، وهي عدسة إيجابية أخرى تأخذها الآن
00: 14: 54.00 موجة مستوية وتعيدها للخلف ، العدسة الأنبوبية تفعل ذلك ، تديرها
00: 14: 58.17 تعود الموجة المستوية إلى موجة كروية متقاربة.
00: 15: 02.04 وتنتهي تلك الموجة الكروية كنقطة هناك. وهذا
00: 15: 07.04 يسمح لنا بطرح السؤال التالي ، وهو عبارة عن نقطة
00: 15: 12.04 كائن في النقطة المحورية ، مثل فلورسنت صغير متناهٍ في الصغر
00: 15: 16.10 حبة ، ما هو توزيع الضوء في مستوى الصورة أو بالقرب منه؟
00: 15: 20.08 وكيف تنتشر هذه النقطة؟ هل ينتشر ، أولا وقبل كل شيء ، وإذا
00: 15: 24.18 انتشاره ، ما هي وظيفة هذا السبريد؟
00: 15: 26.28 كيف ينتهي به الأمر في توزيع معين؟
00: 15: 31.10 لذلك سوف نمر بنفس فكرة الموجات ،
00: 15: 33.28 ولكن الآن انظر إليها في حالة وجود صورة كروية متقاربة
00: 15: 39.04 موجة. سنلقي نظرة على ذلك الجزء من المجهر ،
00: 15: 41.19 لأن هذا هو المكان الذي تتولد منه أنماط التداخل
00: 15: 45.19 مزيج معقد من التركيز إلى نقطة ما ، بالإضافة إلى الضوء المحيط
00: 15: 50.29 تلك النقطة. إذن ، هذا الآن خارج العدسة الأنبوبية. العدسة الأنبوبية
00: 15: 55.09 يظهر في أقصى نهاية هذه الصورة ، هناك ملف
00: 15: 58.08 موجة كروية متقاربة تتكون من مجموعة من الموجات.
00: 16: 00.19 وكل من تلك النقاط اللانهائية في مقدمة الموجة الصاعدة
00: 16: 04.11 يتصرف مثل مصدر الضوء الخاص به ، مثل Huygens
00: 16: 08.00 مويجة. هذه هي كل نقطة تنبعث منها موجة ، ترسل الضوء
00: 16: 11.17 في كل الاتجاهات. وجميع الموجات من نفس الموجة
00: 16: 14.20 الجبهة متماسكة بشكل متبادل ، تتأرجح في تزامن.
00: 16: 17.17 وبسبب ذلك ، يمكنهم التدخل بطريقة ثابتة.
00: 16: 21.06 لذلك يتداخلون مع بعضهم البعض بشكل متوقع للغاية
00: 16: 23.19 النمط. فلنبدأ الآن باثنين فقط من تلك الموجات.
00: 16: 29.14 واختيار موقع تعسفيًا في منتصف المسافة بينهما
00: 16: 34.10 حيث يكون هذا الخط العمودي ، حيث المسافة D1 و D2
00: 16: 38.11 متطابقة. المسافة هي نفسها ، هاتان الموجتان
00: 16: 42.02 يكون كلاهما في الحضيض والذروة أو بينهما تمامًا
00: 16: 46.11 نفس النقطة. وبالتالي ، إذا جمعت هاتين الموجتين
00: 16: 49.13 معًا ، إنهما في مرحلة وستصبح بنّاءً
00: 16: 52.19 تداخل. في التمييز ، إذا حركنا D1 و D2 إلى الأسفل قليلاً
00: 16: 59.19 ذلك الخط العمودي ، أحد هؤلاء الآن نصف طول موجي
00: 17: 03.18 أطول ، الجزء العلوي ، D1 هو نصف طول موجي أطول مسافة
00: 17: 08.10 من الأسفل ، D2. وهكذا عندما تصل هاتان الموجتان
00: 17: 11.14 تلك النقطة ، لقد تجاوزوا المرحلة. بالضبط نصف طول الموجة خارج
00: 17: 15.17 من الطور ، وإذا جمعت هذين الجيوب الأنفية ، فسوف تقوم بذلك
00: 17: 18.22 ينتهي به الأمر مع تداخل مدمر كامل وبدون ضوء.
00: 17: 21.14 إذا ذهب المرء إلى أسفل قليلاً ، فإن D1 الآن أطول بكثير
00: 17: 26.19 من D2. في الواقع ، طول موجي واحد بالضبط أطول من D2.
00: 17: 30.14 إذا جمعت هاتين الموجتين ، فستحصل على الامتلاء
00: 17: 33.25 دورة خارج المرحلة ، لكنها بلغت ذروتها في نفس النقطة
00: 17: 38.28 وهذا يولد تداخلا بناء. وهكذا هنا
00: 17: 44.01 الأنماط التي يراها المرء على الفور في الأعلى. و في
00: 17: 48.09 متكاملة بمرور الوقت ، في الجزء السفلي. ويمكنك أن ترى
00: 17: 52.15 أن القيعان وقمم التداخل على
00: 17: 56.14 الجزء العلوي تحول الآن إلى موجبات وأصفار.
00: 18: 01.04 لا توجد سعة سالبة عند تربيع السعات الآن
00: 18: 04.15 كل شيء بسعة موجبة أو صفر. وهذا التدخل
ينتهي نمط 00: 18: 09.15 بسلسلة من العصابات. حتى لحظة
00: 18: 12.19 في الوقت المناسب في الأعلى ، هناك شبكة مظلمة ومشرقة
00: 18: 15.28 سطورًا. لكن الكواشف ، بما في ذلك العين ، لا ترى
00: 18: 19.21 السعة. نحن نجمع الكثافة. والشدة هي الإضافة
00: 18: 24.19 لدورة كاملة من تلك الموجات وتربيع النتيجة.
00: 18: 29.04 ونمط التداخل المكتشف الآن مظلم و
00: 18: 32.02 خطوط ساطعة. وفي المنتصف يوجد خط أبيض
00: 18: 34.08 يعمل أفقيًا ، وهذا هو المكان الذي يوجد فيه الاثنان
00: 18: 38.12 تتداخل الموجات بشكل متبادل على طول الطريق
00: 18: 43.20 هذا الطول. المناطق المظلمة هي التداخل المدمر ، و
00: 18: 47.16 المناطق الساطعة هي التداخل البناء. لذلك تعاملنا
00: 18: 49.15 مع اثنين من الموجات. والآن أريد فقط أن أتحدث قليلاً عن ذلك
00: 18: 53.15 طريقة عمل المجاهر ، بمعنى أنه لا يوجد شيء
00: 18: 57.19 حتى الآن فيما قلته من شأنه أن يخبرك بمكان ملف
00: 19: 00.17 مستوى الصورة لتلك الموجات الكروية المتقاربة.
00: 19: 03.26 يوجد نمط من العصابات الفاتحة والداكنة فقط. أنت ذاهب إلى
00: 19: 07.06 نرى أن هذا النهج ، دون أي فهم إضافي
00: 19: 11.10 لبصريات الأشعة ، يولد مستوى الصورة عند مستوى معين
00: 19: 15.06 إلى حد كبير لأن هذا هو المكان الوحيد الذي توجد فيه جميع الموجات
00: 19: 20.11 يمكن أن يكون في المرحلة في نفس الوقت. لكن قبل الحديث عن ذلك ، نحن
00: 19: 24.18 يجب أن يتعامل مع حقيقة أن المجهر أهداف
00: 19: 26.23 يأتي بنكهات عديدة. والنكهة الخاصة التي أريد أن أتحدث عنها
00: 19: 30.06 الآن ليس الفرق في التكبير ،
00: 19: 32.20 والتي يعتقد العديد من علماء الميكروسكوبت أنها الأهم
00: 19: 38.05 جانب من كائن ، لكنه ليس كذلك. ما يهم حقًا لـ
00: 19: 42.05 جودة الهدف وقوة حله هي العددية
فتحة عدسة 00: 19: 45.16 ، غير متوفر. و NA لها وصف غريب ، فهو
00: 19: 50.19 مؤشر انكسار المادة بين المجهر
00: 19: 53.25 الهدف والشريحة ، والتي ستكون قريبة جدًا في الهواء
00: 19: 57.24 1 ، أو 1.0. لكن في الماء أو الجلسرين أو الزيت ، يمكن أن يكون هذا الرقم
00: 20: 03.22 أعلى. ضرب جيب نصف الزاوية بين عمودي
00: 20: 08.16 وأكبر انحراف للضوء يمكن أن يكون
00: 20: 13.25 التي جمعتها الهدف. لذلك فهي عدسة ذات فتحة عددية منخفضة
00: 20: 17.25 كما هو موضح في A ، له مخروط ضيق يمكنه تجميع الضوء
00: 20: 22.04 الخروج من العينة. لذلك إذا كان لديك فلورسنت
00: 20: 25.02 عينة ترسل الضوء في جميع الاتجاهات ، أنت تجمع فقط
00: 20: 27.29 كمية صغيرة ذات فتحة عددية منخفضة.
00: 20: 30.22 عدسة ذات فتحة عددية متوسطة لها عدسة أكبر قليلاً
00: 20: 34.14 المخروط الذي يجمعه. وعدسة ذات فتحة عددية عالية
00: 20: 37.15 يحتوي على أعلى مخروط على الإطلاق. إنها حقيقة وسأحاول شرحها
00: 20: 42.08 لماذا ، كلما زادت الفتحة العددية ، كان ذلك أفضل
00: 20: 45.04 قوة التحليل للميكروسكوب. وعلينا أن نعود إلى ذلك
00: 20: 48.25 صورة مويجة وانظر إلى الفرق في الأعلى بينهما
00: 20: 52.09 هدف ذو فتحة عددية عالية وفي الأسفل هدف منخفض
00: 20: 56.06 هدف الفتحة العددية. لذلك في كلتا الحالتين ، لدينا مويجة
00: 20: 59.12 يولد ضوءًا وترى أنك تجمع جزءًا أكبر
00: 21: 03.07 لتلك الموجة الكروية بعدسة NA العالية. لذلك أكبر
00: 21: 10.03 كمية الضوء التي يتم تجميعها ، والتي تولد أ
00: 21: 12.11 أكبر ، في الأساس موجة مستوية أكبر ، هذا في النهاية
00: 21: 17.14 يذهب إلى العدسة الأنبوبية. ثم من العدسة الأنبوبية ،
00: 21: 21.02 تم تحويلها إلى موجة كروية متقاربة.
00: 21: 24.28 لذا مع فتحة العدسة الرقمية العالية ، لديك المزيد
00: 21: 27.09 الموجة الكروية مجمعة. وهكذا تقوم بتوليد أكبر
00: 21: 31.22 موجة كروية تتجه نحو مستوى الصورة. مع
00: 21: 36.16 عدسة ذات فتحة عددية منخفضة ، لديك كمية أقل
00: 21: 40.02 تم جمع الموجة الكروية. وحواف ذلك
00: 21: 46.00 موجة كروية قريبة جدًا من بعضها ، بالنسبة إلى ارتفاع عددية
فتحة العدسة 00: 21: 50.14 حيث أقصى الأجزاء الكروية
00: 21: 55.25 الموجة المتقاربة بعيدة كل البعد عن بعضها البعض. وهذا ما اتضح
00: 22: 00.06 لتكون الميزة الحاسمة للدقة ، كما سترى.
00: 22: 02.26 لذلك إذا قارنا الموجات القصوى من المنحني
00: 22: 08.07 موجة كروية في عدسة ذات فتحة عددية عالية ومنخفضة
00: 22: 12.01 عدسة بفتحة رقمية ، يمكنك أن ترى تأثير ذلك
00: 22: 15.21 هو نمط مختلف من النطاقات عند هذا التعسفي
00: 22: 20.17 الموضع هنا ، والذي سيكون مستوى الصورة ولكن لا يوجد شيء حتى الآن يخبرك
00: 22: 24.10 لماذا. لأن اثنين من الموجات لا تركز على الصورة. لذلك
00: 22: 28.15 أدق التفاصيل تحدد أدق التفاصيل التي يمكن العثور عليها في ملف
00: 22: 32.08 الهدف. هذا ما يحد من دقة الصورة ، كيف
00: 22: 36.13 جيد أن نمط النطاقات هو. وهذه الفترة هي المسافة
00: 22: 40.24 بين المناطق المضيئة والمظلمة مرتبط بالرقم
فتحة عدسة 00: 22: 45.26. إذا كانت الموجتان متباعدتان ، فإن التداخل
00: 22: 50.00 يسمح بمجموعة ترددات عالية جدًا من النطاقات الداكنة والفاتحة. إذا كان الاثنان
00: 22: 56.19 الموجات قريبة جدًا من بعضها ، كما هو الحال في الفتحة الرقمية المنخفضة
00: 22: 58.28 عدسة ، ثم يكون النطاق منتشرًا بشكل أكبر. وهذا يحد من
00: 23: 03.09 أدق التفاصيل في مستوى الصورة. لنحاول الآن ألا ننظر إلى اثنين فقط
00: 23: 07.17 المويجات ، لكن أضف المزيد والمزيد من الموجات إلى ذلك التقارب
00: 23: 10.18 موجة كروية. وانظر ماذا يحدث للنمط المتكامل
00: 23: 14.22 من التداخل لأسفل على مستوى يصبح في النهاية مستوى الصورة.
00: 23: 20.00 إذن ، أولًا ، الفتحة الرقمية العالية تعطي فترة هامشية قصيرة و
00: 23: 24.02 يعطي هوامش ضيقة. تعطي الفتحة العددية المنخفضة هامشًا طويلاً
00: 23: 26.26 فترة وهامش واسعة. حتى الآن ، مهما كانت الفتحة العددية
00: 23: 31.26 لدينا ، سيكون لدينا موجة كروية متقاربة
00: 23: 34.02 هذا هو المحيط الأزرق الذي يراه المرء في الجزء العلوي من هذا
00: 23: 37.27 الصورة ، العدسة الأنبوبية أعلى. والآن ما أريكم إياه هو
00: 23: 42.23 اثنان من الموجات عند حافة العدسة ، بالإضافة إلى موجة واحدة عند حافة العدسة
00: 23: 49.20 المركز. لذلك تتدخل ثلاث موجات. ونحن ننظر إلى
00: 23: 53.20 النمط الذي تم إنشاؤه بواسطة هذه الموجات الثلاثة بعدنا
00: 23: 57.19 تكامل على طول موجي وتربيع النتيجة.
00: 24: 02.17 الكثافة المسجلة هي سلسلة أنماط الأعمدة التي تدور
00: 24: 06.15 في الجزر ، بدلاً من الخطوط ، لدينا الآن جزر
00: 24: 10.21 مشرق وداكن. وعلى مستوى الصورة ، الذي سينتهي به الأمر
00: 24: 14.26 حيث يوجد هذا الخط هنا ، يرى المرء أن هناك جزيرة
00: 24: 20.05 من السطوع تمامًا في المركز ، وهذا بسبب ذلك
00: 24: 23.07 نقطة هناك ، فأنت على مسافة متساوية من تلك الموجات الثلاثة
00: 24: 26.08 لأن هذه النقطة هي مركز الدائرة التي لها هؤلاء
00: 24: 30.26 توجد ثلاث موجات على محيط تلك الدائرة. وبالتالي
00: 24: 34.11 هم على بعد متساوٍ من تلك النقطة وهذا هو سبب ذلك
00: 24: 38.01 حيث يتم تركيز الصورة عند تلك النقطة للعينة
00: 24: 42.00 الموجود في وسط حقل الصورة.
00: 24: 45.00 وألمع شريحة موجودة هناك بسبب التداخل
00: 24: 49.17 النمط هو الأقوى لأنك حصلت على ثلاث موجات
00: 24: 52.08 في المرحلة هناك ، أفضل من أي مكان آخر.
00: 24: 55.01 إذا نظرنا إلى خمس موجات ، فقط أضف اثنين آخرين إلى جانب الثلاثة
00: 25: 00.19 التي تحدثت عنها بالفعل ، مرة أخرى هي الحافة الأكثر إشراقًا
00: 25: 03.27 في مركز مستوى الصورة ، لأن هذا هو المستوى
00: 25: 07.16 ضع جميع العناصر الخمسة مترابطة بشكل متبادل. فى اى مكان اخر
00: 25: 12.01 بعض التداخل بطريقة سلبية يؤدي إلى تدمير
00: 25: 16.07 شدة. وجميع الأطوال الموجية في طور في مركز
00: 25: 19.23 مستوى الصورة. وهذه هي المنطقة الأكثر إشراقًا. ويمكنك
00: 25: 22.20 انظر كلما أضفت المزيد والمزيد من التباين والتحسين ،
00: 25: 26.10 بجانب هذه الجزر الثلاث المضيئة ، هناك الكثير من القليل
00: 25: 30.23 فصوص جانبية باهتة. هذه خمس موجات.
00: 25: 34.19 إذا ذهبنا إلى تسعة موجات ، تصبح الصورة أكثر استقامة
00: 25: 39.27 إلى الأمام بطريقة ما ، وهذا هو المكان الوحيد الذي يوجد فيه كل هؤلاء
00: 25: 43.02 الموجات في طور لأنها متساوية البعد عن كل منها
00: 25: 45.24 آخر ، في تلك المرحلة هناك. وجميع المويجات
00: 25: 51.15 في المرحلة هناك ، وهذه هي الذروة الرئيسية. لكن هناك
00: 25: 55.11 هذه المجموعة من النطاقات على جانبي تلك النقطة. الآن إذا كنا
00: 26: 00.16 فقط اجمع كل المويجات معًا ، هذه هي وظيفة انتشار النقطة ، هذه هي
00: 26: 04.16 الانتقال من تسعة موجات إلى عدد لانهائي. دعنا نذهب
00: 26: 07.26 من خلال شكل هذا الكائن الآن. كل المويجات
00: 26: 12.02 في المرحلة في مركز مستوى الصورة ، يتركز الضوء
00: 26: 16.03 في منتصف مستوى الصورة. كل من الهوامش أو
00: 26: 19.17 الفصوص الجانبية باهتة بشكل تدريجي. في الواقع ، أنت بحاجة إلى كثافة معززة
00: 26: 24.09 لرؤيتهم ، كما هو موضح في هذه الصورة الأفقية السفلية.
00: 26: 28.11 ومعظم الضوء يُرى الآن داخل مخروط ، يبدو أن كل شيء
00: 26: 33.03 لقد ترك التداخل القليل جدًا من الضوء خارج هذا التقارب
00: 26: 39.07 مخروط من الضوء يركز على العينة ثم يعيد تشعبه.
00: 26: 42.29 هذا شكل الساعة الرملية. وهذا لا يأتي من خلال
00: 26: 46.14 بصريات الأشعة ، ولكن فقط من خلال تداخل الموجات.
00: 26: 49.11 يتم تحديد عرض الذروة الرئيسية بواسطة الموجات القصوى ،
00: 26: 55.04 الاثنان على طرفي الغطاء الكروي. وهذا هو
00: 27: 00.24 تم ضبطه بواسطة الفتحة العددية. لذا حجم الصورة
00: 27: 04.23 لنقطة صغيرة جدًا مرتبط بمدى تباعد هؤلاء
00: 27: 09.16 الموجات هي. كلما تباعدوا ، زاد تركيزهم
00: 27: 12.15 هذا الكائن. وهذا هو سبب وجود الفتحة العددية
00: 27: 16.07 ضروري. لذلك إذا قارنا تأثير الفتحة العددية
00: 27: 19.24 في وظيفة انتشار النقطة ، وهي فتحة عددية عالية مقارنةً بفتحة منخفضة
00: 27: 23.02 فتحة عددية ، ترى فرقًا عميقًا. مع ارتفاع
00: 27: 26.07 فتحة عددية ، يوجد فاصل أوسع بين الموجات ،
00: 27: 28.26 وهو أمر ممكن لأنهما بعيدان عن بعضهما البعض. نتيجة ل،
00: 27: 33.09 توجد قمة مركزية صغيرة ، بينما توجد قمة رقمية منخفضة
00: 27: 36.05 عدسات فتحة العدسة ، فقط فاصل ضيق بين
00: 27: 39.19 من الممكن استخدام الموجات ، لذلك لديك قمة مركزية واسعة
00:27: 42.14 ودقة أقل. لذا ، دعونا الآن نفكر في هذا من حيث
00: 27: 48.20 لما تبدو عليه صورة النقطة. لذلك إذا ركزنا الآن
00: 27: 54.11 ليس في الاتجاه المحوري ، ولكن بالنظر إلى أسفل على سطح الصورة
00: 28: 01.27 نقطة ، في المستوى البؤري مباشرةً ، ستظهر النقطة في العينة
00: 28: 06.13 كنقطة صغيرة. تسمى هذه النقطة بالقرص الهوائي لأن
00: 28: 12.19 إذا قمت بتحسين التباين ، فستجد أن النقطة محاطة بها
00: 28: 17.01 حلقات الضوء الخافتة هذه ، وهو نمط الانعراج
00: 28: 21.26 النقطة. هذه هي وظيفة انتشار النقطة في واحد
00: 28: 25.12 طائرة واحدة. Airy هو اسم باحث ، أعتقد أنه كان كذلك
00: 28: 32.02 عالم فلك رأى أنماطًا جيدة التهوية حول النجوم
00: 28: 35.15 وأدرك أن هذا كان من صنع الحيود.
00: 28: 38.12 ليست حقيقة أن كل نجم لديه حلقات حوله. PSF هو
00: 28: 43.26 سلسلة من الحلقات متحدة المركز ، والحلقات الأكبر لها تدريجيًا
00: 28: 48.11 أقل - كلما ابتعدت الحلقات ، انخفض بشكل تدريجي
00: 28: 52.15 الشدة. وإذا كان عليك تذكر أي شيء في
00: 28: 56.06 المجهر الضوئي ، من حيث المعادلات ، سيكون كذلك
00: 28: 58.12 هذا. أن المسافة من مركز القرص متجدد الهواء ،
00: 29: 02.15 تلك الدائرة المركزية ، إلى الحلقة المظلمة الأولى ، تساوي 0.61 ضعف
00: 29: 10.01 الطول الموجي للضوء ، لامدا مقسومًا على العددي
فتحة العدسة 00: 29: 13.16. 0.61 لامدا على NA. تريد أن تحمل
00: 29: 17.08 حول أي حقيقة عن المجاهر الضوئية ، هذه هي الحقيقة
00: 29: 20.16 يجب أن تحملها معك. لأنه كما سترى هذا هو ملف
00: 29: 22.28 حد دقة المجهر الضوئي ، 0.61 لامدا فوق NA
00: 29: 26.23 هي المسافة من المركز إلى أول حلقة مظلمة. يمكن للمرء أيضا
00: 29: 30.17 انظر إلى النمط المتجدد في الاتجاه غير الجانبي ، ولكن في
00: 29: 34.05 اتجاه محوري ، في XZ. X هو الجانب ، و Z هو
00: 29: 39.23 مستوى عمق. ويرى المرء أن نمط المنطقة ليس كذلك
00: 29: 43.19 دائرة ، لكن أكثر من القطع الناقص. ومرة أخرى ، هناك اثنان
00: 29: 47.21 - إذا قمت بتحسينه ، فهناك نقطتان مظلمتان في هذا الاتجاه
00: 29: 51.16 وهذه مسافة أطول. يتم تحديده من خلال معادلة أخرى
00: 29: 55.12 ضعف مؤشر انكسار المادة بين
00: 29: 58.23 الهدف والعينة ، لذلك 2 مرات n من الطول الموجي ،
00: 30: 02.22 مقسومًا على مربع NA. ولفتحة عددية عالية
00: 30: 06.08 عدسات ، يكون هذا أحيانًا أكبر بثلاث مرات
00:30: 09.17 من قرار XY. لذلك المجاهر الضوئية في جوهرها
00: 30: 12.26 لديها دقة أفضل قليلاً في المستوى الجانبي من
00: 30: 16.24 القدرة على تمييز مستوى واحد عن الآخر في العمق
00: 30: 20.03 طائرة. لذا ، هل يمكننا استخدام هذا لمساعدتنا على فهم الدقة
00: 30: 26.28 في مجهر ضوئي؟ هذا 0.61 لامدا فوق NA.
00: 30: 30.18 المسافة بين المركز وذروة الظلام الأولى.
00: 30: 33.03 هناك ، إذا فكرت في هذا ، فهذه هي الأرقام
00: 30: 37.07 محسوبة لعدسة ذات فتحة عددية عالية ، 1.4
00: 30: 42.01 عدسة بفتحة رقمية بضوء عند 480 نانومتر. يمكنك ان ترى
00: 30: 48.00 أن الدقة الجانبية ، وسأشرح سبب حلها
00: 30: 51.04 هي 225 نانومتر ، بينما دقة المحور Z هي 861 نانومتر.
00: 30: 58.06 ليست بنفس الجودة تقريبًا. إذن ما مدى قربه من شخصين
00: 31: 05.27 يجب أن تكون المصادر النقطية ولا تزال تعتبر نقطتين؟
00: 31: 09.25 هذا هو في الأساس مسألة الحل. إذا كان هناك كائنين
00: 31: 13.16 قريبًا ، وما زلت تعتقد أنهما كائنات منفصلة ، إذن
00: 31: 17.02 يمكنك حلها. إذا اختلطوا معًا ، فلا يمكنك حلها.
00: 31: 20.28 إذن هنا ، على سبيل المثال ، مصدران من نقطتين. وهم يتحركون
00: 31: 24.09 أقرب بشكل تدريجي. هناك يجلسون فوق كل
00: 31: 27.22 أخرى في الأسفل ، وهما متباعدان في الأعلى.
00: 31: 30.02 لن يختلف أحد على أنهما نقطتان في الأعلى. لا احد
00: 31: 33.10 أعتقد أن هذه نقطتان في الأسفل. كيف يمكننا
00: 31: 36.16 تقرر متى يمكن حل هاتين النقطتين؟ هذا في بعض الأحيان
00: 31: 40.28 المعروف بمعيار رايلي. إنه معيار تعسفي.
00: 31: 43.24 ليس معيارًا مقبولًا بشكل عام يقوله الجميع
00: 31: 48.02 يخبرك بالدقة ، لكن معظم علماء الميكروسكوب يستخدمون رايلي
00: 31: 51.07 المعيار. وهو المعيار المتعلق بـ 0.61 لامدا
00: 31: 55.00 أكثر من NA. تلك المسافة. إذن تلك المسافة ، كما أشرت لك بالفعل ،
00: 32: 01.02 هي المسافة بين مركز القرص الأول والأول
00: 32: 04.25 حلقة داكنة. وإذا نظرنا إلى هذه الآثار هنا ، فهذه هي
00: 32: 08.06 نقطتان موجودتان في معيار رايلي بعيدًا عن بعضهما البعض ، أي
00: 32: 12.13 0.61 لامدا فوق NA ، مركز هذا الكائن يجلس
00: 32: 16.16 مباشرة على أول حلقة مظلمة لهذا الكائن. إذا نظرت إلى الأسفل هنا
00: 32: 20.28 عند تتبع شدة ، حيث يكون الأول عند أدنى مستوياته
00: 32: 24.19 القيمة حيث تبلغ القيمة الأخرى ذروتها. وعند ذلك
موقف 00: 32: 29.01 ، ربما يكون هناك ما يزيد قليلاً عن 20٪ من الانخفاض
00: 32: 35.00 في الشدة بينهما عند إضافة شدتين.
00: 32: 37.22 يمكن للمرء أيضًا أن يجعل معيار رايلي في المحور z.
00: 32: 41.11 حيث تذهب من مركز واحد إلى أول حلقة مظلمة ،
00: 32: 45.22 إلى أول حلقته المظلمة والجسم الآخر على تلك المسافة. وذلك مرة أخرى
00: 32: 50.12 تعطيك قيمة حيث تنخفض حوالي 19٪. وهذان كلاهما
00: 32: 55.03 تتعلق بالمعادلة الأخرى التي ذكرتها ،
00: 33: 00.28 2 n لامدا على مربع NA. في حين أن هذا يساوي 0.61 لامدا على NA.
00: 33: 05.02 الآن قيمة الفتحة العددية هي أنها تجعل تلك النقاط أصغر.
00: 33: 09.00 لذا من المفترض أن تعمل نقطة انتشار النقطة كونها أصغر
00: 33: 12.09 يسمح للاقتراب من بعضها البعض. وهنا أ
00: 33: 15.07 مثال كلاسيكي على ذلك. إنها حفنة من الخرز حيث
00: 33: 18.29 تم تصويرهم بعدسة ذات فتحة عددية منخفضة ، أ
00: 33: 22.09 فتحة عددية متوسطة ، وعدسة ذات فتحة رقمية عالية.
00: 33: 24.19 لا يوجد فرق في التكبير ، لكن لا يوجد فرق
00: 33: 27.06 شك في C ، أن لديك مجموعة من الخرزات الفردية مع الكثير
00: 33: 31.00 من الحلقات حولهم ، لكنك ما زلت تراهم منفصلين.
00: 33: 34.05 في المتوسط ​​NA ، يكون القيام به أصعب قليلاً. وفي NA منخفضة
00: 33: 37.07 ، إنها مجرد نقطة كبيرة ، لا يمكنك في الواقع معرفة ما تبحث عنه
00: 33: 40.24 على الإطلاق. أريد فقط أن أقول شيئًا أخيرًا ، وهو أمر مهم
00: 33: 46.28 لكي تدرك ، إذا كنت تريد الحصول على الدقة من نورك
00: 33: 53.04 مجهر ، ليس عليك فقط أن تفهم ما يحده
00: 33: 56.25 من حيث حد الانعراج ، ولكن عليك أخذ عينة من الصورة
00: 34: 01.04 بتردد كافٍ بحيث يمكنك رؤية تلك الترددات العالية
00: 34: 06.03 التفاصيل. وهذا يتطلب منك أن تضع في اعتبارك حدود نيكويست.
00: 34: 10.11 و Nyquist ، سميت على اسم العالم هاري نيكويست ،
00: 34: 14.06 الذي ذكر أنه يجب أخذ عينات الصوت على الأقل بأعلى مستوى
00: 34: 19.15 التردد في الصوت مضروبًا مرتين ، لذلك يجب أخذ عينات منه مرتين
00: 34: 28.05 بأعلى تردد لاستخراج جميع المعلومات
00: 34: 31.02 من عرض النطاق الترددي وتمثل بدقة الأصل
00: 34: 34.13 طاقة صوتية. على سبيل المثال ، تسمع الأذن البشرية الترددات
00: 34: 37.14 حتى 20 كيلوهرتز ، لذا فإن القرص المضغوط ، إذا كان لديك واحد ، سيأخذ عينة عند 44.1 كيلوهرتز.
00: 34: 43.19 بحيث يمكنك سماع 20 كيلو هرتز بوضوح. تمر خطوط الهاتف بالترددات
00: 34: 48.27 حتى 4 كيلوهرتز ، لذلك تأخذ شركات الهاتف عينات عند 8 كيلوهرتز. لذلك
00: 34: 53.09 تقول نظرية أخذ العينات ، وهذه مجرد نظرية نيكويست ،
00: 34: 55.22 دالة متصلة ، على سبيل المثال ، بعض أنماط النطاقات
00: 35: 00.22 في صورة ما ، يمكن تمثيلها بالكامل بواسطة مجموعة
00: 35: 03.04 من العينات المتباعدة بشكل متساوٍ إذا حدثت العينات أكثر
00: 35: 07.14 أكثر من ضعف تردد مكون التردد الأعلى
00: 35: 10.13 للوظيفة. لذلك لالتقاط وظيفة بأقصى حد
00: 35: 13.24 تردد F ، مهما كانت ، أيًا كانت الصورة التي تشاهدها ،
00: 35: 16.19 يجب أن تحلها ، يجب أن تأخذ عينات
00: 35: 21.02 ضعف هذا الدقة ، ضعف هذا التردد.
00: 35: 24.16 وهذا هو حد نيكويست. وهنا في الأسفل ، إنه يوضح السبب
00: 35: 28.25 عليك أن تفعل ذلك. إذا كان لديك نمط النطاقات ، وهذا الأحمر هو
00: 35: 31.20 نوعًا من المساحة التي تنتقل من الضوء إلى الظلام ، ومن الضوء إلى الظلام ،
00: 35: 34.26 وأنت تأخذ عينات فقط عند حدود الدقة ، لذلك تحصل على واحدة
00: 35: 38.22 عينة لكل موجة من تلك الدورة المظلمة الفاتحة ، ستنتهي
00: 35: 43.12 مع الاسم المستعار. ستنتهي بنمط
00: 35: 46.21 الضوء والظلام لن يكون هذا هو التردد. تريد أن ترى ذلك
00: 35: 50.29 عالي التردد ، يجب أن يكون لديك عينة واحدة على الأقل من كل منهما
00: 35: 53.19 ذروة وكل قاع. وقد أكدت هذا فقط لأن معظمهم
00: 35: 57.28 أخصائيو الميكروسكوب ، إنهم يعملون بشكل جيد للغاية ويصبحون خياليين للغاية
00: 36: 00.08 الأهداف ، ثم تسقط على جانب التصوير. لا يفعلون
00: 36: 04.10 تصوير Nyquist المحدود. لذلك على سبيل المثال ، إذا كان الحد القرار
00: 36: 08.11 هي 0.61 لامدا فوق NA ، وتريد أن ترى هذا القرار ،
00: 36: 12.24 سيتعين عليك أخذ عينات كافية حتى يكون هناك على الأقل
00: 36: 16.21 بكسلين بين هذين. لذا فإن حد نيكويست هو
00: 36: 23.16 0.3 لامدا فوق NA. ويجب على المرء إما تكبير ملف
00: 36: 27.17 صورة مجهر ، استخدم عدسة تكبير أعلى
00: 36: 31.07 تأكد من تطابق إحداها مع الجهاز المقترن بالشحن ،
00: 36: 34.11 أو أي جهاز رقمي يستخدمه الشخص للصورة ،
00: 36: 38.11 للتأكد من أن حجم البكسل في الصورة مرتين
00: 36: 42.04 الحد بسبب وظيفة انتشار النقطة. كل هذا رائع ،
00: 36: 49.21 في بعض الأحيان ، هذا لا يكفي. وأنا فقط أريد أن أنهي
00: 36: 54.04 هذا بإخبارك أنه لا تزال هناك أشياء يفعلها الناس
00: 36: 57.07 يمكنك فعل ذلك إذا شعرت أنك بحاجة إلى دقة أكثر من مجهرك
00: 37: 01.03 الأهداف يمكن أن تمنحك. السبب الأول هو أنها 0.61 لامدا على NA ،
00: 37: 07.04 إذا كنت تستخدم ضوء موجي أقصر ، سيكون لديك أفضل
00: 37: 10.03 دقة الوضوح من الأضواء ذات الطول الموجي الأطول. لذلك الضوء الأزرق أو
00: 37: 12.14 الضوء فوق البنفسجي سيمنحك صورة أوضح من
00: 37: 15.26 ضوء أحمر أو ضوء الأشعة تحت الحمراء. إذا لم يكن ذلك كافيًا ، يمكنك الاحتفاظ به
00: 37: 21.08 الذهاب إلى المؤشر الأعلى للسوائل الغاطسة ، لأن 0.61 لامدا أعلى من NA ،
00: 37: 26.15 يرتبط مصطلح NA بمؤشر أوقات الانكسار
00: 37: 31.17 نصف الزاوية. كلما ارتفع مؤشر الانكسار ، زاد ارتفاعه
00: 37: 34.21 القرار. فالزيت أفضل من الجلسرين والجلسرين
00: 37: 38.24 افضل من الماء والماء افضل من الهواء.
00: 37: 41.22 وهناك أيضًا بعض الزيوت الباطنية التي تسمح لك بذلك
00: 37: 45.05 للدخول في فتحات عددية عالية جدًا. هم نتن
00: 37: 50.11 زيوت ، ليس من السهل جدًا الحصول عليها ، ولكن هناك أشياء يمكنك القيام بها.
00: 37: 53.23 مجهر متحد البؤر ، يمكن للعديد من الأشخاص الوصول إليه ،
00: 37: 58.27 إذا تم استخدامه بشكل صحيح يمكن أن يحسن الدقة بواسطة الجذر التربيعي لـ 2 ،
00: 38: 02.13 بنحو 1.4. لذلك هذا شيء يجب التفكير فيه.
00: 38: 05.10 وإذا كان بإمكانك دراسة مواقع فردية ، فيمكنك تحديد موقعها
00: 38: 11.23 من خلال النظر إلى مركز القرص المتجدد ، وهذا يمكن أن يمنحك
00: 38: 15.22 دقة فائقة. وذلك دقة عالية بشكل تعسفي
00: 38: 19.00 تم استخدامه لتتبع الأجسام المتحركة بمرور الوقت ، وهو كذلك
00: 38: 22.18 أيضًا أساس إحدى التقنيات الجديدة العديدة المعروفة باسم
00: 38: 27.13 تقنيات فائقة الدقة ، تنظير النانو البصري ، الذي لن أتحدث عنه
00: 38: 30.12 عن اليوم. لكن من المحتمل أن يزودك شخص ما بالمعلومات.
00: 38: 34.01 شكرًا جزيلاً.


تحكيم الثروة الحيوانية

الأساسيات

بعد معرفة سبب الحكم على الثروة الحيوانية ، يمكنك البدء في تقدير سبب احتياجك لممارسة كبيرة لتصبح قاضيًا جيدًا للماشية. في هذا القسم ، ستتم مناقشة بطاقة الترتيب ، وفئة من الماشية ، ومسابقة تحكيم المواشي.

وضع البطاقة

بطاقة الوضع هي السجل الرسمي لكيفية قيام الشخص بوضع فئة. في كل مرة تحكم على فئة من الماشية ، ستحصل على بطاقة وضع. يظهر نوع البطاقات المستخدمة في مسابقات ميسيسيبي في الشكل 1 (أدناه). قد تستخدم المسابقات الأخرى بطاقات وضع مماثلة. في كتلة المسابقة أ ، حدد القسم الذي تتنافس فيه (على الأرجح ، صغير أو كبير). Block B هو رقم فريقك ورقم المتسابق (مثال 1-A). بلوك C هو لاسم الفصل ورقم الفصل. ضع اسم الفصل في هذه الكتلة (على سبيل المثال ، Angus Heifers). الكتلان D و E للاستخدام الرسمي فقط ويجب أن تظل فارغة. أخيرًا ، ارسم دائرة حول المكان الذي تريده في القسم السفلي من البطاقة.

في المثال ، وضع متسابق مبتدئ (1-A) الفئة 4 ، Angus Heifers ، 3-1-4-2. يشير هذا الوضع إلى أن الحيوان الأكثر تفضيلًا هو رقم 3 وأقل حيوان مرغوب فيه هو الرقم 2.

تأكد من أن كل بطاقة تقوم بتسليمها تحتوي على رقم المتسابق الخاص بك وأنك أشرت إلى اسم الفصل. ضع دائرة حول وضع واحد فقط على بطاقة التحكيم الخاصة بك ، وتحقق من وضعك قبل تسليم بطاقتك.

فئة الثروة الحيوانية

يتكون فصل في مسابقة تحكيم الماشية من أربعة حيوانات من سلالة وجنس وفئة عمرية معينة ، مثل Suffolk Yearling Ewes و Dorset Ram Lambs و Crossbred Market Hogs و Duroc Boars و Summer Yearling Hereford Bulls و Brangus Heifer Calves. سيتم ترقيم الحيوانات 1 و 2 و 3 و 4 حتى يمكن التعرف عليها بسهولة. من المحتمل أن تكون الأرقام على ظهور أو أذرع الأشخاص الذين يحملون الحيوانات. من الاستثناءات المحتملة لهذا النظام عند الحكم على الأبقار أو الأغنام والحيوانات التي يتم رفعها أو وضعها في الرفوف. في هذه الحالة ، قم بترقيم الحيوانات من اليسار إلى اليمين وأنت تقف خلفها.

مسابقة تحكيم الثروة الحيوانية

تتضمن مسابقة تحكيم المواشي فئات من الأبقار والأغنام والخنازير. يمكنك الحكم على فئات السوق أو التربية أو كليهما. إذا قمت بوضع الفصل بشكل صحيح ، فستحصل على 50 نقطة للوضع. إذا قمت بوضع زوج أو زوجين بشكل غير صحيح ، أو إذا ارتكبت أخطاء أخرى في الترتيب ، فسيتم تحديد درجاتك من خلال خطورة الخطأ.

في العديد من أحداث التحكيم ، ستتاح لك الفرصة لتقديم أسباب شفهية. تسمح لك الأسباب الشفوية بتبرير وضعك أمام قاضٍ رسمي. سيحسبك القاضي الرسمي على الدقة والاكتمال والطول والعرض التقديمي والتسليم والمصطلحات. أعلى درجة يتم منحها لأسباب شفهية هي 50 نقطة. يمكن العثور على معلومات مفصلة عن الأسباب في قسم "الأسباب" التالي من هذا الدليل.

مسابقة تحكيم الثروة الحيوانية هي ببساطة مجموعة من فئات مختلفة من الماشية. يمكن أن يكون هناك العديد من الفصول في المسابقة كما يرغب المسؤولون عادة ، هناك فئتان على الأقل.

اتبع دائمًا تعليمات قائد مجموعتك أو الشخص المسؤول عن المسابقة. إذا كان لديك أي أسئلة ، اسأل قائد مجموعتك وليس متسابقًا آخر. لا يسمح بالحديث بين المتسابقين خلال المسابقة.

عندما تقترب من فئة من الماشية ، من المحتمل أن يُطلب منك إدارة ظهرك نحو الفصل ووضع بطاقة على بطاقة الترتيب الخاصة بك. لا تبدأ في إصدار الأحكام حتى يُطلب منك ذلك!

بمجرد أن "يحين الوقت" ، ابدأ بالحكم. سيكون لديك من 10 إلى 15 دقيقة لوضع الفصل ، ومعظم الفصول مدتها 15 دقيقة. مع بقاء دقيقتين أو ثلاث دقائق تقريبًا في الفصل ، سيُطلب منك وضع علامة على بطاقتك. تأكد من وجود رقم المتسابق واسم الفصل الدراسي ورقمه ومكانه على البطاقة. عندما "ينتهي الوقت" ، أدر ظهرك نحو الفصل ، وتحقق من ترتيبك للمرة الأخيرة ، وسلم بطاقة الترتيب الخاصة بك إلى قائد مجموعتك.

الشكل 1. وضع البطاقة.

كيف تبدأ

قبل أن تبدأ في الحكم على الماشية ، حاول تكوين صورة ذهنية للحيوان المثالي. افعل ذلك من خلال تذكر أكثر السمات المرغوبة للحيوانات عالية الجودة التي رأيتها والتفكير فيها على أنها تنتمي إلى حيوان واحد. يمكنك أيضًا دراسة صور الأبطال أو عرض التقارير أو مجلات الثروة الحيوانية الحالية أو الصور المثالية من جمعيات السلالات.

في نظام المسابقة ، عادة ما تكون أربعة حيوانات في كل فئة. كما تحكم ، قسّم الفصل إلى ثلاثة أزواج: زوج علوي ، وزوج متوسط ​​، وزوج سفلي. قم بإجراء مقارنات بين هذه الأزواج. عندما تنظر إلى أي فئة ، ضع في اعتبارك خمسة حيوانات: الأربعة في الفصل والحيوان المثالي لتلك السلالة والجنس والفئة العمرية.

تطوير نظام التحكيم

في كل مرة تحكم على فئة من الماشية أو تحلل مجموعة من الماشية ، اعتمد على نظام مراقبة الحيوانات.

فيما يلي بعض المؤشرات للحكم على فئة من الماشية:

  • قف للخلف - اترك مساحة كافية بينك وبين الحيوانات حتى تتمكن من رؤية جميع الحيوانات الأربعة في وقت واحد. عادةً ما تكون مسافة 25 إلى 30 قدمًا جيدة لمشاهدة الفصل. كن ماهرًا في ترتيب الفصول من مسافة بعيدة ، وتعامل مع الحيوانات فقط لتأكيد ملاحظاتك. من الخطأ وضع الفصل بيديك فقط. الاستثناء هو حملان السوق ، والتي غالبًا ما يتم وضعها على التقييم البصري وكذلك عند المناولة.
  • ثلاث زوايا - حاول النظر إلى الفصل من الجوانب والأمام والخلف. قارن كل حيوان بالآخرين في الفصل وبالحيوان "المثالي" الذي صورته في ذهنك.
  • الأشياء الكبيرة أولاً - ابحث دائمًا عن الخصائص الجيدة والسيئة لكل حيوان وحللها في المجالات الرئيسية مثل حجم الإطار ، والحجم ، والحالة ، والعضلات ، والتوازن ، والصحة الهيكلية ، والحركة ، وشخصية التكاثر. تعلم دراسة الحيوانات بعناية. ركز على أجزاء الحيوان التي تنتج قطعًا باهظة الثمن. إن القاضي النشيط للماشية منظم وليس عشوائيًا أبدًا. اصنع أماكنك وفقًا للأشياء الكبيرة ، ما لم يكن زوجان من الحيوانات متشابهين جدًا ، مما يجعلك تحلل الاختلافات الطفيفة بين الحيوانات.
  • ضع الفصل - بمجرد أن تقوم بتحليل العوامل المهمة التي تدخل في وضع الفصل ، ضع الفصل. ضع علامة في الجزء العلوي من دفتر ملاحظاتك أو بطاقة الأسباب ، وابدأ في تدوين الملاحظات. توجد مناقشة أكثر شمولاً لتدوين الملاحظات وتنسيق الأسباب في قسم "الأسباب الشفوية" من هذا الدليل.
  • التفتيش الدقيق - عادة ، سوف تحصل على بعض الوقت للتفتيش الدقيق للفصل. عندما تكون بالقرب من الحيوانات لتفتيشها عن كثب أو التعامل معها ، قم ببساطة بتأكيد القرارات التي اتخذتها عن بعد. إذا ظهر حيوان مختلفًا (أو تعامل بشكل مختلف) عما بدا عليه من مسافة ، وإذا كان الاختلاف يستحق النظر ، فقم بتغيير مكانك. يختلف الفحص الدقيق لكل نوع ، لذلك سيتم التعامل معه بشكل منفصل.

ماشية اللحم - أثناء الفحص الدقيق لماشية اللحم ، ربما لن يُسمح لك بالتعامل مع حيوانات التربية ، ولكن قد يُسمح لك بالتعامل مع الحيوانات في فئة السوق. إذا كان مسموحًا لك بالتعامل مع الحيوانات ، تحرك بهدوء وحذر حتى لا تثير أو تخيف الحيوانات (راجع "التعامل مع ستيرز السوق").

الأغنام - أثناء الفحص الدقيق للأغنام ، قد يُسمح لك أو لا يسمح لك بالتعامل مع فئات التربية والأسواق. مرة أخرى ، تحرك بهدوء وحذر حتى لا تصبح الحيوانات متوترة أو متحمسة. يتعامل قسم في هذا الدليل مع الطريقة المفضلة للتعامل مع الأغنام (انظر "مناولة حملان السوق").

الخنازير - لا توجد إرشادات محددة مسبقًا للتفتيش الدقيق للخنازير لأن الخنازير عادة ما يتم الحكم عليها في حظيرة. في أي وقت خلال الفصل ، يمكنك الركوع والنظر إلى الخطوط السفلية أو شقوق الأذن أو القدمين والساقين. اجعل هذا جزءًا من روتينك المعتاد للحكم على الخنازير.

قف للخلف وتدوين الملاحظات - حتى لو لم يكن فصل الأسباب أو الأسئلة ، اكتب بعض الملاحظات حول سبب ترتيب الفصل بالطريقة التي قمت بها. إذا كان الفصل الدراسي أسبابًا أو فصلًا به أسئلة ، فتراجع عن الفصل واكتب ملاحظاتك للأسباب. إذا لم تكن متأكدًا من شيء ما ، فحاول إما النظر إليه مرة أخرى أو حذفه. إذا لم تكن متأكدًا وخمنًا ، فمن المحتمل أن تكون مخطئًا. حاول أن تكون دقيقًا وصفيًا عند كتابة الملاحظات ، وتذكر كيف تبدو الحيوانات.


محتويات

في أوائل سبعينيات القرن الماضي ، أدرك المُنظِّر الروسي أليكسي أولوفنيكوف لأول مرة أن الكروموسومات لا يمكنها تكرار نهاياتها تمامًا ، وهذا ما يسمى "مشكلة النسخ النهائي". بناءً على ذلك ، واستيعابًا لفكرة ليونارد هايفليك عن الانقسام المحدود للخلايا الجسدية ، اقترح أولوفنيكوف أن تسلسل الحمض النووي يُفقد في كل مرة تتكاثر فيها الخلية حتى تصل الخسارة إلى مستوى حرج ، وعند هذه النقطة ينتهي انقسام الخلية. [1]

في 1975-1977 ، اكتشفت إليزابيث بلاكبيرن ، وهي تعمل زميلة ما بعد الدكتوراه في جامعة ييل مع جوزيف ج. غال ، الطبيعة غير العادية للتيلوميرات ، بتسلسلات الحمض النووي المتكررة البسيطة التي تتكون منها نهايات الكروموسوم. [2] مُنح بلاكبيرن وكارول جريدر وجاك زوستاك جائزة نوبل عام 2009 في علم وظائف الأعضاء أو الطب لاكتشافهم كيفية حماية الكروموسومات بواسطة التيلوميرات وإنزيم التيلوميراز. [3]

في عام 1983 ، تلقت باربرا مكلينتوك ، عالمة الوراثة الخلوية الأمريكية وأول امرأة تحصل على جائزة نوبل غير المشتركة في علم وظائف الأعضاء أو الطب ، على جائزة نوبل لملاحظتها أن الكروموسومات التي تفتقر إلى الأجزاء النهائية أصبحت "لزجة" وافترضت وجود بنية خاصة في طرف كروموسوم يحافظ على استقرار الكروموسوم. [4]

إنهاء مشكلة النسخ المتماثل تحرير

أثناء تكرار الحمض النووي ، لا يمكن لبوليميراز الحمض النووي تكرار التسلسلات الموجودة في النهايات الثلاثية. هذا نتيجة لوضعه أحادي الاتجاه لتخليق الحمض النووي: يمكنه فقط إرفاق نيوكليوتيدات جديدة بنهاية 3'-end (أي ، يتقدم التوليف 5'-3 ') وبالتالي فإنه يتطلب التمهيدي لبدء النسخ المتماثل. على الخيط الرئيسي (الموجه 5'-3 'داخل شوكة النسخ المتماثل) ، يتكاثر DNA-polymerase باستمرار من نقطة البدء على طول الطريق إلى نهاية الشريط مع التمهيدي (المصنوع من RNA) ثم يتم استئصاله واستبداله بواسطة DNA.ومع ذلك ، فإن الخيط المتأخر موجه إلى 3'-5 'فيما يتعلق بشوكة النسخ ، لذا فإن التكرار المستمر بواسطة DNA-polymerase أمر مستحيل ، مما يتطلب تكرارًا متقطعًا يتضمن التوليف المتكرر للاشعال 5' من موقع البدء (انظر التأخير تكرار حبلا). يقع التمهيدي الأخير الذي يتم مشاركته في النسخ المتماثل المتأخر بالقرب من نهاية 3'- نهاية القالب (المقابلة للنهاية المحتملة 5'من الشريط المتأخر). في الأصل كان يعتقد أن التمهيدي الأخير سيجلس في نهاية القالب ، وبالتالي ، بمجرد إزالته ، فإن بوليميريز الحمض النووي الذي يستبدل البادئات بالحمض النووي (DNA-Pol في حقيقيات النوى) [الملاحظة 1] لن يكون قادرًا على توليف "استبدال الحمض النووي" من الطرف 5'من الخيط المتأخر بحيث لا يمكن تكرار نيوكليوتيدات القالب التي تم إقرانها سابقًا مع آخر تمهيدي. [5] وقد تم التساؤل منذ ذلك الحين عما إذا كان آخر خيط تمهيدي متخلف قد تم وضعه بالضبط في الطرف الثالث من القالب ، وقد تم إثبات أنه تم تصنيعه إلى حد ما على مسافة حوالي 70-100 نيوكليوتيد وهو ما يتوافق مع النتائج. يتم تقصير الحمض النووي في الخلايا البشرية المستزرعة بمقدار 50-100 زوج قاعدي لكل انقسام خلية. [6]

إذا تم تدهور تسلسل الترميز في هذه العملية ، فسيتم فقد الكود الجيني الحيوي المحتمل. التيلوميرات عبارة عن تسلسلات متكررة غير مشفرة تقع عند نهاية الكروموسومات الخطية لتعمل كمخازن مؤقتة لتلك التسلسلات المشفرة المتأخرة. إنها "تغطي" التسلسلات النهائية وتتحلل تدريجياً في عملية تكرار الحمض النووي.

إن "مشكلة النسخ النهائي" مقصورة على الكروموسومات الخطية حيث أن الكروموسومات الدائرية ليس لها نهايات تقع دون الوصول إلى بوليميراز الحمض النووي. وبالتالي ، فإن معظم بدائيات النوى ، التي تعتمد على الكروموسومات الدائرية ، لا تمتلك التيلوميرات. [7] جزء صغير من الكروموسومات البكتيرية (مثل تلك الموجودة في ستربتوميسيس, الأجرعية، و بوريليا) ، مع ذلك ، خطية وتمتلك تيلوميرات ، والتي تختلف تمامًا عن تلك الموجودة في الكروموسومات حقيقية النواة في التركيب والوظيفة. تتخذ الهياكل المعروفة للتيلوميرات البكتيرية شكل بروتينات مرتبطة بنهايات الكروموسومات الخطية ، أو حلقات دبوس الشعر من الحمض النووي أحادي الجديلة في نهايات الكروموسومات الخطية. [8]

ينتهي التيلومير والمأوى في تحرير

في نهاية 3'-نهاية التيلومير ، يوجد 300 زوج قاعدي متدلي يمكنه غزو الجزء المزدوج الذي تقطعت به السبل من التيلومير مكونًا بنية تعرف باسم T-loop. تشبه هذه الحلقة العقدة ، التي تعمل على استقرار التيلومير ، وتمنع التعرف على نهايات التيلومير كنقاط توقف بواسطة آلية إصلاح الحمض النووي. في حالة حدوث انضمام طرف غير متماثل عند نهايات التيلومير ، سينتج اندماج الكروموسومات. يتم الحفاظ على الحلقة T بواسطة عدة بروتينات ، يشار إليها مجتمعة باسم مجمع المأوى. في البشر ، يتكون مجمع الملجأ من ستة بروتينات تم تحديدها على أنها TRF1 و TRF2 و TIN2 و POT1 و TPP1 و RAP1. [9] في العديد من الأنواع ، يتم إثراء تكرار التسلسل في الجوانين ، على سبيل المثال TTAGGG في الفقاريات ، [10] والذي يسمح بتكوين G-quadruplexes ، وهو تشكيل خاص للحمض النووي يتضمن الاقتران بقاعدة غير Watson-Crick. هناك أنواع فرعية مختلفة تعتمد على مشاركة الحمض النووي أحادي أو مزدوج السلسلة ، من بين أشياء أخرى. هناك دليل على 3'-overhang في ciliates (التي تمتلك تكرارات تيلومير مماثلة لتلك الموجودة في الفقاريات) لتشكيل G-quadruplexes التي تستوعبها ، بدلاً من T-loop. تمثل G-quadruplexes عقبة أمام الإنزيمات مثل بوليميرات الحمض النووي ، وبالتالي يُعتقد أنها تشارك في تنظيم النسخ والنسخ. [11]

تحرير تيلوميراز

العديد من الكائنات الحية لديها إنزيم يسمى تيلوميراز ، والذي يقوم بمهمة إضافة متواليات النوكليوتيدات المتكررة إلى نهايات الحمض النووي. إن التيلوميراز "يجدد" "غطاء" التيلومير. في معظم الكائنات حقيقية النواة متعددة الخلايا ، يكون التيلوميراز نشطًا فقط في الخلايا الجرثومية وبعض أنواع الخلايا الجذعية مثل الخلايا الجذعية الجنينية وبعض خلايا الدم البيضاء. يمكن إعادة تنشيط التيلوميراز وإعادة التيلوميرات مرة أخرى إلى الحالة الجنينية عن طريق نقل نواة الخلية الجسدية. [12] قد يكون للتقصير المستمر للتيلوميرات مع كل تكاثر في خلايا (الجسم) الجسدية دور في الشيخوخة [13] وفي الوقاية من السرطان. [14] [15] هذا لأن التيلوميرات تعمل كنوع من "فتيل" التأخير الزمني ، وينفد في النهاية بعد عدد معين من الانقسامات الخلوية ويؤدي في النهاية إلى فقدان المعلومات الجينية الحيوية من كروموسوم الخلية مع الانقسامات المستقبلية . [16]

طول التحرير

يختلف طول التيلومير اختلافًا كبيرًا بين الأنواع ، من حوالي 300 زوج قاعدي في الخميرة [17] إلى العديد من قواعد الكيل في البشر ، وعادة ما يتكون من مصفوفات من التكرارات الغنية بالجوانين ، من ستة إلى ثمانية أزواج قاعدية طويلة. تنتهي التيلوميرات حقيقية النواة عادةً بتراكب الحمض النووي أحادي الجديلة بثلاثة أذرع ، وهو أمر ضروري لصيانة التيلومير ووضع حد له. تم التعرف على بروتينات متعددة تربط الحمض النووي التيلومير المفرد والمزدوج الشريطة. [18] تعمل هذه الوظائف في كل من صيانة التيلومير والتغطية. تشكل التيلوميرات هياكل حلقة كبيرة تسمى حلقات التيلومير ، أو حلقات T. هنا ، يلتف الحمض النووي أحادي الخيط في دائرة طويلة ، مستقرًا ببروتينات ربط التيلومير. [19] في نهاية الحلقة T ، يتم الاحتفاظ بالحمض النووي التيلومير أحادي السلسلة في منطقة من الحمض النووي مزدوج الشريطة بواسطة خيط التيلومير الذي يعطل الحمض النووي الحلزوني المزدوج ، والاقتران الأساسي بأحد هذين الخيطين. يسمى هذا الهيكل الثلاثي الذي تقطعت به السبل حلقة الإزاحة أو حلقة D. [20]

تحرير الدور في دورة الخلية

يمكن أن يؤدي تقصير التيلومير في البشر إلى الشيخوخة التكاثرية ، مما يمنع انقسام الخلايا. يبدو أن هذه الآلية تمنع عدم الاستقرار الجيني وتطور السرطان في الخلايا البشرية المسنة عن طريق الحد من عدد الانقسامات الخلوية. ومع ذلك ، فإن التيلوميرات القصيرة تضعف وظيفة المناعة التي قد تزيد أيضًا من قابلية الإصابة بالسرطان. [21] إذا أصبحت التيلوميرات أقصر من اللازم ، فإن لديها القدرة على الانفتاح من بنيتها المغلقة المفترضة. قد تكتشف الخلية هذا عدم التغطية على أنه تلف في الحمض النووي ثم إما أن تتوقف عن النمو ، أو تدخل الشيخوخة الخلوية (الشيخوخة) ، أو تبدأ في التدمير الذاتي للخلية (موت الخلايا المبرمج) اعتمادًا على الخلفية الجينية للخلية (حالة p53). تؤدي التيلوميرات غير المقيدة أيضًا إلى اندماج الكروموسومات. نظرًا لأنه لا يمكن إصلاح هذا الضرر في الخلايا الجسدية الطبيعية ، فقد تدخل الخلية في موت الخلايا المبرمج. ترتبط العديد من الأمراض المرتبطة بالشيخوخة بتقصير التيلوميرات. تتدهور الأعضاء مع موت المزيد والمزيد من خلاياها أو دخولها في الشيخوخة الخلوية.

تحرير الضرر التأكسدي

بصرف النظر عن مشكلة النسخ المتماثل النهائي ، فقد أظهرت الدراسات في المختبر أن التيلوميرات تتراكم الضرر بسبب الإجهاد التأكسدي وأن تلف الحمض النووي الناتج عن الإجهاد التأكسدي له تأثير كبير على تقصير التيلومير في الجسم الحي. هناك العديد من الطرق التي يمكن من خلالها أن يؤدي الإجهاد التأكسدي ، بوساطة أنواع الأكسجين التفاعلية (ROS) ، إلى تلف الحمض النووي ، ومع ذلك ، فمن غير الواضح ما إذا كان المعدل المرتفع في التيلوميرات ناتجًا عن حساسيتها المتأصلة أو انخفاض نشاط الحمض النووي أنظمة الإصلاح في هذه المناطق. [22] على الرغم من الاتفاق الواسع النطاق على النتائج ، فقد تمت الإشارة إلى عيوب واسعة النطاق فيما يتعلق بالقياس وأخذ العينات ، على سبيل المثال ، يُقال إن الأنواع المشتبه بها واعتماد الأنسجة للأضرار التأكسدية للتيلوميرات لم يتم تفسيرها بشكل كافٍ. [23] أشارت الدراسات السكانية إلى وجود تفاعل بين تناول مضادات الأكسدة وطول التيلومير. في مشروع دراسة سرطان الثدي في لونغ آيلاند (LIBCSP) ، وجد المؤلفون زيادة معتدلة في خطر الإصابة بسرطان الثدي بين النساء ذوات أقصر تيلوميرات وانخفاض في المدخول الغذائي من بيتا كاروتين وفيتامين ج أو هـ. [24] هذه النتائج [25] تشير إلى أن قد تتفاعل مخاطر الإصابة بالسرطان بسبب قصر التيلومير مع آليات أخرى لتلف الحمض النووي ، وخاصة الإجهاد التأكسدي.

الارتباط مع الشيخوخة تحرير

يرتبط تقصير التيلومير بالشيخوخة والوفيات والأمراض المرتبطة بالشيخوخة. ترتبط الشيخوخة الطبيعية بقصر التيلومير في كل من البشر والفئران ، وتشير الدراسات التي أجريت على نماذج حيوانية معدلة وراثيًا إلى وجود روابط سببية بين تآكل التيلومير والشيخوخة. [26] ومع ذلك ، فمن غير المعروف ما إذا كانت التيلوميرات القصيرة هي مجرد عرض من أعراض الشيخوخة أم أنها هي نفسها تساهم في تقدم عملية الشيخوخة. [27]

يلعب عمر الأب دورًا في طول تيلوميرات الطفل ، والتي لها آثار تطورية. على الرغم من أن تيلوميرات الكريات البيض تقصر مع تقدم العمر ، فإن تيلوميرات الحيوانات المنوية تطول مع تقدم العمر. يُفترض أن التيلوميرات الأقصر تفرض تكاليف طاقة أقل (بسبب قلة التكرار) ولكن لها أيضًا تكاليف مرتبطة بالجهاز المناعي وتكاليف أخرى مرتبطة بالشيخوخة والأمراض ، لذا فإن تأثير عمر الأب على طول التيلومير قد يكون تكيفًا لزيادة فرص ذلك سيكون الطفل لائقًا للبيئة التي ولد فيها. [28] [29]

التأثير المحتمل للضغوط النفسية

وجدت التحليلات التلوية أن زيادة الضغط النفسي المتصورة كانت مرتبطة بانخفاض طفيف في طول التيلومير - لكن هذه الارتباطات تضعف من عدم وجود ارتباط مهم عند حساب تحيز النشر. تهيمن الدراسات المقطعية والارتباطية على الأدبيات المتعلقة بالتيلوميرات كمؤشرات حيوية تكاملية للتعرض للإجهاد والشدائد ، مما يجعل التفسير السببي إشكاليًا. [25] [30] جادل استعراض عام 2020 أن العلاقة بين الإجهاد النفسي الاجتماعي وطول التيلومير تبدو أقوى بالنسبة للإجهاد الذي يحدث في الرحم أو في الحياة المبكرة. [31]

تمت ملاحظة ظاهرة الانقسام الخلوي المحدود لأول مرة بواسطة ليونارد هايفليك ، ويشار إليها الآن باسم حد هايفليك. [32] [33] تم فيما بعد اكتشافات مهمة من قبل مجموعة من العلماء نظمت في مؤسسة جيرون من قبل مؤسس جيرون مايكل دي وست ، والتي ربطت تقصير التيلومير بحد هايفليك. [34] مكّن استنساخ المكون الحفاز للإنزيم تيلوميراز التجارب من اختبار ما إذا كان التعبير عن التيلوميراز بمستويات كافية لمنع تقصير التيلومير قادرًا على تخليد الخلايا البشرية. تم عرض تيلوميراز في منشور عام 1998 في علم لتكون قادرة على إطالة عمر الخلية ، ومن المعروف الآن أنها قادرة على تخليد الخلايا الجسدية البشرية. [35]

أصبح من الواضح أن عكس تقصير التيلوميرات من خلال التنشيط المؤقت للإنزيم تيلوميراز قد يكون وسيلة فعالة لإبطاء الشيخوخة. السبب في أن هذا من شأنه إطالة عمر الإنسان هو أنه سيمد حد Hayflick. تم اقتراح ثلاث طرق لعكس تقصير التيلومير: الأدوية ، العلاج الجيني ، أو تثبيط التمثيل الغذائي ، ما يسمى السبات / السبات. حتى الآن لم يتم إثبات هذه الأفكار عند البشر ، ولكن تم إثبات أن تقصير التيلومير ينعكس في حالة السبات ويبطئ الشيخوخة (Turbill، وآخرون. 2012 & amp 2013) وهذا السبات يطيل العمر الافتراضي (Lyman وآخرون. 1981). كما تم إثبات أن امتداد التيلومير قد عكس بنجاح بعض علامات الشيخوخة في فئران التجارب [36] [37] وأنواع الديدان الخيطية أنواع معينة انيقة. [38] تم افتراض أن التيلوميرات الأطول وخاصة تنشيط التيلوميراز قد يتسبب في زيادة السرطان (على سبيل المثال Weinstein and Ciszek، 2002 [39]). ومع ذلك ، فإن التيلوميرات الأطول قد تحمي أيضًا من السرطان ، لأن التيلوميرات القصيرة مرتبطة بالسرطان. كما تم اقتراح أن التيلوميرات الأطول قد تتسبب في زيادة استهلاك الطاقة. [21]

قد تكون تقنيات تمديد التيلوميرات مفيدة لهندسة الأنسجة ، لأنها قد تسمح بتربية خلايا الثدييات السليمة وغير السرطانية بكميات كبيرة بما يكفي لتكون مواد هندسية للإصلاحات الطبية الحيوية.

أثبتت دراستان على الطيور البحرية طويلة العمر أن دور التيلوميرات بعيد عن الفهم. في عام 2003 ، لاحظ العلماء أن التيلوميرات في طائر النوء ليتش (أوشيانودروما ليوكورهوا) يبدو أنه يطول مع العمر الزمني ، وهو أول مثال لوحظ لسلوك التيلوميرات هذا. [40] في عام 2006 ، جوولا وآخرون. [41] ذكرت أنه في نوع آخر من الطيور البحرية طويلة العمر غير ذات صلة ، وهي الفرقاطة العظيمة (فريجاتا طفيفة) ، انخفض طول التيلومير حتى ج على الأقل. يبلغ من العمر 40 عامًا (أي ربما على مدار العمر بأكمله) ، ولكن سرعة الانخفاض تباطأت بشكل كبير مع زيادة الأعمار ، وتفاوتت معدلات انخفاض طول التيلومير بشدة بين الطيور الفردية. وخلصوا إلى أنه في هذا النوع (وربما في الفرقاطة وأقاربهم بشكل عام) ، لا يمكن استخدام طول التيلومير لتحديد عمر الطائر بشكل كافٍ. وبالتالي ، يبدو أن هناك تباينًا أكبر بكثير في سلوك طول التيلومير مما كان يُعتقد في البداية.

علاوة على ذلك ، جوميز وآخرون. وجدت ، في دراسة لبيولوجيا المقارنة لتيلوميرات الثدييات ، أن طول التيلومير لأنواع مختلفة من الثدييات يرتبط عكسًا ، وليس بشكل مباشر ، مع العمر الافتراضي ، وخلصوا إلى أن مساهمة طول التيلومير في العمر لا تزال مثيرة للجدل. [42] هاريس وآخرون. وجدت أدلة قليلة على أن طول التيلومير في البشر هو مؤشر حيوي مهم للشيخوخة الطبيعية فيما يتعلق بالقدرات المعرفية والجسدية الهامة. [43] قام جيلي وبلاكبيرن باختبار ما إذا كان شيخوخة الخلايا في البراميسيوم ناتج عن تقصير التيلومير ، ووجدوا أن التيلوميرات لم يتم تقصيرها أثناء الشيخوخة. [44]

يتم سرد تسلسلات نيوكليوتيدات التيلومير المعروفة والمحدثة في موقع قاعدة بيانات Telomerase على الويب.

بعض سلاسل نيوكليوتيدات التيلومير المعروفة
مجموعة الكائن الحي تكرار التيلومير (5 'إلى 3' قرب النهاية)
الفقاريات الإنسان والفأر Xenopus TTAGGG
الفطريات الخيطية نيوروسبورا كراسا TTAGGG
قوالب الوحل فيساروم, ديديميوم TTAGGG
ديكتيوستيليوم AG (1-8)
البروتوزوا Kinetoplastid المثقبيات, كريثيديا TTAGGG
هدبيات البروتوزوا رباعية الغشاء, الزرق TTGGGG
باراميسيوم TTGGG (T / G)
Oxytricha, Stylonychia, إيبلوتس TTTTGGGG
البروتوزوا Apicomplexan المتصورة TTAGGG (T / C)
النباتات العليا نبات الأرابيدوبسيس thaliana TTTAGGG
سيستروم ايليجانس TTTTTTAGGG [45]
زهرة الآليوم CTCGGTTATGGG [46]
طحالب خضراء كلاميدوموناس TTTTAGGG
الحشرات بومبيكس موري TTAGG
الديدان الخراطيني الاسكاريس TTAGGC
خمائر الانشطار شيزوساكارومايس بومب TTAC (A) (C) G (1-8)
مهد الخمائر خميرة الخميرة TGTGGGTGTGGTG (من قالب RNA)
أو G (2-3) (TG) (1-6) T (الإجماع)
Saccharomyces castellii TCTGGGTG
المبيضات glabrata GGGGTCTGGTGCTG
المبيضات البيض جتجتاكجاتجتكتاكتكت
المبيضات الاستوائية GGTGTA [C / A] GGATGTCACGATCATT
المبيضات المالتوسا جتجتاكجاتجكاجاكتكجكت
المبيضات Guillermondii GGTGTAC
المبيضات الكاذبة GGTGTACGGATTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTGATTAGGTATGT

التيلوميرات ضرورية للحفاظ على سلامة الجينوم وقد تكون عوامل للأمراض المرتبطة بالعمر. [47] تظهر الدراسات المختبرية أن ضعف أو تقصير التيلومير يتم اكتسابه بشكل عام بسبب شيخوخة الخلايا وتطور الورم. [47] [48] يمكن أن تؤدي التيلوميرات القصيرة إلى عدم الاستقرار الجيني وفقدان الكروموسوم وتكوين انتقالات وتيلوميرات غير متبادلة في الخلايا السرطانية وتكون آفاتها الأولية أقصر بكثير من الأنسجة الطبيعية المحيطة. [49] [50]

لقد وجدت الدراسات القائمة على الملاحظة أن التيلوميرات القصيرة في العديد من أنواع السرطانات التجريبية. [51] بالإضافة إلى ذلك ، وجد أن الأشخاص المصابين بالسرطان يمتلكون تيلوميرات كريات الدم البيضاء أقصر من الأشخاص الأصحاء. [52] تشير التحليلات التلوية الحديثة إلى زيادة خطر الإصابة بالسرطان بمقدار 1.4 إلى 3.0 ضعف لمن لديهم أقصر تيلوميرات مقابل أطول تيلوميرات. [53] [54] ومع ذلك ، فإن الزيادة في المخاطر تختلف حسب العمر والجنس ونوع الورم والاختلافات في عوامل نمط الحياة. [51]

يتم حاليًا استخدام العديد من التقنيات لتقييم متوسط ​​طول التيلومير في الخلايا حقيقية النواة. إحدى الطرق هي اللطخة الجنوبية لجزء التقييد الطرفي (TRF). [55] [56] يتضمن اختبار PCR في الوقت الحقيقي لطول التيلومير تحديد نسبة التيلومير إلى نسخة واحدة من جين (T / S) ، والتي ثبت أنها متناسبة مع متوسط ​​طول التيلومير في الخلية. [57]

كما تم تطوير أدوات لتقدير طول التيلومير من تجارب تسلسل الجينوم الكامل (WGS). ومن بين هؤلاء TelSeq و [58] telomereCat [59] و telomereHunter. [60] تقدير الطول من WGS يعمل عادةً عن طريق التمييز بين قراءات تسلسل التيلومير ثم استنتاج طول التيلومير الذي أنتج هذا العدد من القراءات. وقد ثبت أن هذه الطرق مرتبطة بطرق التقدير الموجودة مسبقًا مثل PCR و TRF. يستخدم Flow-FISH لقياس طول التيلوميرات في خلايا الدم البيضاء البشرية. تم نشر طريقة شبه آلية لقياس متوسط ​​طول التيلوميرات باستخدام Flow FISH في Nature Protocols في عام 2006. [61]

في حين أن العديد من الشركات تقدم خدمات قياس طول التيلومير ، فقد تم التشكيك في فائدة هذه القياسات للاستخدام السريري أو الشخصي على نطاق واسع. [62] [63] روجت إليزابيث بلاكبيرن الحائزة على جائزة نوبل ، والتي شاركت في تأسيس شركة واحدة ، للفائدة السريرية لمقاييس طول التيلومير. [64]

تم إجراء معظم الأبحاث حول طول التيلومير وتنظيمه ، وعلاقته بالسرطان والشيخوخة ، على الثدييات ، وخاصة البشر ، التي لديها القليل من إنزيم التيلوميراز الجسدي أو معدوم. من المرجح بشكل ملحوظ أن يكون للخلايا الخارجية درجة حرارة متباينة في التعبير الجسدي للتيلوميراز أكثر من المواد المبطنة للحرارة. على سبيل المثال ، في العديد من الأسماك ، يحدث الإنزيم تيلوميراز في جميع أنحاء الجسم (ويرتبط بذلك ، يكون طول التيلومير متماثلًا تقريبًا في جميع أنسجته). تُظهر الدراسات التي أجريت على ectotherms والكائنات غير الثديية الأخرى أنه لا يوجد نموذج عالمي واحد لتآكل التيلومير بدلاً من ذلك ، هناك تباين واسع في الديناميات ذات الصلة عبر Metazoa ، وحتى داخل المجموعات التصنيفية الأصغر ، تظهر هذه الأنماط متنوعة. نظرًا لاختلاف الجداول الزمنية للتكاثر لبعض الحرارة الخارجية ، فإن الاختيار على المرض مناسب لجزء أكبر بكثير من حياة هذه الكائنات مقارنة بالثدييات ، لذلك يبدو طول التيلومير في وقت مبكر ومتأخر من العمر ، وارتباطاتهم المحتملة بالسرطان ، بشكل خاص. مهم في هذه الأنواع من وجهة نظر نظرية تاريخ الحياة. [65]


الحركة والتنقل أسئلة إضافية مهمة نوع الإجابة قصيرة جدًا

السؤال رقم 1.
ما هو الوتر؟
إجابة:
يربط النسيج الضام الكثيف العظام والعضلات الهيكلية.

السؤال 2.
ما هي العضلات المعادية؟
إجابة:
ال. زوج من العضلات التي تنتج عند المفصل حركات معاكسة.

السؤال 3.
ما هو مرض التيتانوس؟
إجابة:
تسمى حالة الانقباض العضلي المستمرة بالكزاز.

السؤال 4.
ما هو عتبة التحفيز؟
إجابة:
يسمى محفز الحد الأدنى من القوة المطلوب لإحداث تقلص عضلي بمحفز العتبة.

السؤال 5.
ما هو ارتعاش العضلات؟
إجابة:
يسمى الانقباض الفردي للعضلة عند تلقي التحفيز نشل العضلات. (الانكماش يتبعه الاسترخاء).

السؤال 6.
ما هو ساركومير؟
إجابة:
تتقلص الوحدة الوظيفية للليف العضلي وتتسبب في تقصير ألياف العضلات.

السؤال 7.
كم عدد العظام الموجودة في الهيكل العظمي البشري؟
إجابة:
يحتوي الهيكل العظمي البشري على 206 عظمة.

السؤال 8.
ما هي المفاصل الزليلية؟
إجابة:
هذه مفاصل متحركة بحرية بسبب وجود السائل الزليلي في التجويف الزليلي.

السؤال 9.
ما هي الحركة؟
إجابة:
تسمى الحركة الجسدية للحيوانات من مكان إلى آخر بالحركة.

السؤال 10.
ما هو تيبس مورتيس؟
إجابة:
- تصلب العضلات بعد الموت.

السؤال 11.
قم بتسمية البروتينات التي تساعد في تقلص العضلات.
إجابة:
الميوسين والأكتين.

السؤال 12.
ما هي وظيفة السائل الزليلي؟
إجابة:
يعمل السائل الزليلي كمواد تشحيم.

السؤال 13.
ما هو المفصل المحوري؟
إجابة:
يسمح المفصل بحركات الدوران أو الدوران ، على سبيل المثال ، بين الأطلس وفقرة المحور.

السؤال 14.
أي مفصل متحرك يصنع مفصل الورك؟
إجابة:
مفصل كروي ومقبس.

السؤال 15.
أي عضلة تنقبض لتجعل راحة يدك متجهة للأعلى؟
إجابة:
سوبيناتور.

السؤال 16.
كم عدد العظام الموجودة في جمجمة الإنسان؟
إجابة:
29

السؤال 17.
أي نوع من المفصل المتحرك هو مفصل الركبة؟
إجابة:
يتوقف المشترك.

السؤال 18.
قم بتسمية شريط مفصل الهيكل العظمي الذي يسمح بالحركات في مستوى واحد فقط.
إجابة:
يتوقف المشترك.

السؤال 19.
التفريق بين النطاق A و I-band.
إجابة:

  • A-band عبارة عن فرقة داكنة بها خيوط ميوسين.
  • I-band عبارة عن شريط خفيف به خيوط رفيعة.

السؤال 20.
ما هو العدد الإجمالي للعظام في أجسامنا؟
إجابة:
206.

السؤال 21.
قم بتسمية الفئات الخمس المختلفة للفقرات في العمود الفقري.
إجابة:

السؤال 20.
أين يتم إنتاج خلايا الدم داخل العظام؟
إجابة:
نخاع العظام الطويلة.

السؤال 23.
أعط مثالاً واحدًا لمفصل كروي ومقبس.
إجابة:
مفصل الكتف.

الحركة والحركة أسئلة إضافية مهمة نوع الإجابة المختصرة

السؤال رقم 1.
قائمة الوظائف الميكانيكية للهيكل العظمي.
إجابة:

  1. يوفر إطارًا صلبًا للجسم وشكلًا محددًا للأعضاء.
  2. يدعم وزن الجسم.
  3. يحمي الأعضاء الداخلية.
  4. تعمل عظامه الطويلة كرافعة.
  5. تعطي العضلات الهيكلية ذات العصابات النسيجية الضامة المرنة والتي تسمى الأوتار بالاشتراك مع الهيكل الداخلي والمفاصل الحركة والحركات لأجزاء الجسم المختلفة.

السؤال 2.
ضع قائمة ببعض الوظائف البيولوجية للهيكل العظمي.
إجابة:

  1. يوفر سطح التعلق بالعضلات.
  2. يعمل كمستودع تخزين من معادن الكالسيوم والفوسفات.
  3. العمل في تكون الكريات الحمر.
  4. تساعد عظيمات الأذن في انتشار الموجات الصوتية.
  5. نخاع العظم الأحمر الموجود داخل تجويف النخاع للعظام الطويلة مثل عظم الفخذ والعضد وفي شقوق العظام الإسفنجية للفقرات والقص والكتف وما إلى ذلك يساعد في تكوين كرات الدم الحمراء وكرات الدم البيضاء والصفائح الدموية في الدم. تُعرف هذه العملية باسم Haemopoiesis.

السؤال 3.
ضع قائمة بأنماط الحركة والحركة المختلفة في الهيدرا.
إجابة:

  1. الانكماش والتوسع
  2. الانحناء والتمايل
  3. التكرار
  4. شقلبة.
  5. يطفو على السطح
  6. مزلق
  7. سباحة
  8. المشي.

السؤال 4.
ما هي الجزيئات المختلفة الموجودة في العضلات؟
إجابة:

  1. البروتينات المقلصة بمعنى. الأكتين والميوسين والتروبوميوسين.
  2. الإنزيمات والبروتينات الأخرى مثل تروبونين.
  3. الكربوهيدرات كركيزة للطاقة.
  4. تحمل الطاقة بمعنى. ATP و ADP و AMP و CP.
  5. أيونات بمعنى. Na +، K +، Mg ++، Ca +، CI +.

السؤال 5.
التفريق بين الانقباض متساوي التوتر والانكماش متساوي القياس
إجابة:

انكماش متساوي التوتر انكماش متساوي القياس
1. هناك تغيير في شكل العضلات. 1. لا يوجد تغيير في شكل العضلات
2. العضلات تحافظ على التوتر. 2. العضلات تحافظ على الطول.
3. انقباض العضلات ورفع الحمل 3. تنقبض العضلات مقابل حمولة يمكن رفعها.

السؤال 6.
تعمل الألياف العضلية الحمراء لفترة طويلة بينما تتعب الألياف العضلية البيضاء ، لماذا؟
إجابة:
تحتوي ألياف العضلات الحمراء على الميوغلوبين الصبغي لتخزين الأكسجين وعدد كبير من الميتوكوندريا ، لذلك يمكن أن يكون لديهم O2 الإمداد بالتنفس الهوائي وإطلاق الطاقة لفترة أطول.

لا تحتوي ألياف العضلات البيضاء على صبغة الميوغلوبين. يواجهون نقصًا في المعروض من O2 ويعتمد الكثير على التنفس اللاهوائي ، فيصابون بالإرهاق قريبًا.

السؤال 7.
ما هي أنواع المفاصل الرئيسية الموجودة في جسم الإنسان؟
إجابة:
أنواع المفاصل الموجودة في جسم الإنسان هي:
1. المفاصل الثابتة أو الليفية: لا توجد حركة على الإطلاق في المفاصل المفصلية ، بسبب وجود أنسجة ليفية بيضاء صلبة غير قابلة للتمدد ، مثل عظام الجمجمة.

2. المفاصل قليلة الحركة أو الغضروفية: تكون الحركة المحدودة ممكنة في مفاصل العظام. ينضم قرص كثيف من الغضروف الأبيض إلى الأسطح المفصلية ، على سبيل المثال ، الفقرات والارتفاق العام.


أنواع مختلفة من المفاصل

3. المفاصل التي تتحرك بحرية أو المفاصل الزليليّة: الحركة الحرة ممكنة بسبب وجود السائل الزليلي في التجويف الزليلي ، بين العظام المفصلية ، على سبيل المثال ، المفصل المفصلي والمفصل الكروي والمقبس.

السؤال 8.
ما هي مميزات حركة اجزاء الجسم؟
إجابة:
تتمتع الحركة بالمزايا التالية:

  1. مع التغيير في وضع الجسم وحركة الأطراف ، يتم الحفاظ على توازن الجسم.
  2. حركة الأطراف تسبب الحركة.
  3. يتم التقاط الطعام بحركة اللوامس والأطراف والفك واللسان وما إلى ذلك في الحيوانات المختلفة.
  4. يمكن استشعار التغيرات في البيئة المحيطة من خلال حركة مقلة العين ، والصيوان الخ.
  5. الدورة الدموية ممكنة بحركة القلب.
  6. حركة الحجاب الحاجز تسبب الشهيق والزفير (التنفس).

السؤال 9.
ما هي مزايا الحركة؟
إجابة:
تتمتع الحركات الجسدية أو الحركة بالمزايا التالية:

  1. إنه يمكّن الجسم من نقله بالكامل من مكان إلى آخر.
  2. يحمي الكائن الحي من الافتراس.
  3. يساعد الحيوانات على البحث عن طعامهم ومتطلباتهم الغذائية الأخرى.
  4. يساعد الحيوان على البحث عن رفيقة للتكاثر.

السؤال 10.
ارسم مخططًا معنونًا للمفصل الموجود بين حزام الحوض وعظم الفخذ. اكتب أيضًا نوع هذا المفصل.
إجابة:
نوع المفصل: المفصل بين عظام الحوض والفخذ عبارة عن مفصل زليلي كروي ومقبس.

الكرة الزليلي ومفصل التجويف بين الحوض وعظم الفخذ

السؤال 11.
لماذا الحركة والتنقل ضروريان بين الحيوانات؟
إجابة:
الحركة والتنقل ضروريان بين الحيوانات لبقائها على قيد الحياة. إنها تمكنهم من شراء الطعام والبحث عن مأوى والعثور على رفقاء وحماية أنفسهم من الحيوانات المفترسة وأداء العديد من أنشطة الحياة الأخرى.

السؤال 12.
وضح أنواع الحركات الموجودة بين الحيوانات.
إجابة:
تختلف الحركات بين الحيوانات اختلافًا كبيرًا. تتضمن الحركة ثلاث آليات أساسية.
وهذه هي:

حركة الأميبا نموذجية للأميبا. تتحرك الأميبا بمساعدة الأرجل الكاذبة. تساعد حركة الأميبويد في التقاط الطعام وتغيير المكان أيضًا.

يتم استخدام نفس طريقة الحركة أيضًا بواسطة كريات الدم البيضاء ، مثل الخلايا البلعمية والبلاعم في الجهاز اللمفاوي البشري لابتلاع المستضد وهجرة سائل الدورة الدموية. في البروتوزوان شوهدت الحركة الهدبية. الحركة العضلية هي الآلية الأساسية المستخدمة في غالبية الفقاريات بما في ذلك البشر. تمتلك معظم الحيوانات متعددة الخلايا أليافًا عضلية لحركة الأعضاء المختلفة ولتحريك الحركة.

السؤال 13.
ما هي العضلة؟ اكتب أسماء أنواع مختلفة من العضلات؟
إجابة:
تعتمد الحركة عند البشر على حركات ألياف العضلات (خلايا العضلات). تتكون العضلات من ألياف مقلصة تتكون بدورها من ليفية عضلية. في البشر ، تشكل العضلات ما يقرب من 40 & # 8211 50 في المائة من إجمالي وزن الجسم.

تصنف العضلات على نطاق واسع إلى ثلاث فئات.

  1. عضلات الهيكل العظمي: ترتبط بالعظام بواسطة الأوتار وتساعد في حركة جزء الهيكل العظمي. هذه العضلات تحت سيطرة العقل الواعي ويمكن نقلها إلى الحائط.
    عضلات الهيكل العظمي تسمى العضلات الإرادية.
  2. عضلات القلب: وهي أيضًا مخططة وتحدث حصريًا في القلب.
  3. العضلات الملساء: هي عضلات لا إرادية وغير مخططة ويعصبها الجهاز العصبي اللاإرادي.

السؤال 14.
كيف تتقلص العضلات الهيكلية؟
إجابة:
أثناء الانكماش ، تنزلق خيوط الأكتين والميوسين متداخلة لتقليل طول الأورام اللحمية. تتحرك خيوط الأكتين إلى الداخل نحو مركز قسيم عضلي. تعمل رؤوس خيوط الميوسين على أنها & # 8216hooks & # 8217 ، وتعلق على F-actin وتشكل جسورًا متقاطعة ، ثم تغير تكوينها النسبي وتسحب خيوط الأكتين.

نتيجةً لذلك ، يتم تقريب الخطوط Z التي تحد من القسيمات اللحمية من بعضها البعض ، ولكن يظل طول النطاقات A دون تغيير. يتم تقليل طول العصابات I.

ومع ذلك ، فإن النتيجة النهائية هي تقصير قسيم عضلي. ينزلق خيوط الأكتين من النطاق A مما يؤدي إلى إطالة قسيم عضلي.

السؤال 15.
ما هو التهاب المفاصل؟ كيف تسببت؟
إجابة:
إنه اضطراب في العظام حيث تلتصق الأنسجة الليفية بالعظام وتتحجر ، مما يجعل المفاصل ثابتة.

وهو ناتج عن التهاب المفاصل. وهو من عدة أنواع ، على سبيل المثال ، التهاب المفاصل الروماتويدي ، هشاشة العظام # 8216 والتهاب المفاصل النقرسي.

السؤال 16.
اكتب أسماء العوامل المسؤولة عن هشاشة العظام.
إجابة:
الاختلالات في الهرمونات مثل هرمون الغدة الدرقية ، الغدة الدرقية والهرمونات الجنسية ، ونقص الكالسيوم وفيتامين د هي المسببات الرئيسية.

السؤال 17.
كيف تساعد المفاصل في الحركة؟ يشرح.
إجابة:
المفصل الزليلي أو المتحرك هو مفصل يسمح بحركة العظام المتجمعة بحيث يمكن أن تتحرك بشكل مكثف على بعضها البعض. يوجد في المفاصل مساحة تسمى التجويف الزليلي. يظل هذا التجويف ممتلئًا بسائل يسمى السائل الزليلي.

تحدث حركة العضو بسبب شد العظام. تحدث الحركة على طول المفاصل التي تعمل كنقطة ارتكاز للكبد. في الواقع ، تعمل المفاصل كرافعة. نظرا لوجود عدد من المفاصل يمكن تحريك أجزاء الجسم المختلفة والجسم كله.

السؤال 18.
كيف يؤثر الكالسيوم على عملية تقلص العضلات؟
إجابة:
ألياف العضلات قابلة للإثارة. عادة ، يبدأ الدافع العصبي الذي يصل إلى الموصل العصبي العضلي استجابة مقلصة. يدخل ناقل عصبي يتم إطلاقه عند التقاطع العصبي العضلي في قسيم عضلي من خلال قناة الغشاء. يؤدي فتح القناة أيضًا إلى تدفق Na + داخل قسيم عضلي ويولد جهد فعل في الألياف العضلية.

تطلق الشبكة الساركوبلازمية Ca ++ المخزنة ، والتي ترتبط بالمواقع المحددة الموجودة على مكون التروبونين في الشعيرة الرقيقة. نتيجة لذلك ، تتعرض المواقع النشطة الموجودة على جزيئات F-actin. هذه المواقع خاصة برأس الميوسين ، والذي يعرض ATP المعتمد على Mg ++ كنشاط.

أثناء استرخاء العضلات ، يتم ضخ Ca ++ مرة أخرى في الشبكة الساركوبلازمية. نتيجة لذلك ، يصبح مكون التروبونين حراً. ينكسر الجسر المتقاطع ويحتل الخيط الرفيع موضعه الطبيعي. تسترخي العضلة.

السؤال 19.
اكتب الفرق بين المفاصل الثابتة والمتحركة.
إجابة:

مفاصل متحركة مفاصل ثابتة
1. يتم الحفاظ على الأسطح المفصلية على اتصال وثيق بواسطة كبسولة ليفية ويحدث سائل زليلي زلق في الفراغ بين الأسطح المفصلية للعظم. 1. العظام المفصلية في هذا المفصل مرتبطة ببعضها البعض بقوة بواسطة عصابات كثيفة من الأنسجة الليفية البيضاء القاسية غير القابلة للتمدد.
2. يسمح بحركة كبيرة للعظام المفصلية. 2. لا يسمح بأي حركة للعظام المفصلية.

السؤال 20.
إملأ الفراغات:
إجابة:

  1. التروبونين جزء من خيوط الميوسين.
  2. رأس الميوسين لديه نشاط سلبي AT.
  3. تم العثور على عظم العضد الشعاع وعظام الزند في الساعد.
  4. يوجد الحق في حزام الحوض.
  5. المفصل الكروي والمقبس عبارة عن حزام متحرك.

السؤال 21.
تطابق العمود الأول مع العمود الثاني

العمود الأول العمود- II
(أ) العضلات الملساء (ط) الميوغلوبين
(ب) تروبوميوسين (2) رافعة من الدرجة الثالثة
(ج) عضلة حمراء (3) خيوط رقيقة
(د) الجمجمة (رابعا) الغرز
(هـ) الساعد (ت) غير الطوعي

العمود الأول العمود- II
(أ) العضلات الملساء (ت) غير الطوعي
(ب) تروبوميوسين (3) خيوط رقيقة
(ج) عضلة حمراء (ط) الميوغلوبين
(د) الجمجمة (رابعا) الغرز
(هـ) الساعد (2) رافعة من الدرجة الثالثة

السؤال 22.
ما هو المفصل؟ اكتب نوعه بمثال.
إجابة:
المفاصل هي مكان مفصل بين عظمتين أو أكثر أو بين عظم وغضروف. بسبب وجود عدد من المفاصل ، يمكن تحريك أجزاء الجسم المختلفة والجسم كله.

هناك ثلاثة أنواع من المفاصل:

  1. المفاصل الثابتة أو غير المنقولة: لا يوجد فراغ بين العظام. يتم ربطها بإحكام شديد بمساعدة النسيج الضام الليفي الأبيض.
  2. متحرك قليلاً أو غضروفي: وهو مفصل بين العظام يسمح بحركة قليلة جدًا.
  3. المفاصل المتحركة أو الزليلي: وهو مفصل يسمح بحركة العظام المفصلية بحيث يمكن أن تتحرك بشكل مكثف على بعضها البعض. في مثل هذه المفاصل يوجد الغرور الزليلي.

السؤال 23.
ما هو دور الحزام في الهيكل العظمي؟
إجابة:
توفر عظام الحزام صلة بين الهيكل العظمي المحوري والأطراف. تم تسمية المشطرين بالمشدات الصدرية والحوضية. يتكون كل حزام من نصفين.

الحركة والحركة أسئلة إضافية مهمة نوع الإجابة الطويلة

السؤال رقم 1.
(أ) أثناء تقلص العضلات ، ما هي التغييرات الكيميائية التي تحدث. صف في شكل مدرج.
إجابة:
الأحداث الكيميائية الرئيسية التي تحدث أثناء التقلص العضلي التي وصفها ألبرت سزينت جيورجي هي
1. يتم تحرير أستيل كولين من الحويصلات عند الموصل العصبي العضلي. يحفز العضلات.

2. التحلل المائي لـ ATP في وجود Ca ++ و Mg ++ الطاقة المستخدمة في تقلص العضلات.

3. يتم شحن ADP مرة أخرى عن طريق أخذ الفوسفات من فوسفات الكرياتين (CP).

4. أثناء الاسترخاء ، يتم فسفرة الكرياتين ، ويتم توفير الطاقة عن طريق التحويل اللاهوائي للجليكوجين العضلي إلى حمض اللاكتيك.
الكرياتين + ATP - تكوين الفوسفات + ADP

5. تتسبب الطاقة المنبعثة من التحلل المائي لـ ATP في دوران رؤوس الميوسين وتقريب خيوط الأكتين ، ويتكون مجمع الأكتوميوسين ، وفي النهاية يقصر قسيم عضلي.

6. يتم نقل Ca ++ بشكل فعال إلى الشبكة الساركوبلازمية ، ولا يتوفر المزيد من Ca ++ لانهيار ATP ، ولا توجد طاقة أخرى متاحة لمزيد من الانكماش للقسيم العضلي.

7. يتم استخدام جزء من الطاقة عن طريق كسر الجسور المتقاطعة وترتاح العضلات.

(ب) ما هى المجموعات الرئيسية للفقرات فى العمود الفقرى للإنسان؟
إجابة:
هناك 5 مجموعات من الفقرات وهي الفقرات العنقية والصدرية والقطنية والعجزية والفقرية العصعصية.
(الصيغة الفقرية هي C7، ت12، لام5، ج3-5 = 32 – 34).

السؤال 2.
(أ) ما هي الأغراض التي تخدمها حركة أجزاء الجسم الخارجية بالنسبة لمحور الجسم في الحيوانات؟
إجابة:

  1. تعمل حركة الأطراف والملاحق والرأس والجذع على تغيير وضع الجسم للحفاظ على التوازن ضد الجاذبية.
  2. تعتبر حركات الأطراف من المتطلبات الأساسية للقيام بالحركة.
  3. يتضمن الشد المسبق للطعام حركة اللسان والفكين والأنف والمخالب والأطراف والزوائد في الحيوانات المختلفة.
  4. تساعد حركة مقل العيون وصيوان الأذن على جمع المعلومات من البيئة الخارجية.

(ب) ما هي المفاصل الليفية والمفاصل الغضروفية ووظيفتها البيولوجية؟
إجابة:

  1. المفصل الليفي: العظام المفصلية متماسكة بقوة بواسطة العصابات الكثيفة من الأنسجة الليفية البيضاء القاسية غير القابلة للتمدد. إنها توفر القوة والدعم للجسم أو حماية الهياكل الحساسة التي لا يمكنها تحمل أي نوع من التشوه.
  2. المفاصل الغضروفية: في المفاصل الغضروفية ، يربط قرص كثيف من الغضروف الليفي الأبيض الأسطح المقابلة للعظام المفصلية مع بعضها البعض. هذا يسمح بحركة محدودة في المفاصل.

(ج) اشرح العضلات المعادية.
إجابة:
العضلات المعادية: العضلات المعادية هي تلك التي تنقبض لإنتاج حركات معاكسة في نفس المفصل. عندما تتقلص العضلة لإنتاج حركة ، يجب أن يرتاح خصمها للسماح بحدوث هذه الحركة ، على سبيل المثال ، العضلة ذات الرأسين هي FLEXER لمفصل الكوع والعضلة ثلاثية الرؤوس هي & # 8217s معادية وموسعة لذلك المفصل.

أثناء الانثناء في الكوع ، تنقبض العضلة ذات الرأسين وتسترخي العضلة ثلاثية الرؤوس ، أثناء التمدد في نفس المفصل تنقبض العضلة ثلاثية الرؤوس وتسترخي العضلة ذات الرأسين.

(د) التمييز بين نفض العضلات والكزاز أو شرح نفض العضلات والكزاز.
إجابة:
يُطلق على الانقباض الفردي المنفصل الناجم عن اندفاع عصبي واحد أو صدمة كهربائية ارتعاش العضلات. مباشرة بعد النفضة القصيرة ، تسترخي ألياف العضلات.

الكزاز هو حالة تركيز مستمرة تسببها العديد من المحفزات المتكررة. يحدث توتر أعلى بكثير في التيتانوس منه في نفضة منعزلة. يتم تنفيذ جميع أنشطتنا اليومية تقريبًا عن طريق تقلصات كزازية للعضلات.

السؤال 3.
كيف يتم ترتيب الخيوط السميكة والرقيقة في ألياف العضلات؟

العلاقة بين خيوط الأكتين والميوسين في حالات التمدد والتعاقد
إجابة:
تحتوي كل عضلة مخططة على خيوط رقيقة من الأكتين والميوسين السميك. يتم ترتيب هذه الخيوط طوليًا داخل نطاقات الضوء I والشرائط الداكنة على التوالي. تظل خيوط الأكتين والميوسين مرتبطة ببعضها البعض في اللييف العضلي. Sarcomeres هي صفوف الوحدة الوظيفية في كل ليف عضلي ، كل منها يمتد من الخط Z المظلم للفرقة I التالية. وهكذا فإن كل قسيم عضلي يتكون من شريط في المنتصف مع 2 نصف أنا على جانبيها.

من كل خط Z ، تتداخل خيوط الأكتين عبر نصف النطاق I مع نهايات خيوط الميوسين في النطاق A. يُحاط اللييف العضلي عند كل شريط من الأنابيب والأنابيب الخاصة بالشبكة الساركوبلازمية وعند كل تقاطع من العصابات A و I بواسطة أنبوب TI يتصل بالخارج الخارجي للخلية ، وهو موضح في الشكل. العلاقة بين الأكتين (الشعيرة الرقيقة) والميوسين (الشعيرة السميكة).


3 إجابات 3

الإجابة هي نعم ، يمكن لأي جسمين أن يدور كل منهما حول الآخر ، بما في ذلك الأرض والمشتري.

يجب أن تقلق بشأن Roche Limit ، الذي يخبرك إلى أي مدى يجب أن يكونا متباعدين من أجل القيام بذلك.

واعلم أن الجاذبية تعمل في كلا الاتجاهين ، حتى بالنسبة للأجسام الصغيرة: يتم سحب الأرض إلى الدوران بواسطة قمرنا تمامًا كما يتم سحب القمر إلى دوران الأرض: إنها ليست فقط المد والجزر التي يتحرك بها القمر ، لكن مركز الأرض يتحرك في دوائر صغيرة بسبب القمر.

لذا فإن الكواكب ذات الكتلة المتساوية ستدور حول بعضها البعض. لكن كوكب المشتري هو 318 ضعف كتلة الأرض ، وأكبر كوكب معروف في الكون تبلغ كتلته حوالي 30 ضعف كتلة كوكب المشتري. (FWIW أرضنا 81 × قمرنا).

ابحث عن Roche Limit الذي يجب أن يخبرك أيضًا بالمدار الأدنى الذي يجب أن يكون حول كوكبك الكبير (لكن المدار الفعلي يمكن أن يكون أكبر بآلاف المرات).

يقول روش ليميت إن الأرض لا يمكن أن تكون أقرب من كوكب المشتري بحوالي 67000 ميل دون أن تتفكك. ومع ذلك ، يمكن أن يكون كوكبك أبعد قليلاً ، فقمرنا يبعد حوالي 40 مرة عن جسمه الصلب Roche Limit من الأرض. لكن ما يعنيه هذا هو أنه يمكنك وضعه في المكان الذي تريده ولا يجب أن تكون بعيدًا جدًا عن عملاق الغاز. إذا كنت تريد تسخين المد والجزر لكوكبك (والكثير من الزلازل) ، فضعه قريبًا إذا كان كوكبك دافئًا بطريقة أخرى وتريده أكثر هدوءًا ، سأبقيه على بعد عشرين وحدة من روش ، لنقل 1.4 مليون ميل من كوكب المشتري.

أنت أفضل حالًا مع قمر صالح للسكن من الأرض التي تم الاستيلاء عليها. سيكون أحد السيناريوهات هو وجود قمر ضخم هاجر نحو كوكبه ، بينما هاجر الكوكب نحو شمسه. يتم تفسير الهجرة من خلال "الانكماش" الشامل ، لذا فهي متسقة ، ولا توجد ضرورة لوجود قفاز أو فيزياء بلياردو غير محتملة.

المشكلة هي أن عملاقك الغازي وكوكب الأرض لم يتشكلوا في نفس الجزء من النظام الشمسي. التفكير الحالي هو أن هناك خط صقيع محدد نشأ عندما تشكل السديم الشمسي في كواكب. داخل خط الصقيع تحصل على الكواكب الأرضية الصخرية ، وخلفها عمالقة الغاز والجليد.

من الممكن أن يهاجر كوكب الأرض - فقد خرج من مداره بفرشاة مع كوكب آخر ، ولكن من غير المحتمل أن يتم اقتلاعه برفق بواسطة عملاق غازي في مدار مستقر - مثل ضرب كرة بيسبول على بعد 10000 ميل للهبوط بلطف على قفاز الماسك. ربما لا تريد أن يكون كوكبك في النظام الشمسي الخارجي ، حتى لو كان بإمكانه الحفاظ على غلافه الجوي أثناء لعبة البلياردو الكونية.

يمكن تصديق عملاق الغاز المهاجر لأنه يمكن أن يهاجر بسهولة نحو الشمس ، ولكن بعد ذلك ما الذي جعله يتوقف عن الهجرة - على افتراض أن كوكب الأرض الخاص بك لا يتم جره إلى دوامة الموت؟ الجواب سيكون عملاق غازي أكبر في مدار رنيني ، ولكن مرة أخرى هذه المجموعة من الظروف تبدو وكأنها بلياردو كوني غير محتمل ، يشمل الآن ثلاثة كواكب.

مدارات الرنين غير مستقرة ، فهي لا "تستقر" جسمًا في أخدود مستقر بقدر ما تقذف الأجسام الأخرى بعيدًا. إن تعريفات الكوكب هي كيفية مسح مدارهم لجميع الكائنات الأخرى (نسبة الرنين 1: 1) ، ويُفترض أن كوكب المشتري هو الطفل الكبير الذي ألقى جميع الألعاب من عربة الأطفال. عندما يقترب عملاق الغاز الخاص بك من النظام الداخلي ، فإنه سيرسل كوكب تيرا الخاص بك إلى خارج النظام الشمسي قبل فترة طويلة من اقترابه بدرجة كافية ليتم التقاطه.

يبدو أن الاستيلاء على كوكب مارق أمر مستحيل أيضًا ، فقد يمزق هذا الكوكب المارق النظام الشمسي بسرعة الإفلات. هذا لن يعيق كوكبًا بلطف أيضًا.

القمر الصالح للسكن هو الطريقة المعقولة الوحيدة التي يمكن أن ينتهي بها الأمر بشيء مستقر.

يخبرني بحثي أن قمرًا حول عملاق غازي ليس من المرجح أن يكون أكبر من 1: 10000 من كتلة والده.

الحد النظري للكتلة بين كوكب وقزم بني هو حوالي 13 كتلة كوكب المشتري ، أو حوالي 4131.4 ضعف كتلة الأرض. وبالتالي إذا كان القمر لا يزيد عن 0.0001 مرة من كتلة عملاق الغاز ، فلا يمكن أن يكون له أكثر من 0.41314 ضعف كتلة الأرض.

كتلة كوكب المشتري 317.8 من الأرض. أضخم أقماره ، جانيميد ، تبلغ كتلته 0.025 من الأرض. وبالتالي فإن كتلة كوكب المشتري تساوي 12712 ضعف كتلة أضخم أقماره.

كتلة زحل 95.159 من الأرض. أكبر أقماره ، تيتان ، يبلغ كتلته 0.0225 من الأرض. وبالتالي فإن كتلة زحل تساوي 4229.28 ضعف كتلة أضخم أقماره.

كتلة أورانوس 14.536 من الأرض. أضخم أقماره ، تيتانيا ، كتلته 0.0005908 من الأرض. وهكذا تبلغ كتلة أورانوس 44603.926 ضعف كتلة أضخم أقماره.

كتلة نبتون 17.147 من الأرض. أضخم أقماره ، تريتون ، كتلته 0.00359 من الأرض. وبالتالي فإن كتلة نبتون تبلغ 4776.3231 ضعف كتلة أضخم أقماره.

وفقًا لأمثلة الكواكب الغازية العملاقة في نظامنا الشمسي ، يمكن لقمر بكتلة الأرض أن يدور حول كوكب غازي عملاق كتلته 4229.28 أو 4776.3231 ضعف كتلة الأرض ، والتي ستكون 13.307992 أو 15.029336 ضعف كتلة الأرض. كتلة كوكب المشتري. سيكون هذا أعلى قليلاً من الحد الأدنى النظري للكتلة للقزم البني.

أكبر وأضخم قمر في النظام الشمسي ، جانيميد ، يبلغ نصف قطره 0.4R⊕ فقط (R⊕ نصف قطر الأرض) وكتلة 0.025M⊕. يعتبر السؤال حول ما إذا كان من الممكن أن تكون المزيد من الأقمار الضخمة حول كواكب خارج المجموعة الشمسية مجالًا نشطًا للبحث. أظهر Canup and Ward (2006) أن الأقمار المتكونة في القرص المحيط بالكواكب العملاقة لها كتل تزيد عن 10−4 أضعاف كتلة الكوكب.

كانوب آر إم. Ward W.R. مقياس جماعي مشترك لأنظمة الأقمار الصناعية للكواكب الغازية. طبيعة سجية. 2006441: 834-839. [PubMed]

يصبح تكوين الكتلة المقيدة في الموقع أمرًا بالغ الأهمية بالنسبة للأقمار الخارجية حول الكواكب في IHZ للنجوم منخفضة الكتلة بسبب نقص الرصد لهذه الكواكب العملاقة. قدم Sasaki et al دراسة ممتازة حول تكوين أنظمة القمر الصناعي كوكب المشتري وزحل. (2010) ، الذي أظهر أن الأقمار ذات الأحجام المشابهة لـ Io و Europa و Ganymede و Callisto و Titan يجب أن تتراكم حول معظم عمالقة الغاز. علاوة على ذلك ، وفقًا للشكل 5 والتواصل الخاص مع Takanori Sasaki ، من الممكن تكوين المريخ - أو حتى الأقمار ذات الكتلة الأرضية حول الكواكب العملاقة. اعتمادًا على ما إذا كان الكوكب يكتسب كتلة كافية لفتح فجوة في القرص النجمي الأولي ، فمن المحتمل أن تكون أنظمة الأقمار الصناعية متعددة ورنين (كما في حالة المشتري) أو تحتوي على قمر رئيسي واحد فقط (انظر زحل). قام Ogihara and Ida (2012) بتوسيع هذه الدراسات لشرح التدرج التركيبي للأقمار الصناعية jovian. تشرح نتائجهم سبب ابتعاد الأقمار الغنية بالمياه عن كوكبها المضيف العملاق وتشير ضمناً إلى أن الالتقاط في 2: 1 الرنين المداري يجب أن يكون شائعًا. تتمثل طرق التحايل على مأزق عدم كفاية كتلة الأقمار الصناعية في التقاط الجاذبية للأقمار الضخمة (Debes and Sigurdsson ، 2007 Porter and Grundy ، 2011 Quarles et al. ، 2012) ، والتي يبدو أنها نجحت مع Triton حول نبتون (Goldreich et al. ، 1989 Agnor and Hamilton، 2006) التقاط أحصنة طروادة (Eberle et al.، 2011) سحب الغاز في مظاريف أولية حول الكوكب (بولاك وآخرون ، 1979) التقاط منسدل يحبس الأقمار الصناعية أو الأجسام المؤقتة بالقرب من نقاط لاغرانج في مدارات مستقرة ( Heppenheimer and Porco، 1977 Jewitt and Haghighipour، 2007) اندماج الأقمار (Mosqueira and Estrada، 2003) والتأثيرات على الكواكب الأرضية (Canup، 2004 Withers and Barnes، 2010 Elser et al.، 2011). تتوافق مثل هذه الأقمار مع الأقمار الصناعية غير المنتظمة في النظام الشمسي ، على عكس الأقمار الصناعية العادية التي تتشكل في الموقع. غالبًا ما تتبع الأقمار الصناعية غير المنتظمة مدارات بعيدة ، مائلة ، وغريبة الأطوار أو حتى رجعية حول كوكبها (Carruba et al. ، 2002). في الوقت الحالي ، نفترض أن الأقمار خارج المجموعة الشمسية - سواء كانت منتظمة أو غير منتظمة - موجودة.

ساساكي تي ستيوارت ج. Ida S. أصل البنى المختلفة لأنظمة الأقمار الصناعية كوكب المشتري. Astrophys J. 2010714: 1052-1064.

Ogihara M. Ida S. N- محاكاة تشكيل الأقمار الصناعية حول الكواكب العملاقة: أصل التكوين المداري لأقمار الجليل. Astrophys J. 2012753 دوى: 10.1088 / 0004-637X / 753/1/60.

تبلغ كتلة تريتون 2.0936 ضعف كتلة القمر المتكون في القرص الكوكبي لنبتون وفقًا لكانوب وورد. يعتقد أن نبتون قد أسر تريتون.

يبلغ حجم كتلة تيتان 2.3644 ضعف كتلة القمر المتكون في القرص الكوكبي لكوكب زحل وفقًا لكانوب وورد. وبالتالي ، يجب أن يكون تيتان قد اكتسب كتلته من خلال واحدة أو أكثر من العمليات المقترحة لتمكين الأقمار من تجاوز حد الكتلة الذي افترضه كانوب وورد.

لكن لماذا تعتبر عمالقة الغاز وأقمارهم النماذج الوحيدة لأنظمة الأقمار الصناعية لعمالقة الغاز؟

تبلغ كتلة الأرض 81.300813 ضعف كتلة القمر. باستخدام نظام الأرض والقمر كنموذج ، يمكن لقمر بكتلة الأرض أن يدور حول كوكب غازي عملاق كتلته 81.300813 ضعف كتلة الأرض ، وأقل كتلة من زحل.

تبلغ كتلة كوكب بلوتو القزم 8.1967 ضعف كتلة أكبر قمر له ، شارون. باستخدام نظام بلوتو-شارون كنموذج ، يمكن لقمر بكتلة الأرض أن يدور حول كوكب غازي عملاق كتلته 8.1967 ضعف كتلة الأرض ، وأقل كتلة من أورانوس.


وكالة التمويل

يحتوي حوالي 68.8٪ (1،143) من 1،662 مقالاً على سجلات تتعلق بوكالة التمويل. يمكن منح مشروع بحثي دعمًا ماليًا من أكثر من منحتين. لذلك ، تم استخراج 3452 سجلًا باستخدام BibExcel ، بما في ذلك رقم المنحة ، ونص التمويل ، وما إلى ذلك لتجنب الانحرافات الإحصائية التي تسببها التعبيرات المختلفة لوكالة التمويل ، مثل الاسم الكامل مع أو بدون الاسم الأوسط أو الأولي ، بالإضافة إلى العديد من الاختصارات ، كل هذه السجلات تم تحديدها وإعادة عدها يدويًا.

تم تصنيف أفضل 20 وكالة ممولة بناءً على عدد المقالات (شكل 3). كان لبرنامج CTSA أهم تأثير تمويلي على الطب الترجمي ، حيث نشر 30.2٪ (503) من المقالات ، تليها معاهد المعاهد الوطنية للصحة ، مثل NCI و NHLBI ، التي نشرت 4.0٪ و 3.3٪ (67 و 55) من المقالات ، على التوالي. . كما أبدت وكالات التمويل من الاتحاد الأوروبي والصين واليابان وألمانيا وكندا اهتمامًا كبيرًا بهذا المجال. بشكل عام ، تلقى الطب التحويلي اهتمامًا متزايدًا من الحكومات والمؤسسات الأكاديمية والمؤسسات الصيدلانية في جميع أنحاء العالم. 33 ، 34


5 إجابات 5

النقطة المهمة هي أنه في بعض الأحيان ، يمكن أن تؤدي النماذج المختلفة (لنفس البيانات) إلى وظائف الاحتمالية التي تختلف بواسطة ثابت الضرب ، ولكن يجب أن يكون محتوى المعلومات هو نفسه بوضوح. مثال:

قمنا بنمذجة تجارب Bernoulli المستقلة $ n $ ، مما أدى إلى البيانات $ X_1 ، dots ، X_n $ ، كل منها بتوزيع برنولي مع معلمة (الاحتمال) $ p $. يؤدي هذا إلى دالة الاحتمال $ prod_^ ن ص ^ (1-p) ^ <1-x_i> $ أو يمكننا تلخيص البيانات بواسطة المتغير الموزع ذو الحدين $ Y = X_1 + X_2 + dotsm + X_n $ ، الذي له توزيع ذي حدين ، مما يؤدي إلى دالة الاحتمال $ binom ص ^ ص (1 - ص) ^ $ والتي ، كدالة للمعامل غير المعروف $ p $ ، تتناسب مع دالة الاحتمال السابقة. من الواضح أن وظيفتي الاحتمال تحتويان على نفس المعلومات ، ويجب أن تؤدي إلى نفس الاستدلالات!

وبالفعل ، بحكم التعريف ، يعتبرون نفس وظيفة الاحتمال.

وجهة نظر أخرى: لاحظ أنه عند استخدام دوال الاحتمال في نظرية بايز ، حسب الحاجة لتحليل بايزي ، فإن مثل هذه الثوابت المضاعفة تلغي ببساطة! لذلك من الواضح أنها ليست ذات صلة بالاستدلال البايزي. وبالمثل ، سيتم إلغاؤها عند حساب نسب الاحتمالية ، كما هو مستخدم في اختبارات الفرضية المثلى (Neyman-Pearson lemma.) ولن يكون لها أي تأثير على قيمة تقديرات الاحتمالية القصوى. لذلك يمكننا أن نرى أنه في كثير من الاستدلالات المتكررة لا يمكن أن تلعب دورًا.

يمكننا الجدال من وجهة نظر أخرى. دالة احتمالية برنولي (من الآن فصاعدًا نستخدم مصطلح "الكثافة") أعلاه هي حقًا كثافة فيما يتعلق بقياس العد ، أي المقياس على الأعداد الصحيحة غير السالبة ذات الكتلة الواحدة لكل عدد صحيح غير سالب. لكن كان بإمكاننا تحديد الكثافة فيما يتعلق ببعض التدابير المهيمنة الأخرى. في هذا المثال ، سيبدو هذا (وهو) مصطنعًا ، لكن في المساحات الأكبر (مساحات الوظائف) يعد هذا أمرًا أساسيًا حقًا! دعونا ، لغرض التوضيح ، نستخدم التوزيع الهندسي المحدد ، المكتوب $ lambda $ ، مع $ lambda (0) = 1/2 $ ، $ lambda (1) = 1/4 $ ، $ lambda ( 2) = 1/8 دولار وهكذا. ثم كثافة توزيع برنولي بالنسبة إلى $ lambda $ يُعطى بواسطة $ f _ < lambda> (x) = p ^ x (1-p) ^ <1-x> cdot 2 ^ $ يعني أن $ P (X = x) = f_ lambda (x) cdot lambda (x) $ مع هذا القياس الجديد المسيطر ، تصبح دالة الاحتمال (مع التدوين من أعلى) $ prod_^ ن ص ^ (1 - ع) ^ <1-x_i> 2 ^ = p ^ y (1-p) ^ 2^ لاحظ $ العامل الإضافي $ 2 ^$. لذلك عند تغيير المقياس المسيطر المستخدم في تعريف دالة الاحتمال ، يظهر ثابت مضاعف جديد لا يعتمد على المعامل غير المعروف $ p $ ومن الواضح أنه غير ذي صلة. هذه طريقة أخرى لمعرفة كيف يجب أن تكون ثوابت الضرب غير ذات صلة. يمكن تعميم هذه الحجة باستخدام مشتقات Radon-Nikodym (كما في الحجة أعلاه مثال على.)


شاهد الفيديو: الأنسجة الطلائية. الفصل الأول المحاظرة الثالثة. مدرس علاء حسين الميالي (كانون الثاني 2022).