معلومة

العثور على مجموعة بيانات Rna-Seq لـ C. Elegans (Caenorhabditis elegans)


أرغب في العثور على مجموعة بيانات RNA-Seq لـ C. Elegans لاستخدامها في برنامج RNA-Skim. بالنسبة لأولئك الذين لا يعرفون RNA-Skim اسمحوا لي أن أشرح ذلك قليلاً. إنها أداة تستخدم لقياس بيانات RNA-Seq باستخدام سيج ميرس(نوع خاص من k-mer). أولاً ، تقوم RNA-Skim بتجميع جينات ترميز البروتين وإيجاد سلاسل فرعية خاصة بمجموعة من هذا الجين. بعد مرحلة الإعداد هذه ، تأخذ بيانات RNA-seq كمدخل وتحاول تحديد النصوص الموجودة فيها. لذلك ، أحتاج إلى العثور على مجموعة بيانات بتنسيق تنسيق ملف فاستا لهذه الخطوة. نظرًا لأنني جديد تمامًا في هذا المجال ، فهل هناك أي شخص يمكنه تزويدني بمعلومات حول كيف يمكنني العثور عليها؟ يمكن العثور على معلومات كاملة حول RNA-skim هنا: RNA_SKIM

تعديل نوع مجموعة البيانات التي أبحث عنها هو شيء من هذا القبيل: http://codepad.org/n3ioT3nj.


انتقل إلى NCBI-SRA أو GEO وابحث عن بيانات RNAseq. تعيين الكائن الحي C. ايليجانس واختياريا أي كلمات رئيسية أخرى تهتم بها. سيعطيك مصطلح البحث هذا جميع بيانات RNAseq في SRA من C. ايليجانس:
("caenorhabditis elegans" [كائن]) و "إستراتيجية rna seq" [خصائص]
ستجد الملفات بشكل عام بتنسيق سريع تنسيق يمكنك تحويله بسهولة إلى Fasta. هناك العديد من الأدوات التي تقوم بذلك ؛ يمكنك أيضًا القيام بذلك باستخدام البرنامج النصي الخاص بك. سيؤدي اتباع أمر awk إلى تنفيذ المهمة:

awk 'NR٪ 4 == 1 {print ">" substr ($ 0،2)} NR٪ 4 == 2 {print}' data.fastq> data.fasta

بصرف النظر عن SRA ، يمكنك أيضًا إلقاء نظرة على ENA (أرشيف النوكليوتيدات الأوروبي) و DDBJ


الجمع بين تسلسل الحمض النووي الريبي أحادي الخلية والأطلس الجزيئي يكشف عن علامات جديدة لـ C. ايليجانس فصول الخلايا العصبية

تسلسل الحمض النووي الريبي أحادي الخلية (تسلسل سكرنا) من أنواع معينة انيقة (C. ايليجانس) يوفر الجهاز العصبي فرصة فريدة للحصول على ملف تعريف تعبير جزئي لكل خلية عصبية داخل شبكة عصبية معروفة. بناء على بيانات تسلسل scRNA الحديثة [1] وعلى الأطلس الجزيئي الذي يصف نمط التعبير عن

800 جين بدقة خلية واحدة [2] ، قمنا بتصميم تحليل تجمعي متكرر يهدف إلى مطابقة كل مجموعة خلوية مع

100 فئة عصبية محددة تشريحيًا من C. ايليجانس. نجح هذا النهج الإرشادي في تعيين 58 مجموعة إلى فئة الخلايا العصبية المقابلة لها. 11 مجموعة أخرى جمعت فئات الخلايا العصبية التي تشترك في تواقيع جزيئية قريبة ولم يتم تعيين 7 مجموعات. بناءً على هذه التشكيلات الجزيئية الـ 76 ، قمنا بتصميم 15 مروجًا جديدًا خاصًا بفئة الخلايا العصبية تم التحقق من صحته في الجسم الحي. من بينها ، 10 تمثل المروج المحدد الوحيد الذي تم الإبلاغ عنه حتى يومنا هذا ، مما يوسع قائمة الخلايا العصبية القابلة للتلاعب الجيني. أخيرًا ، لاحظنا تعبيرًا تفاضليًا للجينات ذات الصلة وظيفيًا بين الخلايا العصبية الحسية والداخلية والحركية في C. ايليجانس، مما يشير إلى أن طريقة التنويع الوظيفي قد تختلف وفقًا للطرائق العصبية.


المواد والأساليب

C. ايليجانس سلالات

استخدمنا سلالتين متحولة متماثلة اللواقح: فيم 3 (q96gf) IV، وهي حساسة لدرجة الحرارة ، و الضباب -2 (q71) الخامس. ال fem-3 (q96gf) تم الحفاظ على المخزونات عند 15 & # x000b0 ونمت حيوانات التجارب عند 22 & # x000b0 الضباب -2 تم الحفاظ على المسوخ في 22 & # x000b0. للتحكم في المناعة ، استخدمنا سلالة بريستول N2 من النوع البري ، نمت أيضًا عند 22 & # x000b0.

تشريح الغدد التناسلية من أجل المناعة

تم قطع صغار البالغين المتزامنين (0 & # x020132 ساعة بعد L4 إلى ذوبان بالغ) خلف البلعوم في PBS-Tween (0.1 ٪ توين 20) مع 0.25 ملي مولار من الحيوانات التي تم تشريحها ليفاميزول وتم إصلاحها في بارافورمالدهيد 3 ٪ ، 0.1 م ك2HPO4 لمدة 30 دقيقة ونفاذية في 100٪ ميثانول عند & # x0221220 & # x000b0 لمدة 30 دقيقة. تم غسل العينات ثلاث مرات في PBST وتم منعها في PBST بالإضافة إلى 0.5٪ BSA لمدة 30 دقيقة عند درجة حرارة الغرفة. تم تحضين العينات بالأجسام المضادة الأولية عند 4 & # x000b0 بين عشية وضحاها في PBST بالإضافة إلى 0.5٪ BSA في التخفيف التالي: فأر مضاد لـ SP56 (1: 100) (هدية من S. Strome) وأرنب مضاد لـ RME-2 (1: 500) (هدية من B. Grant). تم تحضينهم بعد ذلك مع الأجسام المضادة الثانوية المقترنة Cye3 و FITC (Jackson ImmunoResearch) ، كلاهما بتخفيف 1: 1000 في PBST بالإضافة إلى 0.5٪ BSA ، لمدة ساعة واحدة عند درجة حرارة الغرفة. أخيرًا ، تم تركيب العينات على شرائح في VectaShield تحتوي على DAPI لتصور الحمض النووي وتصويرها باستخدام مجهر Zeiss Axioimager.

عزل الغدد التناسلية لاستخراج الحمض النووي الريبي

تم قطع الشباب البالغين المتزامنين (0-2 ساعة بعد L4 إلى الذروة البالغة) أولاً خلف البلعوم كما هو موضح أعلاه. ثم تم قطع أذرع الغدد التناسلية عند الحيوانات المنوية أو بالقرب منها لعزلها عن الذبيحة. تم استخراج إجمالي الحمض النووي الريبي من الغدد التناسلية باستخدام TRIzol (Invitrogen) و RNeasy Mini Kit (Qiagen) باتباع تعليمات الشركة المصنعة & # x02019s.

يكرر وتسلسل

أنتجنا ثماني عينات مستقلة لـ الضباب -2 وثمانية أخرى من أجل فيم 3. احتوت كل عينة على ما يقرب من 30 ذراعا من الغدد التناسلية ومعظم (14/16) كان تركيز الحمض النووي الريبي الكلي لها 20 & # x0201334 نانوغرام / مل. أعد مركز التكنولوجيا الحيوية بجامعة ويسكونسن مكتبات لكل عينة باستخدام بروتوكول تسلسل TruSeq Illumina ، والذي يتضمن تنقية mRNA (اختيار poly-A) والتجزئة ، وتوليف cDNA ، وإصلاح النهاية ، وربط المحولات ، وإثراء جزء الحمض النووي. تم ترميز كل مكتبة بشفرة شريطية وتسلسلها في أربعة ممرات مختلفة للحصول على قراءات أحادية النهاية تبلغ 101 نقطة أساس باستخدام Illumina HiSeq2000. لقد حصلنا على أكثر من 36 مليون قراءة لنقاط الجودة العالية (& # x0003e35 يعني نقاط الجودة) في المتوسط ​​لكل عينة. جميع بيانات التسلسل متاحة في قاعدة بيانات المعاهد الوطنية للصحة Gene Expression Omnibus تحت رقم المدخل <"type": "entrez-geo" ، "attrs": <"text": "GSE57109" ، "term_id": "57109"> > GSE57109.

تحليل النصوص

استخدمنا TopHat2 v2.0.11 (مع خيار & # x02212g 1) (Trapnell وآخرون. 2012) لمحاذاة القراءات إلى C. ايليجانس الجينوم المرجعي (WBcel235.75.fa) والشروح الجينية (WBcel235.75.gtf) في WormBase WS240 (Ensembl) (Flicek وآخرون. 2014). للتوافق مع برنامج عد الميزات ، أنشأنا إصدارات SAM مصنفة ومفهرسة من ملفات BAM (SAMtools) (Li وآخرون. 2009). لإنشاء مجموعة بيانات عدد القراءة ، قمنا بمعالجة ملفات SAM باستخدام نصوص Python النصية الموضحة في مكان آخر (Anders and Huber 2010). كان قطعنا عبارة عن قراءتين معينتين لكل جين لكل من ثمانية مكررات أو ما لا يقل عن 16 قراءة إجمالية لكل جين ، تم تطبيقها على كل متحولة بشكل مستقل. تمت إزالة الجينات ذات التعليقات التوضيحية الغامضة أو عدد أقل من القراءات (& # x0003c16 قراءة / جين). لتحديد النصوص المعبر عنها تفاضليًا ، استخدمنا حزمة R / Bioconductor DESeq ، وهي طريقة شائعة لتقييم التعبير التفاضلي (Anders and Huber 2010 Rapaport وآخرون. 2013). يقوم DESeq بالتطبيع من خلال تطبيق عامل تحجيم على كل عينة ، وهذا عامل القياس هو الوسيط المحسوب من نسب عدد القراءة لكل جين إلى المتوسط ​​الهندسي لجميع العينات (Anders and Huber 2010 Rapaport وآخرون. 2013). حددنا أيضًا الوفرة كـ rpkm باستخدام Cufflinks v2.1.1 (مع خيارات & # x02212N و & # x02212u و & # x02212b) (Trapnell وآخرون. 2012) (المعلومات الداعمة ، الجدول S1). في المجموع ، وجدنا 10754 جينًا معبرًا بشكل لا لبس فيه مع ما لا يقل عن 16 قراءة محاذاة عالية الجودة وفريدة من نوعها. لتخطيط البيانات ، استخدمنا حزمة ggplot2 R / Bioconductor (Wickham 2009).

تحليل استخدام إكسون

استخدمنا TopHat v2.0.11 (& # x02212m 2 & # x02212g 1 و & # x02212G خيارات) لمحاذاة القراءات مع C. ايليجانس الجينوم المرجعي (WS235). استخدمنا أزرار Cufflinks الإصدار 2.1.1 (مع خيارات & # x02212N و & # x02212u و & # x02212b) (Trapnell وآخرون. 2010 ترابنيل وآخرون. 2012) لتجميع الأشكال الإسوية وقياس التعبير الإسوي. لتحليل استخدام exon التفاضلي بين الغدد التناسلية المنوية و oogenic ، استخدمنا حزمة DEXSeq لـ R / Bioconductor (Anders وآخرون. 2012). حصلنا على قراءات لكل exon من ملفات المحاذاة باستخدام برنامج نصي مصاحب لحزمة DEXSeq. للحصول على درجات مختلفة بشكل كبير في exon ، قمنا بتعيين معدل اكتشاف خاطئ & # x0003c1٪ ومتطلب تغيير أضعاف الحد الأدنى من الضعف. وضعنا أيضًا حدًا أدنى لعتبة التعبير من قراءتين لكل exon. استخدمنا التعليقات التوضيحية الجينية في WS240 ونصًا مخصصًا لمقارنة نتائج exon التفاضلية مع استخدام exon البديل المشروح. كما تم استخدام البرامج النصية المخصصة لحساب عدد وصلات exon & # x02013spanning لملفات المحاذاة لتحديد ما إذا كان استخدام exon البديل في منطقة ترميز أو غير مشفرة ولتمييز أنواع الربط البديلة التي تمت ملاحظتها. تم استخدام متصفح UCSC Genome Browser ce10 (www.ucsc.genome.edu) لتصور الربط البديل لملفات WIG التي تم تحويلها من ملفات BAM باستخدام SAMtools mpileup (SAMtools) (Li وآخرون. 2009) ونص مخصص.


ملخص المؤلف

ج. ايليجانس هو أبسط نظام نموذج متعدد الخلايا ، مع 959 خلية جسدية فقط في البالغين المطورين بالكامل. يصف هذا العمل عزل وتحليل تسلسل الحمض النووي الريبي لأنسجة الدودة البالغة الرئيسية. في السابق ، كان عزل الأنسجة البالغة يعوقه قساوة الدودة الخارجية ، ولكن تحديد ترانسكريبتومات الأنسجة البالغة ضروري لفهم بيولوجيا البالغين ، والتي تختلف اختلافًا جوهريًا عن الخلايا الجنينية واليرقات. لقد طورنا مؤخرًا طريقة لعزل الأنسجة البالغة وتسلسل الحمض النووي الريبي (RNA) ، وطبقناها هنا لتوصيف نسخ العضلات والخلايا العصبية والأمعاء والبشرة البالغة وملامح الشكل الإسوي. تكشف البيانات عن خصائص جديدة مثيرة للاهتمام للأنسجة البالغة ، لا سيما وظيفة التمثيل الغذائي تحت الجلد ، والتي اختبرناها وظيفيًا. تم استخدام نسخ الأنسجة أيضًا لتحديد أخصائيي تقويم الأنسجة البشرية ذوي الصلة بطريقة غير متحيزة. أخيرًا ، نقدم أداة تنبؤ جديدة للتعبير الجيني في ما يصل إلى 76 نوعًا من الأنسجة والخلايا ، ونوضح فائدتها ليس فقط في التنبؤ بالتعبير الجيني الخاص بالخلية ، ولكن في تشخيص تغيرات التعبير في المسارات والسياقات الجينية المختلفة.

الاقتباس: Kaletsky R و Yao V و Williams A و Runnels AM و Tadych A و Zhou S وآخرون. (2018) تحليل النسخ للبالغين أنواع معينة انيقة تكشف الخلايا عن الجينات الخاصة بالأنسجة والتعبير الإسوي. بلوس جينيه 14 (8): e1007559. https://doi.org/10.1371/journal.pgen.1007559

محرر: جريجوري س. بارش ، كلية الطب بجامعة ستانفورد ، الولايات المتحدة

تم الاستلام: 14 مارس 2018 وافقت: 13 يوليو 2018 نشرت: 10 أغسطس 2018

حقوق النشر: © 2018 كاليتسكي وآخرون. هذا مقال مفتوح الوصول يتم توزيعه بموجب شروط ترخيص Creative Commons Attribution License ، والذي يسمح بالاستخدام غير المقيد والتوزيع والاستنساخ في أي وسيط ، بشرط ذكر المؤلف والمصدر الأصليين.

توافر البيانات: يتم إيداع التسلسلات في NCBI BioProject PRJNA400796.

التمويل: سي تي إم هو مدير مركز جلين لأبحاث الشيخوخة في برينستون وعالم كلية HHMI-Simons. OGT هو زميل أول في برنامج الشبكات الجينية التابع للمعهد الكندي للأبحاث المتقدمة (CIFAR). تم دعم هذا العمل من قبل NIH (جائزة DP1 Pioneer (GM119167) والشيخوخة المعرفية R01 (AG034446) إلى CTM ، و R01 GM071966 إلى OGT) ، وكذلك من قبل مؤسسة جلين الطبية. تم دعم VY و AMR جزئيًا بواسطة منح NIH T32 HG003284 و T32GM007388. لم يكن للممولين أي دور في تصميم الدراسة أو جمع البيانات وتحليلها أو اتخاذ قرار النشر أو إعداد المخطوطة.

تضارب المصالح: وقد أعلن الباحثون إلى أن لا المصالح المتنافسة موجودة.


مناقشة

النتائج الرئيسية من هذه الدراسة هي تقليل ديناميكيات التعبير الجيني إلى مشعب أحادي البعد كشف عنه تحليل المكون الرئيسي (PCA) ، واستقرار بصمة الشيخوخة عبر الظروف البيولوجية ، وتوسيع نطاق التشابه الذاتي لكل من مسارات نسخ الشيخوخة ومنحنيات البقاء. ، وهضبة الوفيات التجريبية عند المستوى المتوقع لأسس جومبيرتز ، وتحديد علاجات صيدلانية جديدة محتملة لإطالة العمر.

يمكن تفسير السمات المرصودة لديناميكيات الشيخوخة بمساعدة فرضية "الشيخوخة في الحرجة" 12. تقترح هذه الفرضية أن شبكات تنظيم الجينات لمعظم الأنواع تعمل بالقرب من نقطة تشعب اضطراب الترتيب 50 وهي في جوهرها غير مستقرة. على مقربة من التشعب ، تكون ديناميكيات الحالة الفيزيولوجية للكائن الحي ذات بعد واحد بشكل فعال. يتيح لنا هذا التخفيض في مسار ناقل الحالة الفسيولوجية في مساحة نسخ الجينات متعددة الأبعاد تحديد تقدم الشيخوخة من خلال متغير عشوائي واحد يمثل العمر البيولوجي. يرتبط هذا المؤشر الطبيعي لشيخوخة الكائن الحي ارتباطًا مباشرًا بالوفاة (انظر طرق للحصول على مزيد من التفاصيل). هذه الخاصية لشبكة تنظيم الجينات الأساسية هي سمة مشتركة للشبكات المعقدة بغض النظر عن مدى تعقيد الشبكة وكبرها ، يمكن للمرء أن يميز النظام بحالته الطبيعية ومتغيرات التحكم ، وبالتالي يصف النظام بشكل فعال من خلال معادلة غير خطية أحادية البعد 51،52. عند القيام بذلك ، يقدم المرء معلمة فعالة على مستوى الكائن الحي تجمع بين جميع الميزات المجهرية لطوبولوجيا الشبكة في رقم واحد أو صلابة أو مرونة للشبكة (نظير لمعدل الشيخوخة). متغير الحالة الفعال هو معلمة ماكروسكوبية أخرى (معلمة الطلب) ، والتي تلعب دور مؤشر عملية الشيخوخة ويمكن أن تعزى إلى معنى العمر البيولوجي.

الثبات الظاهر لتوقيع الشيخوخة عبر ظروف بيولوجية مختلفة إلى حد كبير ليس مفاجئًا من المنظور النظري نظرًا لأن توقيعات العمر والشيخوخة مرتبطة بأصغر قيمة ذاتية والمتجه الذاتي المقابل لمصفوفة التفاعل الجيني الجيني ، على التوالي. الاضطرابات الصغيرة ، مثل آثار الطفرات أو RNAi ، تنتج تحولات صغيرة في قيمة eigenvalue الصغيرة بالفعل ، وبالتالي قد تسفر عن اختلافات كبيرة جدًا في العمر. في نفس الوقت ، تعديلات اتجاه الشيخوخة من خلال اضطراب ضعيف من المتوقع أن تكون صغيرة. الاستنتاج عام إلى حد ما وينطبق على الشيخوخة في الأنواع الأخرى ، انظر ، على سبيل المثال ، PCA لمستويات التعبير الجيني في الذباب الذي يتغذى بشكل طبيعي والمقيّد بالسعرات الحرارية 53،54.

نظرًا للطبيعة القوية والفعالة أحادية البعد للتغيرات أثناء الشيخوخة ، يمكن استخدام مجموعة بيانات كبيرة بما يكفي لإنتاج نموذج عمر بيولوجي عالمي ، مثل ، في أبسط أشكاله ، تراجع مستويات التعبير الجيني في العمر الزمني ، مناسبة لدراسات الشيخوخة المستقبلية في ج. ايليجانس. إن حجم وعلامة مساهمات النصوص الفردية في العصر البيولوجي ليست فريدة من نوعها بسبب التباين العالي داخل كل مجموعة فرعية من الجينات المعبر عنها بالتنسيق. يجب إصلاح النموذج بأي مطلب إضافي معقول ، مثل التباين ، وبالتالي ليس له معنى فيزيائي أو بيولوجي مباشر بخلاف توفير أداة ملائمة لتحليل البيانات التجريبية.

يحدد العمر البيولوجي كدالة للعمر الزمني مسار الشيخوخة ، وبالتالي يمكن استخدامه لتمييز تقدم الشيخوخة عبر السلالات. في وقت مبكر من الحياة ، حتى متوسط ​​العمر التقريبي ، فإن الارتفاع المعتمد على العمر في العمر البيولوجي هو وظيفة عالمية لمتغير عمر بلا أبعاد ، يتم الحصول عليه عن طريق إعادة قياس العمر الزمني إلى متوسط ​​العمر المتوقع للسلالة. من السهل تفسير هذا إذا كان تأثير القوى العشوائية صغيرًا بعد عمر معين ، وبالتالي فإن التقدم يكون حتميًا تقريبًا بنفس المقياس الزمني الذي يحدد شكل اختلافات التعبير الجيني وقيمة متوسط ​​العمر. من الناحية النظرية ، يحدث هذا عندما يتجاوز متوسط ​​العمر إلى حد كبير معدل الوفيات بمقدار الضعف. من الناحية العملية ، يكون الافتراض صحيحًا من الناحية النوعية فقط ، ولكنه لا يزال يوفر تفسيرًا معقولًا للوضع التجريبي. وفقًا للنموذج ، يتم تحديد المقياس الزمني من خلال صلابة الشبكة التنظيمية للجينات الأساسية ، وبالتالي يرتبط ميكانيكيًا بخصائص مستوى الكائن الحي ، مثل العمر الافتراضي ، بخصائص التفاعل الجزيئي القابلة للتعديل المحتمل للشبكة التنظيمية الأساسية ، مثل الخصائص الجزيئية المميزة والضرر الجيني ومعدلات الإصلاح 54.

نتوقع أن تعتمد ديناميكيات التعبير الجيني والوفيات بشكل متزايد على اللاخطية لشبكة تنظيم الجينات المتحللة تدريجيًا ، حيث تزعجها قوى الانجراف والشيخوخة العشوائية. الانحرافات الكبيرة في مستويات التعبير الجيني عن حالة الشباب لا تتوافق مع البقاء. ومن ثم فإن الديناميكيات العشوائية لمتغير العمر البيولوجي توفر اقترانًا ميكانيكيًا مع معدل الوفيات. ينبغي أن تكون الشمولية المتدرجة للتباين في مستويات نسخ الجينات ، على طول مسار الشيخوخة الموضح في الشكل 3 (أ) ، بدورها الأساس الجزيئي للقياس الزمني لمنحنيات البقاء على قيد الحياة 13. في تلك الدراسة ، تعرضت الديدان الخيطية إلى ضغوط مختلفة لتقصير الحياة ، وتم تقليل عمرها بطريقة تجعل أي منحني للبقاء على قيد الحياة يمكن فرضه من خلال تغيير بسيط للعمر. تتبع بيانات البقاء على قيد الحياة لدينا مع طفرات تطيل الحياة ، وتداخل الحمض النووي الريبي ، والتدخلات الدوائية ، نفس النمط. يعمل تحويل القياس بشكل جيد للغاية ويجمع مسارات الشيخوخة للحيوانات ذات متوسط ​​عمر مختلف تمامًا للبالغين: من 17 يومًا فقط لديدان التحكم من النوع البري N2-DRM إلى 160 يومًا لمدة سن-1(ملغ 44) المسوخ. لم يتم التحقيق حتى الآن فيما إذا كان المقياس الزمني لمسارات الشيخوخة يمكن تعميمه على تدخلات تقصير الحياة ، وقد يكون معقدًا بسبب تعدد المسارات التي يؤدي تعطيلها إلى تقليص العمر الافتراضي.

إن التحجيم الزمني لمسارات الشيخوخة ومنحنيات البقاء هو ، بالطبع ، بيان تقريبي ، لأن التعبير الجيني والعمر يعتمدان أيضًا على عوامل بيئية وعشوائية داخلية. قد يكون هذا تفسيرًا وراء الانحرافات عن القياس الزمني لمنحنيات البقاء على قيد الحياة في مكررات مختلفة لنفس السلالة في المرجع. 13. قد تؤدي بعض الظروف الخارجية أو التدخلات العلاجية ، من حيث المبدأ ، إلى تأخير أو تسارع في النمو دون تغيير في معدل الشيخوخة ، وبالتالي تنتج انحرافات عن سلوك القياس العام. قد تكون سلالة DR1694 ، التي توضح منحنى البقاء الأكثر تعارضًا في تحليلنا ، مثالًا على مثل هذا السلوك وتستحق دراسة مستقلة. DR1694 هي السلالة الوحيدة التي تحتوي على طفرتين (للجينات التي تشفر مستقبلات الأنسولين / IGF1 ومستقبلات الهرمون النووي).يتفاعل هذان الجينان المتحوران بطرق خاصة بالأليل ، بحيث تكون بعض التوليفات قصيرة العمر بينما البعض الآخر طويل العمر. يشير هذا إلى توازن دقيق بين المنتجات الجينية لأنها تؤثر على العمر الافتراضي.

يجب أن يستقر العمر البيولوجي عند متوسط ​​العمر الافتراضي تقريبًا ، وهو ما لوحظ بالفعل في جميع مجموعاتنا التجريبية عبر مدى 10 أضعاف من الاختلاف في العمر (الشكل 3 (أ)). مع اقتراب العمر البيولوجي من القيمة المحددة ، يتباطأ معدل الوفيات أيضًا ويصل إلى مستوى ثابت عند مستوى أس جومبيرتز الذي تم الحصول عليه من نوبة أسية في النطاق العمري القريب من متوسط ​​العمر 12. باستخدام بيانات البقاء على قيد الحياة عالية الجودة 13 ، أكدنا تمامًا التنبؤ النظري وأظهرنا أن معدل الوفيات المعتمد على العمر في ج. ايليجانس يتباطأ بالفعل ويصل إلى هضبة في العصور المتأخرة بالقرب من المستوى المتوقع. لا تقتصر هذه الظاهرة على التجارب على الديدان الخيطية 55 ويفترض أنها تكمن وراء الهضبة في معدلات الوفيات التي لوحظت سابقًا في مجموعات كبيرة جدًا من الذباب المتوسط ​​وذباب الفاكهة 56،57،58،59،60،61 ، والتي قمنا بتوسيعها هنا لتشمل نسبيًا و مجموعات متجانسة من ج. ايليجانس (الشكل 5). تتوافق النتائج مع التوقعات ، جنبًا إلى جنب مع الشمولية المتدرجة لمسار الشيخوخة ، في كل من الترانسكريبتومات ، الشكل 3 (أ) ، ومنحنيات البقاء المقابلة ، الشكل 3 (ب) ، تدعم نموذجنا النظري.

بالنسبة للبشر ، فإن وجود هضبة الوفيات هو موضوع نقاش 62،63،64،65،66،67،68 ، ويرجع ذلك في الغالب إلى عدم وجود ناجين لأعمار تتجاوز إلى حد كبير متوسط ​​عمر الإنسان. يؤدي عدم وجود مثل هذه البيانات إلى حساسية عالية لهضبة الوفيات البشرية للأخطاء الديموغرافية 66،68. في المقابل ، ل ج. ايليجانس تتوفر بيانات الوفيات عالية الجودة لأعمار تصل إلى ضعف متوسط ​​عمر الديدان الخيطية ، وبالتالي ، في هذه الحالة بالذات ، فإن الطبيعة الواقعية لهضاب الوفيات غير محتملة.

تم اقتراح تفسيرات متعددة ، لاستقرار معدل الوفيات في الأعمار المتقدمة 69،70،71 ، وكلها تنطوي على نماذج متعددة المعلمات. الميزة الرئيسية لنهجنا هي ، على الأقل في ج. ايليجانس، يتم شرح الزيادة الأسية في معدل الوفيات في وقت مبكر من العمر وتشبع معدل الوفيات في وقت متأخر من العمر في إطار نظرية تفاعل-حركية بسيطة تعتمد فقط على معلمة واحدة. يمكن التعرف على هذه المعلمة مع مضاعفة معدل الوفيات الأس الذي تم قياسه في منتصف العمر على مستوى السكان ، ومع صلابة الشبكة التنظيمية الأساسية على المستويات الجزيئية المجهرية.

يكتسب القياس الكمي لتقدم الشيخوخة باستخدام رقم واحد ، مثل الانحدار في عمر المتغيرات الفسيولوجية التي تمثل حالة الكائن الحي ، قوة جذب في مجتمع أبحاث الشيخوخة. أحد أكثر النماذج نجاحًا من هذا النوع هو "عمر مثيلة الحمض النووي" ، وهو مجموع مرجح لخصائص مثيلة الحمض النووي ، تم تدريبه على "التنبؤ" بالعمر الزمني عند البشر 72.73.774 والفئران 75.76. ومع ذلك ، نلاحظ أن المنفعة العملية لمفهوم العمر البيولوجي تعتمد ضمنيًا على الافتقار المفترض للتغير في معدل الشيخوخة في الدراسة. تشير الشمولية المتدرجة لمسار الشيخوخة المذكورة هنا إلى أن هذا الافتراض ليس صحيحًا بالضرورة ، على الأقل في التجارب مع ج. ايليجانس. ومع ذلك ، يبدو أن معدل الشيخوخة مستقر في الفئران 77 وفي البشر 78،79،80 ، مما يشير إلى أن العمر منظم بشكل أكثر إحكامًا في الثدييات منه في الديدان الخيطية - بما يتوافق مع ندرة الطفرات العفوية طويلة العمر بين "الأعلى". الكائنات الحية.

تساعد تأثيرات عدم التجانس العشوائية المتزايدة (بما في ذلك تسوية معدل الوفيات والحيوية) في توضيح متى يجب تطبيق علاج مضاد للشيخوخة للحصول على أكبر تأثير ممكن. نتوقع أنه في مراحل ما قبل الجنين والمضغة في أبسط الحيوانات ، أو في وقت مبكر من حياة الإنسان ، يتم تحديد نمو الكائن الحي إلى حد كبير من خلال برنامج تنموي. في الأعمار الأكثر تقدمًا ، تؤثر العشوائية في حركيات شبكة تنظيم الجينات وتؤدي إلى زيادة عدم التجانس الظاهري على كل المستويات. وفقًا لذلك ، نتوقع أن يكون للتدخلات المضادة للشيخوخة في المراحل المبكرة تأثير أوسع وأكثر عمومية على الشيخوخة عبر الأنواع المختلفة. في المقابل ، يجب اختيار التدخلات المطبقة في الأعمار المتأخرة بدقة للمساعدة في علاج حالات معينة للفرد في نقطة معينة على طول مسار الشيخوخة نتيجة لتاريخ الحياة في شكل أخطاء متراكمة عشوائياً.

يتكون توقيع الشيخوخة العالمي من عدد قليل نسبيًا من الجينات (أقل من 7 ٪ من جميع النصوص المتاحة) ، ويتم إثرائها بأهداف منظمات التعبير الجيني التي تعزز طول العمر عبر مسارات متباينة ، مثل DAF-16 (مدروس جيدًا) عامل النسخ FOXO الذي يتوسط مسارات طول العمر الرئيسية) 81 ، ELT-2 (عامل نسخ ينظم المكونات النهائية لمسار الأمعاء DAF-2 / DAF-16 يطيل العمر الافتراضي 15-25٪ 36) ، ELT-6 (RNAi يطيل العمر 37 ) ، NHR-1 ، NHR-10 ، NHR-86 ، ZTF-9 ، يترك-7 و miR-60 (انظر الجدول 3 للتحليل الكامل للتمثيل الزائد). وبالتالي سيكون من المفيد إجراء اختبار تجريبي لبعض النتائج غير المميزة من قوائمنا. اختبرنا ما إذا كانت التدخلات الصيدلانية (أزاسيتيدين ، ميتاميزول ، ألستيرباولون وأنيسوميسين) تنبأت بإحداث اضطرابات معارضة لتغير الشيخوخة ستقلل من معدل الشيخوخة وتطيل العمر ، وأظهرت أنها تطيل العمر بالفعل. تم بالفعل فحص نسخة من قاعدة بيانات LOPAC المركبة الشاملة التي تحتوي على 1280 إدخالًا لمعرفة تأثيرات إطالة العمر في ج.ايليجانس 6. ومع ذلك ، لم يتم اختبار ثلاث من نتائجنا الأربعة (ميتاميزول ، ألسترباولون وأنيسوميسين) هناك ، والرابعة (أزاسيتيدين) تم اختبارها بنتيجة سلبية ، والتي ربما تكون بسبب السمية عند جرعة أعلى من 33 ميكرومترM المستخدمة للفحص الأولي. في تجربتنا ، كانت جميع الأدوية أكثر فعالية عند 1 ميكرومترM من عند 10 ميكرومترM ، مما يوحي ببعض السمية عند تناول جرعة أعلى. يتضح هذا بشكل أكبر بالنسبة للأنيسوميسين ، وهو محايد أو ضار عند 10 ميكرومترم.

Alsterpaullone هو مثبط تنافسي لـ ATP للكينازات المعتمدة على السيكلين (Cdk1 / cyclin B ، Cdk2 / cyclin A ، و Cdk5 / p25) ، وبفعالية أكبر ، من الجليكوجين سينثيز كيناز GSK-3β. من خلال النشاط الأخير ، فإنه يمنع الفسفرة المسببة للأمراض من تاو في مرض الزهايمر ، وقد يكون لها أهداف مسببة للأمراض الأخرى. Metamizole ، أو dipyrone ، هو مثبط لانزيمات الأكسدة الحلقية 3 (Cox-3) ، لوحظ لتنشيط مستقبلات الأفيون والقنب ، ومع ذلك ، فإنه لا يعتبر مادة أفيونية أو مضادات الالتهاب غير الستيروئيدية. من الناحية السريرية ، يتم استخدامه كمسكن مع خصائص خافضة للحرارة ومضادة للتشنج ، ولكن فقط تأثيرات مضادة للالتهابات قليلة. يقلل من الحمى التي يسببها عديدات السكاريد الدهنية (عبر مسارات تعتمد على البروستاجلاندين وتعتمد على البروستاجلاندين) ، ويعطل التخليق الحيوي لفوسفات الإينوزيتول. أنيسوميسين ، المعروف أيضًا باسم فلاجيسيدين ، هو مشتق ثنائي الحلقات من التيروزين يتم إنتاجه بواسطة Streptomyces griseolus ويثبط نشاط الببتيدل ترانسفيراز للريبوزومات حقيقية النواة. يتداخل بشكل ثانوي مع تخليق الحمض النووي ، ويحفز موت الخلايا المبرمج في أنواع مختلفة من الخلايا ، ويستخدم أيضًا كعامل مضاد للبروتوزوان. سيكون من المثير للاهتمام معرفة ما إذا كان يؤدي بشكل مفضل إلى موت الخلايا المبرمج في الخلايا الشائخة ، مثل أزيثروميسين. ينشط كينازات البروتين المنشط بالتوتر والميتوجين (SAP و MAP kinases) بما في ذلك Jnk و p38 / Mapk. أزاسيتيدين هو نظير للسيتيدين ، والذي عند دمجه في الحمض النووي (وربما الحمض النووي الريبي) يربط بشكل لا رجعة فيه ويثبط نشاط ميثيل ترانسفيرازات الحمض النووي. نلاحظ أنه قد يمنع أهدافًا إضافية ، على سبيل المثال الإنزيمات أو عوامل النسخ التي تربط السيتيدين أو الديوكسيتيدين. يتم استخدام أزاسيتيدين ومشتقاته غير المؤكدة ، 5-aza-2′-deoxycytidine ، في علاج متلازمة خلل التنسج النقوي ، والعديد من السرطانات التي تم فيها إسكات الجينات المضادة للأورام. بالنظر إلى الآليات المتنوعة لهذه الأدوية ، فمن المرجح تمامًا أن تكمل بعضها البعض في "كوكتيل" متعدد الأدوية. علاوة على ذلك ، فإن كل دواء له آثار جانبية ضارة ، والتي يمكن تجنبها أو التقليل منها عند الجرعات المنخفضة المطلوبة بشكل واضح للحماية من الجيرو ، وخاصة في تركيبات الأدوية المركبة.

يبدو أن التحجيم الزمني الملحوظ لمنحنيات البقاء ومسارات الشيخوخة ، جنبًا إلى جنب مع النمط القوي لتغيرات التعبير الجيني المرتبطة بالشيخوخة ، كان عالميًا عبر ظروف بيولوجية متنوعة للغاية تم اختبارها في تجاربنا. من هذا ، نستنتج أن تأثيرات إطالة الحياة تتحقق من خلال تثبيت شبكة تنظيم الجينات وإبطاء معدل الشيخوخة ، بدلاً من التغيير النوعي للآلية الجزيئية للكائن الحي بأكمله. هذا يعني أنه يمكن تقليد مسار شيخوخة السلالات طويلة العمر بشكل علاجي ، وبالتالي سيؤدي في النهاية إلى زيادة العمر بشكل كبير دون آثار ضارة. تظهر فرضية "الشيخوخة في الأهمية" كإطار عمل نظري وعملي قوي لفهم مجموعة واسعة من الخصائص الديناميكية للشيخوخة وخصائص البقاء على قيد الحياة المفيدة للجهود المستقبلية لتحديد التدخلات المضادة للشيخوخة في ج. ايليجانس وأنواع أخرى.


النتائج

تستجيب فئات متعددة من جينات الحمض النووي الريبي للصدمة الحرارية في C. ايليجانس

تمت دراسة الاستجابة النسخية لـ PCGs لـ HS بشكل مكثف (1،2،35) ، ومع ذلك لم يتم فحص تأثير هذا الضغط على تعبير RNA غير المشفر (ncRNA) بشكل منهجي. استخدمنا هنا تسلسل الحمض النووي الريبي لمقارنة مستويات الأنواع المختلفة من الحمض النووي الريبي من المرحلة اليرقية الأخيرة (L4) C. ايليجانس يحتفظ في 20& # x000b0C (التحكم ، CTRL) أو التحول إلى 35& # x000b0C (HS) لـ 4 (RNA-seq) أو 6 h & # x000a0 (smRNA-seq). إلى جانب التغييرات المتوقعة التي يسببها HS في تعبير mRNA (الجدول التكميلي S1) ، كشف هذا التنميط أيضًا عن جينات RNA معينة تنتمي إلى miRNA و piRNA و lincRNA و ncRNA غير المصنف والجينات الزائفة والعائلات المتكررة التي تغيرت مرتين على الأقل استجابةً لـ الإجهاد الحراري (الشكل & # x200B (الشكل 1 أ 1 أ).

يغير النظام المنسق التعبير عن الحمض النووي الريبي المشفر وغير المشفر. (أ) تم استخدام RNA-seq الصغيرة و RNA-seq التي تقطعت بهم السبل لتحليل التغييرات في تعبير RNA في أنواع معينة انيقة تحول من 20 & # x000b0C (تحكم ، CTRL) إلى 35 & # x000b0C (HS) لمدة 4 (RNA-seq) أو 6 ساعات & # x000a0 (smRNA-seq). يشار إلى أعداد الجينات المعبر عنها تفاضليًا في كل فئة من فئات الحمض النووي الريبي. & # x02018ALL & # x02019 يشير إلى العدد الإجمالي للجينات المشروحة في كل فئة. (ب) الاستراتيجية المستخدمة لتصفية الحمض النووي الريبي الموجب الخاطئ المنتظم. راجع & # x02018Materials and Methods & # x02019 قسم لمزيد من التفاصيل ، تتوفر الرموز المستخدمة للتصفية على https://github.com/wschrein. (ج) DAVID تجميع التعليقات التوضيحية الوظيفية للجينات صعودًا وهبوطًا في التنظيم استجابةً للنظام المنسق (41). يتم عرض الأعضاء الممثلين لكل مجموعة بدرجة تخصيب & # x0003e 2. حجم النقطة يتوافق مع عدد الجينات في كل مجموعة. (د) TEA للجينات صعودًا وهبوطًا استجابةً لـ HS. تم إجراء TEA باستخدام أداة Wormbase TEA (45). الاختصارات: PVD & # x02014 الخلايا العصبية الحسية (مسبب للألم متعدد الوسائط لتحسس الميكانيكا والتحسس الحراري) ، Hyp7 & # x02014 syncytium of hyp7، Hyp6 & # x02014Cylindrical hypodermal syncytium in head، Psub1 & # xry02014Emb2013 المؤسس x02014 الخلية الجنينية ، الخلية الأولية لخط الجراثيم Z2 & # x02014 ، الخلية الأولية لخط الجراثيم Z3 & # x02014.

بينما أثارت ظروفنا تغييرات في تعبير mRNA لترميز البروتين مقارنة بالدراسات المنشورة سابقًا للاستجابة النسخية لـ HS في C. ايليجانس (36،37) ، لاحظنا بعض الخصائص في مجموعة الجينات المنتظمة. أشار الفحص البصري لقراءات التسلسل المعينة إلى متصفح UCSC Genome Browser إلى العديد من مكالمات الجينات الإيجابية الكاذبة الموجودة في قائمة PCGs التي تم تنظيمها بواسطة HS. على سبيل المثال، srt-42 تم إدراجه في الأصل باعتباره ثاني أكثر الجينات تنظيمًا في HS ولكن القراءات المرتبطة بهذا الجين لا تتوافق مع نمط التضفير المتوقع وتضمنت تسلسلات تمتد إلى أعلى الجين HSP المجاور ، هسب -16.41 (الشكل & # x200B (الشكل 1 ب). 1 ب). وهكذا ، تغطي القراءات srt-42 من المحتمل أن تنبع من النصوص التي فشلت في إنهاؤها بشكل صحيح من المستحثة بدرجة عالية من النظام المنسق هسب -16.41 الجين. تم اكتشاف هذه الأنواع من النصوص الشاذة ، والمعروفة باسم DoGs for Downstream of Gene المحتوي على النصوص ، سابقًا في ظروف إجهاد مختلفة (38 ، 39). في حين أن الدور الوظيفي لـ DoGs لم يتم إثباته بعد ، فإن الإنهاء النسخي غير المكتمل لجين المنبع المستحث بشدة يمكن أن يوفر قراءات RNA-seq التي تعين خطأً جينًا متسلسلًا على نفس الخيط كما تم تنظيمه أيضًا (38 ، 39). نظرًا لأنه من غير المرجح أن تحافظ هذه الإيجابيات الخاطئة على إمكانات الترميز ، فقد قمنا بترشيحها من قائمتنا الأصلية لـ PCGs المنتظمة من HS عن طريق إزالة 49 جينًا بقراءات في المنبع Intergenic Junction التي كانت أعلى مرتين في HS والتي كانت بها نسبة intronic إلى exonic يقرأ 0.4 أو أكبر (الشكل & # x200B (الشكل 1 ب 1 ب والجدول التكميلي S1).

كان هناك مصدر آخر للـ PCGs المُنظَّمة عن طريق الخطأ الإقامة الداخلية لـ tRNAs و snoRNAs التي يبدو أنها فشلت بشكل صحيح في إنهاء النظام المنسق (الشكل & # x200 ب (الشكل 1 ب). 1 ب). هذه الإصدارات الأطول من الحمض الريبي النووي النقال و snoRNAs مكنت من اكتشافها في تسلسل الحمض النووي الريبي القياسي ، في حين لم يتم التقاط الأشكال الأقصر عادة في هذا الإجراء. من خلال تصفية الجينات مع نسبة intron إلى exon (IR) & # x0003e1 بسبب تراكم ncRNA intronic في HS ، أزلنا 14 PCGs أخرى من القائمة المنتظمة (الشكل & # x200B (الشكل 1B 1B والجدول التكميلي S1). ، تم أيضًا تصفية PCGs التي تداخلت مع عنصر متكرر كان مسؤولاً على الأرجح عن زيادة قراءات التسلسل في النظام المنسق (الشكل & # x200B (الشكل 1B 1B والجدول التكميلي S1). تم تفصيل خطوات المعلومات الحيوية المستخدمة للتصفية في & # x02018Materials و قسم الأساليب & # x02019 ومتاح عبر الإنترنت (https://github.com/wschrein).

مع مجموعة ثقة أعلى من PCGs التي ينظمها HS بشكل تفاضلي ، أكدنا أن ظروفنا أثارت تغييرات في تعبير mRNA مماثلة للدراسات المنشورة سابقًا للاستجابة النسخية لـ HS في C. ايليجانس (36،37،40). التغييرات الواسعة في تعبير PCG الناجم عن HS المحاذاة مع المسارات الجزيئية المتوقع أن يتم تنظيمها بواسطة هذا الإجهاد. أشارت تحليلات DAVID Gene Ontology (GO) للجينات التي تم تنظيمها بواسطة HS إلى إثراء قوي لتلك المرتبطة بصيانة البشرة و HSPs والعوامل الأنزيمية (الشكل & # x200B (الشكل 1C 1C والجدول التكميلي S1) (41،42). الجينات في هذه الفئات لها أدوار راسخة في الحماية من الإجهاد وقد تم العثور عليها سابقًا على أنها منظمة في النظام المنسق (الشكل & # x200B (الشكل 1C 1C والجدول التكميلي S1) (26،36،37). المخصب في الجينات التي تم تنظيمها بواسطة HS (الشكل & # x200B (الشكل 1C 1C والجدول التكميلي S1). يتوافق التعبير المنخفض عن الجينات المرتبطة بتكرار الحمض النووي مع توقف النمو وانقسام الخلايا الناتج عن الإجهاد الحراري (1).

أشارت مجموعات الجينات الأعلى والمنخفضة أيضًا إلى استجابات الأنسجة المتميزة لـ HS ، بما يتوافق مع التنظيم الخلوي غير المستقل لـ HSR في C. ايليجانس (43،44). باستخدام تحليل تخصيب الأنسجة (TEA) ، لاحظنا أن الجينات المنتظمة كانت مرتبطة بالخلايا العصبية والظهارية (الشكل & # x200 ب (الشكل 1 د) 1 د) (45). على وجه الخصوص ، قد يعكس التخصيب في الخلايا العصبية الحسية الحرارية دور هذه الخلايا العصبية في تنشيط HSR بطريقة غير مستقلة للخلية (الشكل & # x200B (الشكل 1 د) 1 د) (43). ارتبطت PCGs الخاضعة للتنظيم بالأنسجة التناسلية ، والتي من المحتمل أن تتوافق مع تأخير التطور في ظروف الإجهاد.

بعد التأكد من أن شروط HS المستخدمة في هذه الدراسات أثارت التغييرات المتوقعة في تعبير PCG ، قمنا بعد ذلك بفحص تأثير HS على الفئات الرئيسية من جينات ncRNA. إن الاكتشاف الذي يشير إلى أن أعضاء معينين من كل فئة من فئات ncRNA قد تم رفعهم أو خفضهم استجابةً لـ HS يشير إلى أن HSR يتحكم في نسخ أو استقرار ncRNAs معينة.

تستجيب miRNAs محددة للإجهاد الحراري

من بين الـ 205 miRNAs التي اكتشفناها عن طريق تسلسل الحمض النووي الريبي الصغير ، تم تنظيم 8 منها على الأقل مرتين في C. ايليجانس تخضع لـ HS مقارنة بشروط CTRL (الشكل & # x200B (الشكل 2A 2A و & # x000a0 B الجدول التكميلي S2). تمشيا مع دراسة سابقة ، كانت miR-239b واحدة من أكثر miRNAs تنظيمًا بعد النظام المنسق (الشكل & # x200B (الشكل 2A 2A و & # x000a0 B) (11). لوحظ أكبر تغيير في الطية لـ miR-4936 ، والذي زاد بأكثر من 200 ضعف في HS (الشكل & # x200B (الشكل 2A 2A & # x02013 C). كان هذا ميرنا غير قابل للكشف تقريبًا في درجة حرارة CTRL ولكنها تراكمت إلى مستويات عالية في HS (الشكل & # x200B (الشكل 2C). 2C). علاوة على ذلك ، يختلف الشكل الإسوي السائد الذي اكتشفناه لـ miR-4936 في HS (5 & # x02032 AUUGCUUUGUGGCUUUGCUGGUAAC 3 & # x02032) عن المرجع التسلسل المدرج في miRBase (5 & # x02032 UGCUUUGUGGCUUUGCUGGUA 3 & # x02032) (46). من المتوقع أن يؤثر هذا الاختلاف في التسلسل 5 & # x02032-end على التعرف على الهدف ، والذي يتم دفعه إلى حد كبير من خلال الاقتران الأولي للنيوكليوتيدات miRNA 2 & # x0201037 & # x000 (تسلسل البذور) (12) حيث أن تدهور الرنا المرسال يكون غالبًا النتيجة من تنظيم miRNA ، بحثنا في مجموعة PCGs الخاضعة للتنظيم عن المواقع التكميلية في 3 & # x02032UTRs لتسلسل البذور (nt 2 & # x020137) من miRNAs المنتظم (الجدول التكميلي S2). تعكس الأهداف المتوقعة لهذه miRNAs مصطلحات GO المرتبطة بالجينات التي تنخفض مستوياتها في الإجهاد الحراري ، مثل الربط 3 & # x02032UTR (الشكل & # x200B (الشكل 2 ب). 2 ب). علاوة على ذلك ، فإن بعض هذه الجينات الخاضعة للتنظيم هي أهداف محتملة للعديد من miRNAs المنتظم ، مما يشير إلى التعاون (الشكل & # x200B (الشكل 2D). 2D). تتوافق هذه الملاحظات مع دور miRNAs المنتظم في المساهمة في قمع بعض PCGs في HS.

يتم تنظيم التعبير عن miRNAs بواسطة HS. (أ) التعبير عن miRNAs في CTRL مقابل HS المكتشف بواسطة تسلسل الحمض النووي الريبي الصغير. تمثل النتائج متوسط ​​مكررين بيولوجيين مستقلين ويتم الإشارة إلى miRNAs بشكل متكرر لأعلى (أحمر) وأسفل (أزرق) ينظمهما & # x02265 2 أضعاف. (ب) قائمة mRNAs دليل حبلا ضمن أعلى 100 miRNAs المعبر عنها والتي يتم استنساخها لأعلى أو لأسفل استجابةً لـ HS. يُظهر العمود الأخير أكثر العمليات البيولوجية إثراءً GO مصطلحًا للأهداف المحتملة لكل ميرنا (انظر الجدول التكميلي S2).تم إجراء تحليل GO باستخدام DAVID (41). (ج) تحليل تعبير miR-4936 في CTRL مقابل شروط HS عن طريق النشاف الشمالي. يعمل 5S rRNA كعنصر تحكم في التحميل. (د و & # x000a0ه) تحليل شبكة الرنا المرسال المنظم تفاضليًا التي تستهدفها ثلاثة جزيئات من الرنا المرسال على الأقل أعلى أو منظمة. تم استخدام Cytoscape لرسم الشبكات (https://cytoscape.org) (25).

في حين تم العثور على 52 miRNAs خاضعة للتنظيم في HS ، كان معظمها عبارة عن خيوط ركاب منخفضة المعبر عنها في الأصل miRNA مزدوج الاتجاه (الجدول التكميلي S2). تم تخفيض مستويات 15 دليل فقط من miRNAs أكثر من 2 أضعاف بعد HS (الشكل & # x200B (الشكل 2A 2A و & # x000a0 B الجدول التكميلي S2). تم الكشف عن التوقعات المستهدفة لـ 11 miRNAs التي تم تنظيمها والتي كانت من بين 100 miRNAs الأكثر وفرة أعلى مصطلحات GO المخصبة المرتبطة بالانسلاخ والحركة (الشكل & # x200B (الشكل 2 ب). 2 ب). واحد وعشرون من هذه الجينات المستهدفة لديها القدرة على التعرف عليها من قبل ثلاثة أو أكثر من miRNAs التي يتم تنظيمها بواسطة HS ، مما يزيد من احتمال زيادة التعبير عن هذه الجينات يتم تسهيل الجينات عن طريق قمع ميرنا المخفف (الشكل & # x200B (الشكل 2E). 2E). ومن المثير للاهتمام ، أن تجانس بروتين الفترة لين 42 يتم تنظيمه بشدة في HS وهدف متوقع لأربعة miRNAs مختلفة مع انخفاض التعبير في HS (الشكل & # x200B (الشكل 2E 2E والجدول التكميلي S2). ينظم هذا الجين دورات طرح الريش ويعمل كمثبط نسخي عام لجينات ميرنا (47 & # x0201350) وهكذا ، زاد التعبير عن لين 42 في HS يمكن أن يساهم في قمع النسخ للعديد من جينات ميرنا. سيكون هذا متسقًا مع انخفاض مستويات جزيئات miRNAs للركاب ، والتي تكون أكثر حساسية للتغيرات في النسخ من سلاسل الدليل المستقرة (51).

بالإضافة إلى miRNAs ، حددنا أيضًا 11979 piRNAs مختلفة في مجموعات بيانات تسلسل الحمض النووي الريبي الصغيرة الخاصة بنا. من بين هؤلاء ، زاد 15 وانخفض 63 بنسبة 2 ضعف على الأقل في HS مقارنة بظروف التحكم (الجدول التكميلي S2). باستخدام أداة التنبؤ بالهدف piRTarBase piRNA (52) ، وجدنا أن عددًا قليلاً جدًا من PCGs المنظمة تفاضليًا لديها القدرة على التنظيم بواسطة piRNAs (الجدول التكميلي S2). وبالتالي ، من غير المرجح أن تساهم الاختلافات المحدودة في مستويات piRNA كثيرًا في التغييرات الواسعة في تعبير PCG الذي لوحظ في HS.

تتراكم رنا محددة طويلة غير مشفرة في النظام المنسق

على عكس miRNAs ، حيث كانت أعداد مماثلة من الأنواع الأكثر وفرة أعلى وأقل من حيث التنظيم في HS ، زادت ncRNAs الأطول في المقام الأول في المستويات استجابةً للإجهاد الحراري. تم شرح ما يقرب من 150 جينًا على أنها رنا طويلة غير مشفرة بين الجينات (lincRNAs) في C. ايليجانس (53). في حين أن الأدوار الوظيفية لـ lincRNAs غير معروفة إلى حد كبير ، فإن جينات lincRNA تي تي إس -1 و رنكس -1 ارتبطت بطول العمر ومسارات الإجهاد ، على التوالي (14 ، 15). من خلال تصنيف الحمض النووي الريبي الخاص بنا ، وجدنا أن تسعة lincRNAs وفيرة نسبيًا زادت وأن lincRNA واحد فقط انخفض بأكثر من ضعفين في HS مقارنة بظروف CTRL (الشكل & # x200B (الشكل 3A 3A والجدول التكميلي S3). تي تي إس -1 كان من بين lincRNAs عالي التنظيم ، مما يشير إلى أن دوره في طول العمر قد يكون مرتبطًا بمسار الإجهاد (14). واحد على الأقل من lincRNAs ، لينك -7، يبدو أنه يتم تنظيمه بسرعة بواسطة النظام المنسق (الشكل & # x200B (الشكل 3 ب). 3 ب). ومن المثير للاهتمام ، أن هذا lincRNA يحتوي على خمسة مواقع ذات تكامل مع منطقة البذور الخاصة بـ miRNA سريع التنظيم ، miR-239b-5p. بالإضافة إلى، لينك 82 يحتوي على ثماني مباريات أولية لـ miR-239a-3p و miR-230 & # x020133p ، وكلاهما يتراكم في HS (الشكل & # x200B (الشكل 2A 2A و & # x000a0 B الجدول التكميلي S2). قد تنظم تفاعلات lincRNA و # x02013miRNA المحتملة الاستقرار أو توافر أو وظيفة هذه RNAs المحددة خلال HS.

يغير النظام المنسق التعبير عن الحمض النووي الريبي الطويل غير المشفر. (أ) التعبير عن RNAs طويلة غير مشفرة بين الجينات (lincRNAs) في CTRL مقابل HS المكتشفة عن طريق التسلسل المزدوج الذي تقطعت به السبل. يشار بشكل ملحوظ إلى أعلى- (أحمر) وخافض التنظيم (أزرق) lincRNAs (& # x022652 تغيير أضعاف مع baseMean & # x02265 50 و padj & # x0003c 0.01 & # x000a0 من ثلاث مكررات مستقلة). (ب) تحليل qRT-PCR لـ hsp-70 و لينك -7 مستويات الحمض النووي الريبي بعد 15 و 30 و 180 دقيقة من HS مقابل شروط CTRL. يتم عرض التغييرات يعني أضعاف و SEM من ثلاث مكررات مستقلة. *ص & # x0003c0.05 ، **ص& # x000a0 & # x0003c0.01 ، ***ص& # x000a0 & # x0003c0.001 (ر-الاختبار ، على الوجهين). (ج) التعبير عن ncRNAs في CTRL مقابل HS المكتشفة بواسطة تسلسل الطرف المزدوج الذين تقطعت بهم السبل. يشار إلى ncRNAs بشكل ملحوظ (أحمر) وخفض التنظيم (أزرق) (& # x022652 تغيير أضعاف مع baseMean & # x02265 50 و padj & # x0003c 0.01 & # x000a0 من ثلاثة مكررات مستقلة). (د) التعبير عن الجينات الكاذبة RNAs في CTRL مقابل HS المكتشفة بواسطة تسلسل الطرف المزدوج الذين تقطعت بهم السبل. يشار إلى RNAs للجينات الزائفة (باللون الأحمر) والمنظم (الأزرق) بشكل ملحوظ (& # x022652 تغيير أضعاف مع baseMean & # x02265 50 و padj & # x0003c 0.05 من ثلاث مكررات مستقلة).

بالإضافة إلى lincRNAs ، تم شرح أكثر من 7000 & # x000a0ncRNAs التي لا تنتمي إلى فئة مميزة سابقًا من الحمض النووي الريبي غير المشفر في ج. ايليجانس الجينوم (22). من بين هؤلاء ، زاد 71 وانخفض 1 ضعفًا على الأقل استجابةً لـ HS (الشكل & # x200B (الشكل 3C 3C والجدول التكميلي S3). اكتشفنا أيضًا تعبيرًا عن 1455 جينًا خادعًا ووجدنا أن 94 كانت أعلى و 23 تم تنظيمها في HS (الشكل & # x200B (الشكل ثلاثي الأبعاد والجدول التكميلي S4) يشير العدد الكبير نسبيًا من الحمض النووي الريبي للجينات الكاذبة التي تراكمت إلى مستويات عالية في النظام المنسق إلى أن درجات الحرارة المرتفعة تعطل مسارات المراقبة التي عادةً ما تكبح التعبير عن الجينات الزائفة.

تتراكم الحمض النووي الريبي المشتق من العناصر المتكررة في الصدمة الحرارية

من خلال إعادة تعيين بيانات تسلسل الحمض النووي الريبي لدينا إلى قائمة توافق الآراء C. ايليجانس العناصر المتكررة التي تم الحصول عليها من repbase (24) ، حددنا قراءات لـ 165 نوعًا من العناصر المتكررة في C. ايليجانس الجينوم. تم العثور على أعداد مماثلة من التكرارات (& # x0223c20) لزيادة أو نقصان في HS ومع ذلك ، تم تضخيم حجم التغيير بشكل كبير في المجموعة المنتظمة (الشكل & # x200B (الشكل 4A 4A و & # x000a0 B الجدول التكميلي S4). من المحتمل أن يرجع تنظيم CERP16 ، جزئيًا على الأقل ، إلى موضع هذا العنصر في اتجاه مجرى النهر مباشرةً hsp-16.2 و هسب -16.41. من المحتمل أن تكون DoGs التي تنتجها كل من جينات HSP شديدة الاستحثاث مصدرًا سائدًا للقراءات لعنصر التكرار هذا.

Upregulation من RNAs متعددة العناصر المتكررة أثناء HS. (أ) التعبير عن RNAs للعنصر المتكرر في CTRL مقابل HS المكتشفة عن طريق التسلسل المزدوج الذي تقطعت به السبل وتعيينه إلى قاعدة بيانات للعناصر المتكررة (24). يشار إلى RNAs بشكل ملحوظ (أحمر) وخافض التنظيم (أزرق) (& # x022652 تغيير أضعاف مع baseMean & # x02265 100 و padj & # x0003c 0.05 من ثلاث مكررات مستقلة). (ب) قائمة RNAs العنصر المتكرر المنتظم 10 أضعاف على الأقل في HS. (ج) الكشف عن RT-PCR شبه الكمي للـ RNAs المشار إليه في CTRL وبعد 15 أو 30 دقيقة من HS. (د) التحليل الكمي RT-PCR hsp-16.2& # x000a0 و Helitron1_CE تعبير RNA خلال فترة زمنية من HS. يتم عرض التغييرات يعني أضعاف و SEM من ثلاث مكررات مستقلة. *ص & # x0003c & # x000a00.05 ، **ص & # x0003c 0.01 ، ***ص & # x0003c 0.001 (ر-الاختبار ، على الوجهين).

في المقابل ، يبدو أن بعض أعضاء الدائرة المتدحرجة ينقل الحمض النووي المعروفة باسم Helitrons مستحثة بقوة بشكل مستقل عن PCGs المجاورة (الشكل & # x200B (الشكل 4B 4B وانظر أدناه). Helitron1_CE تتراكم بسرعة إلى مستويات عالية على النظام المنسق (الشكل & # x200B (الشكل 4C 4C و & # x000a0 D). C. ايليجانس أكدت بيانات HS RNA-seq أيضًا الحث السريع لعنصر Helitron المتكرر RNA (36).

يتحكم HSF-1 في التعبير عن ncRNAs محددة

في حين أن مسارات إسكات الحمض النووي الريبي الصغيرة المعيبة قد تفسر بعض زيادة تعبير RNA المتكرر خلال HS (54) ، فإن التراكم السريع والهائل لـ Helitron RNAs يشير إلى أن الحث النسخي متورط أيضًا. لاحظنا ذلك Helitron1_CE عرض HSR مشابهًا للجينات الكنسية التي يسببها HS ، مثل هسب -16.42، مع مستويات RNA بالكاد يمكن اكتشافها والتي ترتفع بسرعة على HS (الشكل & # x200B (الشكل 4C). 4C). وهكذا ، توقعنا أنه ، مثل جينات HSP ، يمكن أن تكون Helitrons أهدافًا نسخية مباشرة لـ HSF-1. للتحقيق في هذا الاحتمال ، قمنا بإعادة التخطيط C. ايليجانس بيانات HSF-1 و Pol II ChIP-seq من Li وزملائه لتشمل التكرار والمواقع الجينية الأخرى لـ ncRNA (26). على غرار منطقة المروج لـ hsp-16.2 و هسب -16.41، وجدنا دليلًا على ارتباط HSF-1 و Pol II بـ Helitron1_CE، وأفراد عائلة Helitron الآخرين ، استجابةً لـ HS (الشكل & # x200B (الشكل 5A 5A الجداول التكميلية S1 و 4). علاوة على ذلك ، تتداخل قمم HSF-1 مع نسخ متعددة من عناصر استجابة الصدمات الحرارية (HSEs) الموجودة في جينات Helitron (الشكل & # x200B (الشكل 5A 5A والجدول التكميلي S4).

يتم تنظيم NcRNAs بواسطة HSF-1 خلال HS. (أ) لقطات شاشة مستعرض الجينوم لـ HSF-1 (أصفر) و Pol II (أزرق) بيانات ChIP-seq من التحكم (CTRL) وظروف HS (بيانات من (26)) للجينات التمثيلية (hsp-16.2 و هسب -16.41، مرنا Helitron1_CE، كرر RNA ، مير -239 أ و مير -239 ب، ميرنا dct-10، الجين الكاذب). تم تحديد HSEs الفردية باستخدام FIMO (ص & # x0003c 1e-04) يشار إليها (30). (ب) تغيير أضعاف في مستويات الحمض النووي الريبي hsp16.2 ، Helitron1_CE ، miR-239b& # x000a0 و dct-10 بعد 30 دقيقة من HS في الحيوانات المعرضة لناقل فارغ أو HSF-1 RNAi و WT مقابل سلالة مفرطة في التعبير عن HSF-1 (HSF-1 OEX) التي تحددها تحليلات qRT-PCR. يتم رسم متوسط ​​أضعاف التغييرات و SEM من ثلاث مكررات مستقلة. *ص & # x0003c 0.05 ، **ص & # x0003c 0.01 (ر-الاختبار ، على الوجهين).

يشير تفاعل HSF-1 مع مناطق Helitron إلى أن HSF-1 يمكن أن يساهم بشكل مباشر في تنظيم Helitron RNA في HS. باستخدام الشروط التي تنقص (hsf-1 (رني)) أو زيادة (الإفراط في التعبير الجيني HSF-1(OEX)) مستويات HSF-1 ، لاحظنا التأثيرات المعاكسة المتوقعة على التعبير عن hsp-16.2، هدف ثابت HSF-1 ، استجابةً للنظام المنسق (الشكل & # x200 ب (الشكل 5 ب). 5 ب). وبالمثل ، فإن تحريض Helitron1_CE التعبير عن طريق HS انخفض بشكل ملحوظ في hsf-1 (رني) وتحسينها hsf-1 (OEX) الشروط (الشكل & # x200B (الشكل 5 ب). 5 ب). بالنظر إلى وفرة HSEs الموجودة في بعض Helitrons وحساسية Helitron1_CE إلى مستويات HSF-1 ، يمكن تنظيم تنظيم هذه الجينات المكررة أثناء HS إلى حد كبير على مستوى النسخ.

لاستكشاف إمكانية أن تكون ncRNAs الأخرى جزءًا من برنامج النسخ HSF-1 المباشر في HS ، قمنا بتحليل مناطق المروج المفترضة الخاصة بهم (1 كيلو بايت من موقع البدء المشروح) لقمم HSE و HSF-1 في بيانات ChIP-seq من لي وآخرون & # x000a0al.، & # x000a0 (26). من miRNAs المنتظم ، فقط ميل -239 المكان المناسب لهذه المعايير (الجدول التكميلي S2). تقع هذه المنطقة بين مير -239 ب و مير -239 أ، والتي تم نسخها في اتجاهين متعاكسين. تعد HSE الفردية والمستوى الأكبر من قراءات HSF-1 ChIP-seq أقرب إلى بداية مير -239 ب، ولكن لوحظ الإشغال المعزز لـ Pol II في HS على كل من miRNAs ، بما يتوافق مع تنظيمهما المتبادل في HS (الأرقام & # x200B (الأشكال 2A 2A و & # x000a0 B و 5A الجدول التكميلي S2) علاوة على ذلك ، وجدنا أن تقليل أو زيادة HSF- أسفرت المستويات 1 عن مستويات miR-239b أقل أو أعلى ، على التوالي ، استجابةً لـ HS (الشكل & # x200B (الشكل 5B). 5B). بالنسبة لجينات ncRNA الأطول المنتظمة ، تم اكتشاف HSEs ودليل ارتباط HSF-1 في HS في مناطق المروج لـ 0 lincRNAs و 11 ncRNAs غير مصنفة و 5 جينات خادعة (الجدول التكميلي S4). تمشيا مع جين الورم الذي يتحكم فيه DAF-16 / FOXO ، dct-10نظرًا لكونها واحدة من أكثر الجينات الخادعة المستحثة بقوة ، وجدنا أن مروجها يحتوي على العديد من HSEs وأن تعبيرها في HS ينظمه HSF-1 (الشكل & # x200B (الشكل 5 & # x000a0 و & # x000a0 الجدول التكميلي S4) إجمالاً ، تشير هذه النتائج إلى دور موسع لـ HSF-1 في توجيه نسخ جينات ncRNA المحددة كجزء من HSR في C. ايليجانس.


مناقشة

يعد التعليق التوضيحي للجينوم عالي الجودة أمرًا بالغ الأهمية لتعيين تقويم العظام الدقيق ، واكتشاف الكتلة التركيبية ، والتحليل الوراثي للتطور الجزيئي للجينات ومروجيها. من المهم أيضًا التحقيق في التطور الجزيئي للجينات بما في ذلك اكتساب وفقدان الإنترون (Roy and Gilbert 2005) ، وتوسع عائلة الجينات وتقلصها (Prachumwat and Li 2008) ، وتضاعف الجينوم القطاعي (Jiang et al. 2007). وبالتالي التحليل المقارن بين نموذج الكائن C. ايليجانس وأفضل الأنواع الشقيقة المدروسة C. briggsae تم إعاقته إلى حد كبير بسبب التعليق التوضيحي المحدود لـ C. briggsae الجينوم. كما هو مذكور في أحدث ملاحظة إصدار WormBase (WS228) ، فقط 0.2٪ (أو 52) من C. briggsae تم تأكيد النماذج الجينية بالكامل و 95.9٪ تفتقر إلى أي تأكيد. لا يوجد سوى عدد قليل جدًا من ESTs و mRNAs المحددة تجريبياً لـ C. briggsae الجينوم في قواعد البيانات العامة بما في ذلك قاعدة بيانات dbEST في GenBank. 15 فقط C. briggsae يتم دعم نماذج الجينات بشكل كامل من خلال هذه الأعداد المحدودة من ESTs و mRNAs. في هذا المشروع ، حاولنا تحسين والتحقق من صحة C. briggsae نماذج الجينات. في المنقحة C. briggsae مجموعة الجينات ، 14812 (68.3٪) من الجينات تم التحقق منها جزئيًا على الأقل ، مع 7347 (33.9٪ من جميع الجينات ذات الإنترونات) C. briggsae نماذج الجينات بعد التحقق من صحة جميع الإنترونات الخاصة بهم. على مستوى النسخة (mRNA / cDNA) ، في 47.0٪ (10.235) من جميع الجينات ، تم التحقق من صحة 95٪ على الأقل من أطوال النسخ بالكامل 62727 (60.9٪) من الإنترونات من C. briggsae يتم التحقق من صحة مجموعة الجينات. كل هذه النماذج الجينية الـ 15 التي تدعمها ESTs في GenBank مدعومة بالكامل ببيانات RNA-seq ، مما يشير إلى تغطية جيدة لـ C. briggsae transcriptome بواسطة بيانات RNA-seq الخاصة بنا. بالإضافة إلى ذلك ، قمنا بتوضيح 5 & # x02032 تسلسل UTR لـ 14089 C. briggsae الجينات ، و 3 & # x02032 تسلسل UTR لـ 14089 C. briggsae الجينات. علاوة على ذلك ، سمح لنا تحليل RNA-seq الخاص بنا أيضًا بالتعرف بنجاح عبر-مواقع الربط عام 8555 C. briggsae تم تحديد نماذج الجينات 11617 SLs ، بما في ذلك 8856 SL1s (في 7871 جينًا) و 2761 SL2s (في 2287 جينًا). على أساس عبر-معلومات الربط ، قمنا بتوضيح 1034 عاملًا في ملف C. briggsae الجينوم. هذا التقدم الكبير في C. briggsae إن شرح الجينوم والتحقق من الصحة والتأكيد سيسهل بلا شك تحليل الجينوم المقارن الأكثر دقة بين هذين النموذجين المهمين للديدان الخيطية: C. ايليجانس و C. briggsae.

التحسن في C. briggsae أصبح شرح الجينوم ممكنًا جزئيًا من خلال التقدم الأخير والجوهري في C. ايليجانس شرح الجينوم. يُعزى هذا التقدم إلى مجموعة كبيرة من مشاريع الشرح الجيني عالية الإنتاجية بالإضافة إلى شرح الجينات من المشاريع الصغيرة في C. ايليجانس مجتمع البحث. لقد قمنا بتطوير مجموعة جديدة من الخوارزميات genBlastA (She et al. 2009) و genBlastG (She et al. 2011) ، للاستفادة من التحسينات المحسّنة. C. ايليجانس شرح الجينوم. لقد سمح لنا هذا بتحسين C. briggsae شرح الجينوم من خلال شرح الجينوم القائم على التماثل. على وجه الخصوص ، يتنبأ genBlastA بالمناطق الجينومية التي تحتوي على جين متماثل مرشح ، بينما يحدد genBlastG نموذج الجين المتماثل بناءً على التشابه بين جين الاستعلام والجين المستهدف. نتج عن هذا الجهد مراجعة 6715 C. briggsae النماذج الجينية وإضافة 1091 نموذجًا جينيًا جديدًا تم إغفالها تمامًا في التعليقات التوضيحية السابقة. التحقق من صحة وتحسين C. briggsae أصبح شرح الجينوم ممكنًا من خلال استغلال بيانات RNA-seq (Hillier et al. 2009 Wang et al.2009). تم إنشاء هذه البيانات من جودة عالية C. briggsae النسخ والتسلسل باستخدام تقنية تسلسل DNA Illumina. مكنتنا قوة RNA-seq من التحقق من صحة النماذج الجينية ، ومراجعة نماذج الجينات المعيبة ، وكذلك اكتشاف UTRs و عبر-إشارات الربط ، والتي بدورها سمحت لنا باكتشاف العوامل في C. briggsae.

أظهرنا أن المراجعة C. briggsae تحسين شرح الجينوم تعيين تقويم العظام بين C. ايليجانس و C. briggsae وتحديد الكتل المخلقة بين هذين النوعين. لاحظ أن نتائج الكتلة التركيبية التي تم الإبلاغ عنها هنا تختلف بشكل ملحوظ عن تقريرنا السابق المستند إلى WormBase WS180 (Vergara and Chen 2010). على سبيل المثال ، أكبر كتلة تركيبية تم الإبلاغ عنها باستخدام التعليق التوضيحي WS180 هي 42 جينًا بعد تحسين نموذج الجين (Vergara and Chen 2010) ، مقارنة بـ 21 جينًا (أو 25 جينًا بعد التحسين) في هذه الدراسة. يرجع الاختلاف إلى دمج التعليقات التوضيحية nGASP (Coghlan et al. 2008) في إصدارات WormBase الأخيرة ، مما يشير إلى أن العديد من nGASP C. briggsae من المحتمل أن تكون النماذج الجينية إيجابيات خاطئة تؤدي إلى كسر الكتل التركيبية بشكل غير صحيح. على الأرجح سيتم التخلص من هذه التعليقات التوضيحية الخاطئة من خلال تحسين نموذج الجينات القائم على الأدلة.

مع المشغلات المستندة إلى الأدلة في نسخة C. briggsae، يمكننا للمرة الأولى مقارنة حفظ وتباعد العوامل في C. ايليجانس و C. briggsae. في المقابل ، أجريت جميع تحليلات الحفظ لتطور الأوبرا في الدراسات السابقة بين المنسق C. ايليجانس operons والأوبرونات المقدرة في C. briggsae (Stein et al. 2003 Qian and Zhang 2008). مقارنة العوامل الموضحة في C. ايليجانس (تم الحصول عليها من WormBase) مع C. briggsae الأوبونات المنسقة في هذا المشروع من خلال تحليل RNA-seq ، أكدنا أن غالبية (51.4 ٪) من الأوبرا يتم حفظها بين هذين النوعين. ومع ذلك ، وجدنا أن الحفاظ على الأوبرا ليس مرتفعًا كما هو مقدر سابقًا (أي 93٪ & # x0201396٪ من الحفظ) لأننا وجدنا ما لا يقل عن 153 عاملًا (14.8٪) بالكامل C. briggsae محدد. يتم حفظ الأوبرا 349 المتبقية (33.8٪) بشكل أساسي بين C. ايليجانس و C. briggsae، لكن تكويناتها ليست متطابقة ولديها مستوى من الاختلاف.

نتوقع أن C. briggsae سيتم تحسين شرح الجينوم بشكل أكبر من خلال التسلسل الأعمق للنصوص المأخوذة من أنواع الخلايا المختلفة في مراحل النمو المختلفة.على وجه الخصوص ، الأشكال الإسوية البديلة لـ C. briggsae سيتم تعريف الجينات. في هذه الدراسة ، وجدنا مستوى محدودًا جدًا من الحفاظ على نماذج الجينات الموصولة بدلاً من ذلك. للجينات التي يتم تقطيعها بدلاً من ذلك C. ايليجانس، أخصائيو تقويم العظام في C. briggsae ليست بالضرورة مقسمة بشكل بديل ، والعكس صحيح. هذه النتيجة مثيرة للاهتمام والاستخدام المختلف للأشكال الإسوية البديلة للربط قد يكون مهمًا لتحديد خصوصية الأنواع. ومع ذلك ، قد تكون الاختلافات أيضًا بسبب نقص عمق تسلسل النسخ لكليهما C. ايليجانس و C. briggsae. سيكون التسلسل الأعمق قادرًا على المساعدة في اختبار هذه الفرضية. قد يجد تسلسل النسخ الأعمق أيضًا دليلًا يدعم أو يدحض نماذج الجينات 3072 التي ليس لها دعم حاليًا. علاوة على ذلك ، أعمق تسلسل C. briggsae ستمكننا الترانسكريبتومات أيضًا من بناء نماذج جينية كاملة الطول تعتمد على الجينات التي تم الكشف عنها بواسطة تحليل RNA-seq.

نتيجة غير متوقعة لهذا المشروع هي ملاحظة أن التيار C. briggsae يحتوي تجميع الجينوم على أكثر من 10 آلاف حالة من الأخطاء الجينية. على الرغم من أن سبب حدوث هذه الأخطاء لا يزال غير معروف ، فقد حددنا إحداثياتها وطبيعتها. يمكن تصحيح هذه الأخطاء بسهولة في ملف C. briggsae الجينوم (البيانات التكميلية 14 & # x0201316) ، والتي ستسمح بإصلاح مئات النماذج الجينية التي تم شرحها بشكل غير صحيح للتحايل على تأثير الأخطاء الجينية.


خلفية

يمكن أن يعتمد مصير الكائن الحي على قدرته على الإحساس بدقة والاستجابة للإجهاد. الإجهاد المنتشر في كل مكان والذي غالبًا ما يعطل التوازن هو تقلبات درجة الحرارة [1]. وبالتالي ، فإن الأنظمة البيولوجية لديها مجموعة متنوعة من الآليات لإعادة الاستقرار عند مواجهة درجات حرارة مرتفعة. يمكن أن تكون هذه التكيفات مع درجة الحرارة تطورية وعضوية. التكيفات التطورية مدفوعة باختيار التغيرات الجينية الوراثية. الاستجابات العضوية مدفوعة بآليات خلوية وجزيئية.

على المستوى العضوي ، تُظهر الحيوانات تغيرات في السلوك وردود الفعل اللاإرادية (مثل التعرق) ووظيفة القلب والأوعية الدموية وإشارات الغدد الصم العصبية عند تعرضها لدرجات حرارة مرتفعة [2]. بالنسبة للماشية ، تعتبر درجة الحرارة من أكبر عوامل الإجهاد في الإنتاج الحيواني ، وعادة ما تكون آليات استجابة الكائنات الحية ضارة بالأداء بسبب ارتفاع تكاليف التمثيل الغذائي [3 ، 4]. يقلل الإجهاد الحراري من النمو والتكاثر وإنتاج الحليب وإنتاج اللحوم ، مع زيادة حدوث الأمراض. علاوة على ذلك ، تطورت الكائنات الحية لتعيش في نطاقات معينة من درجات الحرارة ، ومن المتوقع أن تؤدي زيادة بضع درجات فقط إلى انقراض ما يصل إلى 16٪ من جميع الأنواع [5].

على المستوى الجزيئي ، تؤدي درجات الحرارة المرتفعة إلى تعطيل توازن طي البروتين أو التوازن البروتيني [6]. عادة ما يتم الحفاظ على البروتيوستايس من خلال شبكة واسعة من العوامل المعروفة مجتمعة باسم شبكة البروتينات ، والتي تشمل المسارات التي تنظم تخليق البروتينات وطيها والاتجار بها وتدهورها. ومع ذلك ، فإن العديد من البروتينات تتبنى حالات أصلية يتم تثبيتها بشكل هامشي فقط ، بحيث تؤدي زيادة 4 درجات مئوية فقط إلى زعزعة استقرار متوسط ​​البروتين عن طريق

20٪ في الإشريكية القولونية [7]. للتعامل مع التراكم الهائل للبروتينات غير المطوية أثناء إجهاد درجة الحرارة ، تستخدم جميع الكائنات الحية استجابة تكيفية تُعرف باسم استجابة الصدمة الحرارية (HSR) [8]. يتم التوسط في هذا المسار المحفوظ للغاية بواسطة عامل النسخ الحراري عامل الصدمة 1 (HSF1). تسبب الطفرات في HSF1 حساسية للحرارة ، في حين أن الإفراط في التعبير عن HSF1 يعزز التحمل الحراري [9 ، 10].

فئة مهمة من الجينات الخاضعة للتنظيم HSF1 هي عائلة المرافقة الجزيئية التي تساعد في طي البروتين [11 ، 12]. في غياب الإجهاد ، تشارك المرافقون في طي جديد للبروتينات المصنعة حديثًا وفي العمليات الخلوية التي تتطلب تجميع وتفكيك المجمعات الجزيئية. على سبيل المثال ، المرافقات مطلوبة لعدة خطوات من الالتقام الخلوي [13 ، 14 ، 15]. يتم تنظيم الغزوات الأولية للحفر المطلية ، وتفكك الكلاذرين أثناء فك الحويصلة ، وتثبيت الكلاذرين بعد التفكك بواسطة المرافقة HSC70. مرافق آخر ، RME-8 ، مهم للخطوات النهائية للالتقام الخلوي بوساطة الكلاذرين وهو منظم مشترك لكل من الالتقام الخلوي بوساطة المستقبل (RME) في البويضات والالتقام الخلوي في الطور السائل في خلايا الجوف في أنواع معينة انيقة [16،17،18،19]. في ظل الإجهاد ، تساعد المرافقون على إصلاح البروتينات التالفة أو المشوهة [20]. يعمل هذا على معايرة مرافقين معينين بعيدًا عن المركب المثبط باستخدام HSF1. لذلك ، يرتبط نشاط HSF1 ارتباطًا وثيقًا بحالة طي البروتين في الخلية. تؤدي الظروف الأخرى غير الإجهاد الحراري بالمثل إلى معايرة المرافق. أثناء التقدم في السن ، يُعزى الانخفاض الكبير في قدرة شبكة الانصمام البروتيني إلى التراكم المرتبط بالعمر للبروتينات المشوهة [21]. ترتبط العديد من الأمراض العصبية التنكسية أيضًا بمعايرة المرافق الموسعة [22].

تختلف عواقب الإجهاد اختلافًا جوهريًا اعتمادًا على درجة الإجهاد ومدته. تمت دراسة HSR على نطاق واسع على المستوى الجزيئي باستخدام مجموعة متنوعة من الأنظمة النموذجية المعرضة لضغط درجة الحرارة الحاد والشديد. ومع ذلك ، فإن الاستجابات الفسيولوجية لضغط درجة الحرارة في metazoans تُلاحظ عادةً أثناء الإجهاد الخفيف على نطاقات زمنية أطول بكثير. لا تزال العلاقة بين الأحداث الجزيئية التي تحدث أثناء الإجهاد الحاد والاستجابات على مستوى الكائن الحي للإجهاد المزمن بحاجة إلى وصف كامل. في الآونة الأخيرة ، تم إجراء ارتباطات بين الاستجابات الجزيئية والكائناتية لضغط درجة الحرارة. على سبيل المثال ، لقد أظهرنا أن التعرض المزمن لمدة 4 أسابيع للإجهاد الحراري في الحصين المنتصب ينتج عن فرس البحر تواتر تغذية متغير ومعدلات تهوية عامة ، إلى جانب زيادة التعبير عن جينات HSR والجينات المشاركة في تنظيم التكاثر [23]. بالإضافة إلى ذلك ، فإن ظهور الجيل التالي من التسلسل والمعلومات الجينومية قد مكّن العديد من الدراسات لفحص الاستجابات النصية للضغط الحراري في مجموعة متنوعة من الميتازوان [24 ، 25 ، 26]. بينما تولد هذه الدراسات كنزًا دفينًا من البيانات ، فإن هذه المنهجية تقتصر على توفير الارتباطات الوصفية.

الديدان الخيطية الشفافة متعددة الخلايا C. ايليجانس هو مرشح مثالي لفحص آثار الإجهاد الحراري على المستويات الجزيئية والخلوية والخاصة بالأنسجة والعضوية. إن إجهاد درجة الحرارة الحاد والمميت تقريبًا (ساعة واحدة عند 33-35 درجة مئوية) الذي يتسبب في حدوث HSR ليس له أي آثار ضارة تم الإبلاغ عنها على خصوبة الكائن الحي في C. ايليجانس [27،28،29]. على النقيض من ذلك ، فإن الإجهاد المزمن المعتدل في درجة الحرارة (48 ساعة عند 28 درجة مئوية - أعلى ببضع درجات من درجات حرارة النمو الطبيعي من 15-25 درجة مئوية) يمنع تمامًا التكاثر بينما يؤثر بشكل طفيف على الأنماط الظاهرية مثل الحيوية والحركة [30 ، 31] . هنا ، نجمع بين علم الوراثة وتحليلات النسخ مع الأنماط الظاهرية الخلوية والعضوية لتحديد الآليات الجزيئية التي تقود الاختلافات الدراماتيكية في المصير بين الإجهاد الحاد والمزمن.


مراجع

مور ، إم جيه منذ الولادة حتى الموت: الحياة المعقدة للـ mRNAs حقيقية النواة. علم 309, 1514–1518 (2005)

Martin، K.C & amp Ephrussi، A. mRNA localization: التعبير الجيني في البعد المكاني. زنزانة 136, 719–730 (2009)

Ahringer، J. & amp Kimble، J. التحكم في تبديل الحيوانات المنوية-بويضة في أنواع معينة انيقة خنثى من قبل فيم 3 3 ′ منطقة غير مترجمة. طبيعة سجية 349, 346–348 (1991)

Wightman، B.، Burglin، T. R.، Gatto، J.، Arasu، P. & amp Ruvkun، G. المتواليات التنظيمية السلبية في لين 14 3′-المنطقة غير المترجمة ضرورية لتوليد تبديل زمني أثناء أنواع معينة انيقة تطوير. تطوير الجينات. 5, 1813–1824 (1991)

Merritt، C.، Rasoloson، D.، Ko، D. & amp Seydoux، G. 3 ′ UTRs هي المنظمات الأساسية للتعبير الجيني في C. ايليجانس خط جرثومي. بالعملة. بيول. 18, 1476–1482 (2008)

روجرز ، إيه وآخرون. WormBase 2007. الدقة الأحماض النووية. 36، D612-D617 (2008)

Mangone، M.، Macmenamin، P.، Zegar، C.، Piano، F. & amp Gunsalus، K. C. UTRome.org: منصة لبيولوجيا 3′UTR في C. ايليجانس . الدقة الأحماض النووية. 36، D57-D62 (2008)

مانجوني ، إم وآخرون. المناظر الطبيعية C. ايليجانس 3′UTRs. علم 329, 432–435 (2010)

نام ، دي ك وآخرون. يولد التمهيدي Oligo (dT) ترددًا عاليًا من cDNAs المقطوعة من خلال فتيلة بولي داخلية (A) أثناء النسخ العكسي. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 99, 6152–6156 (2002)

هيلير ، إل دبليو وآخرون. التسلسل المتوازي بشكل كبير للنسخة متعددة الأدينيلات C. ايليجانس . الدقة الجينوم. 19, 657–666 (2009)

Pruitt، K.D، Tatusova، T. & amp Maglott، D. الدقة الأحماض النووية. 35، D61-D65 (2007)

Nunes، N. M.، Li، W.، Tian، B. & amp Furger، A. يتطلب موقع بولي بشري وظيفي (A) فقط DSE قويًا وتسلسلًا منبعًا غنيًا بـ A. EMBO J. 29, 1523–1536 (2010)

إيفانز ، د. وآخرون. مجمع يحتوي على CstF-64 و SL2 snRNP يربط تشكيل mRNA 3 ′ end و عبر-تقسيم في C. ايليجانس أوبرا. تطوير الجينات. 15, 2562–2571 (2001)

بريسكوت ، إي إم وبرودفوت ، إن.ج.الاصطدام النسخي بين الجينات المتقاربة في الخميرة الناشئة. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 99, 8796–8801 (2002)

باتيستا ، ب.جيه وآخرون. تتفاعل PRG-1 و 21U-RNAs لتشكيل مركب piRNA المطلوب للخصوبة في C. ايليجانس . مول. زنزانة 31, 67–78 (2008)

شيانغ ، هـ. آر وآخرون. الرنا الميكروي للثدييات: تقييم تجريبي للجينات الجديدة والمشروحة مسبقًا. تطوير الجينات. 24, 992–1009 (2010)

روبي ، جي جي ، جان ، سي إتش آند بارتل ، دي بي سلائف Intronic microRNA التي تتجاوز معالجة Drosha. طبيعة سجية 448, 83–86 (2007)

فريدمان ، آر سي ، فاره ، ك.ك ، بورج ، سي بي وأمبير بارتل ، دي بي معظم الرنا المرسال في الثدييات هي أهداف محفوظة لـ microRNAs. الدقة الجينوم. 19, 92–105 (2009)

زيسوليس ، دي جي وآخرون. اكتشاف شامل لمواقع ارتباط الأرجونوت الذاتية في أنواع معينة انيقة . هيكل الطبيعة. مول. بيول. 17, 173–179 (2010)

كلارك ، إيه إم وآخرون. يتحكم microRNA miR-124 في التعبير الجيني في الجهاز العصبي الحسي لـ أنواع معينة انيقة . الدقة الأحماض النووية. 38, 3780–3793 (2010)

لال ، إس وآخرون. خريطة على مستوى الجينوم لأهداف microRNA المحفوظة في C. ايليجانس . بالعملة. بيول. 16, 460–471 (2006)

راينهارت ، ب.جيه وآخرون. 21 نيوكليوتيد اسمحوا 7 ينظم الحمض النووي الريبي توقيت النمو في أنواع معينة انيقة . طبيعة سجية 403, 901–906 (2000)

أبراهانت ، ج. إي وآخرون. ال Caenorhabditis ايليجانس أحدب-مثل الجين لين 57/hbl-1 يتحكم في وقت النمو وينظمه microRNAs. ديف. زنزانة 4, 625–637 (2003)

Tian ، B. ، Hu ، J. ، Zhang ، H. & amp Lutz ، C. S. تحليل واسع النطاق لعديد الأدينيل mRNA لجينات الإنسان والفأر. الدقة الأحماض النووية. 33, 201–212 (2005)

وانج ، إي تي وآخرون. تنظيم الإسوي بديل في ترنسكربيتوم الأنسجة البشرية. طبيعة سجية 456, 470–476 (2008)

Sandberg ، R. ، Neilson ، J.R ، Sarma ، A. ، Sharp ، P. A. & amp Burge ، C.B. الخلايا المتكاثرة تعبر عن mRNAs مع تقصير 3 مناطق غير مترجمة وعدد أقل من مواقع الرنا الميكروي المستهدفة. علم 320, 1643–1647 (2008)

Ji ، Z. ، Lee ، J. Y. ، Pan ، Z. ، Jiang ، B. & amp Tian ، B. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 106, 7028–7033 (2009)

Mayr، C. & amp Bartel، D. P. تقصير واسع النطاق لـ 3 UTRs عن طريق الانقسام البديل والبولي أدينيل ينشط الجينات المسرطنة في الخلايا السرطانية. زنزانة 138, 673–684 (2009)

Lau، N.C، Lim، L.P، Weinstein، E.G & amp Bartel، D. P. فئة وفيرة من الحمض النووي الريبي الصغير مع أدوار تنظيمية محتملة في أنواع معينة انيقة . علم 294, 858–862 (2001)

عوامل البروتين Mandel، C.R، Bai، Y. & amp Tong، L. خلية مول. علوم الحياة. 65, 1099–1122 (2008)

يعمل كل من Guo و H. و Ingolia و N. T. و Weissman و J. S. & amp Bartel و D. P. Mammalian microRNAs في الغالب على خفض مستويات الرنا المرسال المستهدفة. طبيعة سجية 466, 835–840 (2010)

Langmead ، B. ، Trapnell ، C. ، Pop ، M. & amp Salzberg ، S. L. محاذاة فائقة السرعة وفعالة للذاكرة لتسلسلات الحمض النووي القصيرة للجينوم البشري. جينوم بيول. 10، R25 (2009)

Maglott ، D. ، Ostell ، J. ، Pruitt ، K. D. & amp Tatusova ، T. Entrez Gene: المعلومات المتمحورة حول الجينات في NCBI. الدقة الأحماض النووية. 35، D26-D31 (2007)

ائتلاف التسلسل C. elegans. تسلسل الجينوم للديدان الخيطية C. ايليجانس: منصة للتحقيق في علم الأحياء. علم 282, 2012–2018 (1998)

بلومنتال ، T. Trans-splicing and operons. WormBook 25, 1–9 (2005)

كارولشيك ، د. وآخرون. قاعدة بيانات متصفح الجينوم UCSC. الدقة الأحماض النووية. 31, 51–54 (2003)


دعم المعلومات

S1 التين. التحقق من صحة بروتوكول تضخيم وتسلسل الحمض النووي الريبي.

(أ) لمقارنة نهج تضخيم وتسلسل RNA (RNA-amp-seq) للعينات منخفضة المدخلات مقابل RNA-seq القياسي الذي تم إجراؤه على عينات ذات مدخلات عالية ، قمنا بمقارنة التقنيتين على نفس عينات الحمض النووي الريبي. يتم عرض مؤامرة ارتباط تمثيلية بين RNA-seq و RNA-amp-seq لواحد من نسختين مكررتين تم إجراؤها. (ب) تم تسلسل عينتين من مستحضرات الأجنة التي تم جمعها في نقطتين زمنيتين باستخدام كل من RNA-seq و RNA-amp-seq. تم تلوين الجينات التي تم تمثيلها بشكل زائد في الأجنة في المرحلة المتوسطة مقارنة بالأجنة المبكرة كما تم تقييمها بواسطة RNA-seq باللون الأحمر في كلتا المؤامرات. تم إنشاء المؤامرة الموجودة على اليمين باستخدام قياسات من طريقة RNA-amp-seq ، مما يوضح أن الجينات نفسها التي تم إثرائها بواسطة RNA-seq تُظهر أيضًا إثراءًا بطريقة التضخيم (أحمر). يتم أيضًا تلوين النصوص التي لم يتم تحديدها على أنها تم تمثيلها بشكل مفرط بواسطة تقنية RNA-amp-seq (السلبيات الخاطئة) (باللون الأخضر). (ج) كما هو الحال بالنسبة إلى الشكل S1B ، إلا أنه يُظهر نصوصًا ذات وفرة أعلى في الأجنة المبكرة مقارنةً بالأجنة في منتصف المرحلة بإيجابيات حقيقية (حمراء) وسلبيات كاذبة (خضراء).

S2 التين. يؤدي تجميع الخلايا المتفجرة إلى مجموعات بيانات RNA-seq مع تباين أقل بالنسبة لطرق الخلية المفردة [16].

(أ) لقياس التباين ، تم حساب معاملات التباين على أساس عدد القراءة الطبيعي الذي تم الحصول عليه في دراستنا وعلى أساس جزيئات mRNA المطلقة لكل خلية كما تم قياسها في Hashimshony et al. يتم رسم الفروق لكل جين كما تم إنتاجه في كل دراسة مقابل بعضها البعض. تم تصوير هوية x = y (الخط الأحمر الصلب) و intevals التغيير المزدوج (الخطوط المنقطة الحمراء). (ب) باستخدام قياسات عدد القراءة المعيارية التي تم الحصول عليها في هذه الدراسة ، قمنا برسم AB على P.1 النسب مقابل متوسط ​​الشدة لكل نص (نفس المؤامرة مثل الشكل 1C). النصوص غير المتماثلة التي حددها Hashimshony et al. مظللة باللون الأزرق (AB-المخصب) والأحمر (P.1-الثراء) لتوضيح سلوكياتهم في دراستنا (تظهر النصوص المحددة في دراستنا في الشكل 1 ج). (ج) التداخل بين الجينات التي حددها Hashimshony et al. ودراستنا.

S3 التين. فى الموقع صور تهجين لـ AB المخصب ، P1- النصوص الثريّة والمتناظرة.

يتم عرض النصوص المخصبة بـ AB التي أسفرت عن أنماط في الموقع مع درجات 2 أو أكثر في مسح أعمى (مرسوم في الشكل 2 ب). ص1- يتم عرض النصوص الغنية التي أسفرت عن أنماط سجلت -2 أو أقل. يتم أيضًا عرض مجموعة فرعية من النصوص المتماثلة. يتم توجيه خلية AB الأمامية دائمًا إلى يسار P الخلفية1 زنزانة. تشير رؤوس الأسهم الحمراء إلى الخلية ذات الإشارة الملحوظة الأعلى. تم التقاط جميع الصور في B و C و D من قاعدة بيانات تعبير النيماتود (http://nematode.lab.nig.ac.jp/db2/index.php).

S4 الشكل. القياس الكمي لـ smFISH لـ AB و P.1 النصوص.

الفصل 1 و bpl-1 ولكن أيضا PGL-3 أظهر بعض علامات ارتباط الجسيمات في حبيبات أكبر يمكن أن تعقد التقدير الكمي عن طريق تعداد الجسيمات البسيط. كنهج تكميلي ، قمنا بقياس وتقدير حجم الخلية كثافة التألق الطبيعي (مجمعة) داخل الجسيمات ونوضح كمياتها هنا (ب) بالمقارنة مع قياسات كثافة الجسيمات (أ) التي تم تصويرها أيضًا في الشكل 3.

S5 التين. PGL-3 يرتبط بالخلايا الخلفية خلال المراحل الجنينية المبكرة.

PGL-3 تظهر إشارات التهجين بواسطة الفحص المجهري smFISH من خلية واحدة إلى مرحلة التطور المكونة من 22 خلية تقريبًا.

S6 الشكل. ميزات التسلسل المرتبطة بنصوص وفيرة بشكل غير متماثل.

(أ) بحثنا عن السمات الجينية التي تميز الجينات المخصبة بـ AB من مجموعة الجينات المتماثلة و P1- إثراء الجينات من مجموعة الجينات المتماثلة. تسلسل وطول وخصائص 5-UTRs (Wormbase) ، 3-UTR (Wormbase، Mangone et al. [100]). تم مقارنة استخدام زعيم لصق (Mangone وآخرون) ، وأطوال نموذج الجينات المقسمة وغير المقسمة بين مجموعات الجينات الثلاثة. لم يتم العثور على ارتباطات ذات دلالة إحصائية باستثناء طول النموذج الجيني (كلاهما مقسم وغير مقسم). (ب) يتم عرض ترددات النوكليوتيدات في النص بأكمله (النموذج المقسم). (ج) يتم عرض النسبة النسبية لأطوال نموذج الجين mRNA المقسم (التي تراوحت من 0 إلى 8000 نانومتر) لـ P1- الجينات المخصبة والجينات المتماثلة. يتم رسم الجينات المخصبة AB والجينات المتماثلة في اللوحة اليمنى. ص تم حساب قيم احتمالية استخلاص التوزيعين من نفس السكان باستخدام مجموع رتبة ويلكوكسون (مان ويتني يو) اختبار مع تصحيح الاستمرارية (ص = 1.364x10 -13 لـ AB مقابل متماثل و ص = 9.827x10 -9 لـ P.1 مقابل متماثل).

جدول S1. النصوص المخصبة بـ AB و P.1- النصوص الغنية.

قائمة بسيطة للغاية من AB المخصب و P1- النصوص المخصّصة على النحو المحدد في هذه الدراسة.

مجموعة البيانات S1. AB و P.1 مجموعة بيانات النسخ.

ملف Excel مع AB و P1 القيم والدرجات لجميع الجينات البالغ عددها 20،240 جينًا. يحتوي هذا الملف على عدة أوراق عمل. (1) بيانات الشرح. تسرد ورقة العمل هذه عنوان كل عمود ومعناه. يحتوي أيضًا على رمز R الذي تم استخدامه لتصفية القوائم وترتيبها. (2) مجموعة بيانات كاملة. تسرد ورقة العمل هذه قراءات العد الخام لكل جين لكل عينة ، وقراءات العد الطبيعي لكل جين لكل عينة ، وتحليل مخرجات DESeq ، والتعليقات التوضيحية لكل جين. (2) المجموعة الفرعية الحالية. هذه هي نفس المعلومات من مجموعة البيانات الكاملة ولكنها تتضمن فقط الجينات "الموجودة". (3) مجموعة فرعية AB. هذه هي نفس المعلومات من مجموعة البيانات الكاملة ولكنها تتضمن فقط الجينات التي تم تحديدها على أنها مخصبة بـ AB. (4) ص1 مجموعة فرعية. هذه هي نفس المعلومات من مجموعة البيانات الكاملة ولكنها تتضمن فقط الجينات التي تم تحديدها على أنها P1المثرية. (5) مجموعة فرعية متماثلة. هذه هي نفس المعلومات من مجموعة البيانات الكاملة ولكنها تتضمن فقط الجينات التي تم تحديدها على أنها متماثلة. تم استخدام البيانات من جداول البيانات هذه لإنشاء الشكل 1C ، وتغيير طي RNA-seq في الشكل 2E ، و S2B الشكل.

مجموعة البيانات S2. عام فى الموقع بيانات التهجين.

ملف Excel يحتوي على ثلاثة جداول بيانات توثق النصوص التي استفسرنا عنها في قاعدة بيانات Kohara ، وأنماطها فى الموقع تهجين. تم استخدام البيانات من هذا الملف لإنشاء الشكل 2 أ و 2 ب.

مجموعة بيانات S3. وثائق qRT-PCR.

ملف اكسل يحتوي على قياسات لتجارب qRT-PCR. تم استخدام البيانات من هذا الملف لإنشاء الشكل 2C.

مجموعة بيانات S4. رني الفتك الجنيني.

يحتوي ملف Excel على نسبة مئوية من معدلات الوفيات الجنينية المحددة لمجموعة فرعية من AB المخصب و P.1الجينات المخصبة. تم استخدام البيانات من هذا الملف لإنشاء الشكل 4 أ.

مجموعة بيانات S5. هذا هو المواد التي سوف تستخدم.

ملف Excel يحتوي على معرّف الأنطولوجيا GO والممثل بشكل مفرط في AB-rich and P1قائمة غنية. يحتوي على مصطلحات GO ومخرجات REViGO والجينات التي تساهم في كل فئة. تم استخدام البيانات من هذا الملف لإنشاء الشكل 5.

مجموعة البيانات S6. مقارنة مع مجموعات الجينات المنشورة.

ملف Excel يحتوي على قائمة بجميع الجينات الموجودة في 7945 جينًا موجودًا. يقوم هذا الملف بجدولة تلك الجينات التي حدثت في قائمة mRNAs الأمهات المتدهورة [MD] [60] وتلك التي حدثت في مجموعات البيانات المخصبة بنوع الأنسجة [61]. تم استخدام البيانات من هذا الملف لإنشاء الشكل 6A-6C.

مجموعة بيانات S7. معامل التباين.

ملف إكسل يحتوي على أعداد طبيعية الحجم مدمجة من هذه الورقة ومن هاشمشوني وآخرون. يتم تضمين حسابات معامل التباين وقائمة الجينات المتداخلة. تم استخدام البيانات من هذا الملف لإنشاء S2A Fig و S2C Fig

نص S1. قواعد التقييم العام فى الموقع بيانات التهجين.

تم الاستعلام عن مستند pdf يسرد نموذج التقييم المستخدم لإرشاد المراجعين حول كيفية تسجيل النصوص في قاعدة بيانات Kohara وأنماط التهجين في الموقع في مرحلة مكونة من خليتين من التطوير.

نص S2. مجموعات مسبار smFISH.

ملف نصي يحتوي على تحقيقات smFISH المستخدمة في هذه الدراسة. تم تصميم المجسات بواسطة Stellaris. تم استخدام المجسات الموثقة في هذا الملف لإنشاء صور تهجين موضحة في الشكل 3 والشكل 5 والشكل S4 والشكل S5.

نص S3. مجموعة بيانات الفحص المجهري الكمي.

ملف نصي يحتوي على عدد الجسيمات وتعداد الفلورة الداخلية لكل جنين تم تصويره بواسطة تحقيقات smFISH المدرجة في نص S2. تم توضيح البيانات التي تم تحليلها من هذه المجموعة الأولية في الشكل 3 و S4 الشكل.

نص S4. PSPM of Motif 1.

ملف نصي يحتوي على مصفوفة الاحتمالات المحددة للموقع (PSPM) التي حددتها MEME. تم تمثيل هذا النموذج بشكل كبير في متواليات 3-UTR لـ P.1- النصوص المخصبة بالنسبة إلى مجموعة 3 ′ UTR متواليات من النصوص المتماثلة.

نص S5. PSPM of Motif 2.

ملف نصي يحتوي على PSPM المحدد بواسطة MEME. تم تمثيل هذا النموذج بشكل كبير في متواليات 3-UTR لـ P.1- النصوص المخصبة بالنسبة إلى مجموعة 3 ′ UTR متواليات من النصوص المتماثلة.

نص S6. تجارب تخفيف الحمض النووي الريبي.

ملف نصي يحتوي على قراءات أولية وموحدة لدراسة تم فيها تحديد عينات من إجمالي الحمض النووي الريبي باستخدام بروتوكول RNA-amp-seq ذي المدخلات المنخفضة وبروتوكول RNA-seq القياسي. تم استخدام البيانات من هذا الملف لإنشاء S1A-S1C Fig.


شاهد الفيديو: Evolution of hermaphroditism in Caenorhabditis (كانون الثاني 2022).