معلومة

التسلسل من PCR

التسلسل من PCR



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

بقدر ما أفهمه ، يمكن استخدام PCR لعمل نسخ عديدة من جين واحد. سؤالي هو ، هل من الممكن تسلسل الحمض النووي بعد PCR وهل هو أسهل من التسلسل عبر طرق أخرى. إذا كان ذلك ممكناً ، فكيف ستفعله؟


تحتاج جميع طرق التسلسل ، سواء كانت تسلسل سانجر الكلاسيكي أو تسلسل الجيل التالي (أو حتى الجيل الثالث) ، إلى كمية معينة من الحمض النووي للعمل معها.

تحتاج إما إلى استخراج الحمض النووي من عينة نسيج كبيرة أو تحتاج إلى تضخيم محتوى الحمض النووي من عينة أصغر. غالبًا ما يكون النهج الأول غير عملي ، أو مستحيلًا تمامًا (عندما تريد العمل مع خلايا مفردة أو كائنات صغيرة جدًا).

لذلك يتم استخدام PCR بشكل روتيني لتضخيم الحمض النووي قبل التسلسل. التسلسل نفسه لا يتأثر بهذا - فأنت تستخدم أي تقنية مناسبة. ومع ذلك ، قد يؤدي تفاعل البوليميراز المتسلسل (PCR) إلى إدخال تحيزات في البيانات لأنه لا تتضخم كل شظايا الحمض النووي بكفاءة متساوية. يجب الاهتمام بهذا في التحليل النهائي لبيانات التسلسل إذا كانت المعلومات الكمية مطلوبة (كما في RNA-seq أو ChIP-seq).

بالعودة إلى سؤالك ، فإن تفاعل البوليميراز المتسلسل ليس طريقة تسلسل في حد ذاته. إنه يساعد فقط في الحصول على الكمية اللازمة من المواد الخام من أجل عمل التسلسل. علاوة على ذلك ، فإن معظم طرق التسلسل في الواقع يشمل خطوات تفاعل البوليميراز المتسلسل أيضًا ، لأنها تعتمد على توليد شظايا الحمض النووي المتداخلة ليتم تخييطها معًا.


نحن نفعل ذلك في كل وقت. يمكنك استخدام أحد البرايمرات الطرفية / المرافقة واستخدامها كأساس للتسلسل. عادةً ما يكون لدى الشركات إعداد حيث يمكنها أخذ عينة "مختلطة مسبقًا".

نظرًا لأننا نميل إلى استخدام Sequetech ، فإليك تفاصيلها: http://www.sequetech.com/requirements.php؟premixed=1

للحصول على رأي ثانٍ ، انظر إلى موقع Elimbio: http://www.elimbio.com/Sample_Preparation.htm


مكتب الإجابة

تحتاج جميع طرق التسلسل ، سواء كانت تسلسل سانجر الكلاسيكي أو تسلسل الجيل التالي (أو حتى الجيل الثالث) ، إلى كمية معينة من الحمض النووي للعمل معها.

تحتاج إما إلى استخراج الحمض النووي من عينة نسيج كبيرة أو تحتاج إلى تضخيم محتوى الحمض النووي من عينة أصغر. غالبًا ما يكون النهج الأول غير عملي ، أو مستحيلًا تمامًا (عندما تريد العمل مع خلايا مفردة أو كائنات صغيرة جدًا).

لذلك يتم استخدام PCR بشكل روتيني لتضخيم الحمض النووي قبل التسلسل. التسلسل نفسه لا يتأثر بهذا & # 8211 الذي تستخدمه أي تقنية مناسبة. & # 160 ومع ذلك ، قد يقدم PCR تحيزات في البيانات لأنه لا يتم تضخيم جميع أجزاء الحمض النووي بنفس الكفاءة. يجب الاهتمام بهذا في التحليل النهائي لبيانات التسلسل إذا كانت المعلومات الكمية مطلوبة (كما في RNA-seq أو ChIP-seq).

بالعودة إلى سؤالك ، فإن تفاعل البوليميراز المتسلسل ليس طريقة تسلسل في حد ذاته. إنه يساعد فقط في الحصول على الكمية اللازمة من المواد الخام من أجل عمل التسلسل. علاوة على ذلك ، فإن معظم طرق التسلسل في الواقع يشمل خطوات تفاعل البوليميراز المتسلسل أيضًا ، لأنها تعتمد على توليد شظايا الحمض النووي المتداخلة ليتم تخييطها معًا.


خطوات المشاركة في تفاعل البلمرة المتسلسل في تسلسل الحمض النووي

بعض الخطوات الرئيسية المتضمنة في تفاعل البلمرة المتسلسل في تسلسل الحمض النووي هي: 1. الخطوة 1: التمسخ بالحرارة 2. الخطوة 2: التلدين التمهيدي إلى التسلسل المستهدف 3. الخطوة 3: التمديد 4. الخطوة 4: نهاية دورة PGR الأولى .

يعمل تفاعل البلمرة المتسلسل (PGR) على تضخيم قطعة واحدة من الحمض النووي عبر عدة أوامر من حيث الحجم ، انظر الشكل 6.2. إنه إنشاء آلاف إلى ملايين النسخ من تسلسل DNA معين.

PGR هي عملية أو دورة من ثلاث خطوات. يتكرر عدد محدد من المرات. بمجرد أن تتكون دورة PGR من هذه الخطوات وهي التمسخ والتليين والتمديد. تتحكم الأداة تلقائيًا في العملية التي تحدث في جهاز تدوير حراري ، حيث تتبدل درجات الحرارة لفترات زمنية مبرمجة للعدد المناسب من دورات PGR.

1. الخطوة 1: تمسخ التشبع بالحرارة:

عادة ما تكون الحرارة أكثر من 90 درجة مئوية عند فصل الحمض النووي مزدوج الشريطة إلى شريطين منفردان. تُعرف هذه العملية باسم & # 8220denaturation & # 8221. الروابط الهيدروجينية التي تربط القواعد ببعضها البعض ضعيفة ، وبالتالي فإن التمسخ ممكن. تنكسر روابط الهيدروجين عند درجات حرارة عالية ، في حين أن الروابط بين الديوكسيريبوز والفوسفات ، تظل سليمة لأن هذه أقوى تظل سليمة.

2. الخطوة 2: التلدين التمهيدي للتسلسل المستهدف:

الهدف النهائي لـ PGR هو تكرار تسلسل مستهدف من حوالي 100-600 زوج أساسي فريد للكائن الحي قيد الدراسة. يتم تحقيق استهداف التسلسل باستخدام الاشعال. علامات التمهيدي نهايات التسلسل الهدف.

بادئات اختبار AMPLICOR® عبارة عن تسلسلات اصطناعية قصيرة من الحمض النووي أحادي السلسلة تتكون عادةً من 20-30 قاعدة ، مع نهاية 5 & # 8242 البيوتين للمساعدة في الكشف. بالنسبة للمنطقة المستهدفة من الكائن الحي ، فهي محددة PGR لها اثنين من البادئات ، واحدة لكل من خيوط الحمض النووي الفردية التكميلية التي تم إنتاجها أثناء تغيير طبيعة خيوط الحمض النووي المفردة التي تم إنتاجها أثناء التمسخ.

يتم تمييز بداية تسلسل الدنا المستهدف ذي الأهمية بواسطة البادئات التي تصلب (ترتبط) بالتسلسل التكميلي. يحدث التلدين عادة بين 40 درجة مئوية و 65 درجة مئوية ، اعتمادًا على الطول والتسلسل الأساسي للبادئات.

3. الخطوة 3: التمديد:

ترتفع درجة الحرارة إلى ما يقرب من 72 درجة مئوية بعد أن تصلب البادئات لتسلسل الحمض النووي التكميلي. أيضًا ، يتم استخدام إنزيم Taq DNA polymerase لتكرار خيوط DNA. إن بوليميراز DNA Taq عبارة عن بوليميراز DNA مؤتلف حراري ثابت من كائن Thermus aquatics لنا وعلى عكس إنزيمات البوليميراز العادية نشطة في درجات حرارة عالية.

تقوم عملية التوليف بتوليف جزيئات DNA جديدة مزدوجة الجديلة ، وكلاهما متطابقة مع منطقة الحمض النووي المستهدفة المزدوجة التي تقطعت بها السبل ، من خلال تسهيل الارتباط والانضمام للنيوكليوتيدات التكميلية الخالية في المحلول (dNTPs). يبدأ التمديد دائمًا عند الطرف 3 & # 8242 من التمهيدي مما يجعل خيطًا مزدوجًا من كل من الخيطين الفرديين. يتم تصنيع بوليميراز DNA Taq حصريًا في الاتجاه 5 & # 8242 إلى 3 & # 8242.

4. الخطوة 4: نهاية دورة PGR الأولى:

يوجد الآن خيطان جديدان للحمض النووي متطابقان مع الهدف الأصلي في نهاية دورة PGR الأولى. تحتوي الخيوط المشكلة حديثًا على بداية ، والتي يتم تحديدها بدقة بواسطة 5 & # 8242 نهاية التمهيدي ، لكن النهاية 3 & # 8242 غير محددة بدقة.

ثم يكون لشريط الحمض النووي المركب من مثل هذا القالب طول محدد بدقة يكون محدودًا في أي من الطرفين بنهاية 5 & # 8242 لكل من البادئين. تُعرف خيوط الحمض النووي هذه باسم AMPLIGON. خيوط الحمض النووي التي تتوافق مع التسلسل المستهدف. بعد بضع دورات فقط ، تكون موجودة بأعداد أكبر بكثير من متواليات الطول المتغير. التسلسل المحاط أو المحدد بواسطة البادئين هو المقطع الذي يتم تضخيمه.


التسلسل من PCR - علم الأحياء

PCR القائم عكس تحليل تسلسل DNA Shotgun-Clone

(أ) جينوم كبير (10 6

7 أو أكثر من bps) إلى أجزاء عشوائية ويتم استنساخها في مكتبة ناقلات بلازميد. يتم تسلسل عدد كبير من هذه البلازميدات عشوائيًا ، باستخدام أساس تسلسل خاص بالبلازميد ( نفسجي تمايل). يتم الحصول على التسلسل الجينومي النهائي عن طريق تجميع تسلسلات متعددة الأجزاء المتداخلة. في هذا المثال ، موضع نيوكليوتيد معين ( خط أحمر ) هو إجماع على ثلاثة مستنسخات متداخلة (في الممارسة العملية ، يمكن قراءة أي موضع معين 5

10 مرات أو أكثر). الهدف من جهد التسلسل هو الحصول على التسلسل الكامل لـ واحد كبير الجينوم بدقة كبيرة. القراءة الكاملة لأي نسخة معينة ليست ضرورية ، لأن تغطية الجينوم زائدة عن الحاجة ويمكن استبعاد المناطق ذات دقة التسلسل المنخفضة تلقائيًا من الإجماع.

(ب) جينوم ميتوكوندريا صغير (

1.7 × 10 4 بت في الثانية) يتم تضخيمه بواسطة تفاعل البوليميراز المتسلسل كمجموعة من

17 قطعة متداخلة 1 كيلو بايت. أزواج PCR التمهيدي ( أحمر & أمبير أزرق شرائح الخط) على أساس معرفة التسلسل من نفس النوع أو الأنواع ذات الصلة. يتم تحليل جينومات متعددة: في المثال ، تم ترتيب 10 أفراد مختلفين (في الممارسة العملية ، قد يكون هذا المئات من أي نوع واحد). يتم قراءة تسلسل أي نيوكليوتيد واحد بالضبط مرتين، من البادئات الأمامية والعكسية لجزء معين. الهدف من جهد التسلسل هو التعرف النوكليوتيدات المفردة (النيوكلوتايد) بين العديد من الأفراد ( كتل حمراء ). قراءة دقيقة كاملة الطول للتسلسلات الأطول ( لون أخضر تمايل) ضروري لتحديد النيوكلوتايد الحقيقي داخل السكان من الحد الأدنى من شظايا PCR. Text & amp Figure & copy 2000 بواسطة Steven M. Carr


تسلسل الحمض النووي

يعد إعداد مكتبة DNA عالية الجودة الخطوة الأولى في تجربة تسلسل الحمض النووي الناجحة. عند البدء باستخدام الحمض النووي بكميات محدودة أو بجودة متفاوتة ، يجب أن تكون طريقة إعداد المكتبة دقيقة وفعالة ، وتجنب خطوات التنقية التي تقلل من استعادة العينة. تلبية هذه المتطلبات لمجموعة واسعة من التطبيقات ، تتميز حافظة تسلسل الحمض النووي لدينا بسير عمل أحادي الأنبوب للعينات الصعبة مثل الخلايا المفردة أو الحمض النووي الخالي من الخلايا أو الحمض النووي FFPE.

يعد إعداد مكتبة DNA عالية الجودة الخطوة الأولى في تجربة تسلسل الحمض النووي الناجحة. عند البدء باستخدام الحمض النووي بكميات محدودة أو بجودة متفاوتة ، يجب أن تكون طريقة إعداد المكتبة دقيقة وفعالة ، وتجنب خطوات التنقية التي تقلل من استعادة العينة. تلبية هذه المتطلبات لمجموعة واسعة من التطبيقات ، تتميز حافظة تسلسل الحمض النووي لدينا بسير عمل أحادي الأنبوب للعينات الصعبة مثل الخلايا المفردة أو الحمض النووي الخالي من الخلايا أو FFPE DNA.

  • يمكن استخدام مجموعة ThruPLEX DNA-Seq في أي تطبيق DNA-seq أو RNA-seq أو ChIP-seq وتوفر أداء تسلسل قويًا ومستهدفًا مع جميع منصات التخصيب المستهدفة الرائدة.
  • يوفر ThruPLEX DNA-Seq HV و ThruPLEX Tag-Seq HV بيانات موثوقة ومتسقة من العينات الصعبة باستخدام سير عمل مبسط وعلامات جزيئية لتصحيح الخطأ.
  • تعد PicoPLEX Single Cell WGA v3 Kit و PicoPLEX Gold Single Cell DNA-Seq Kit المعايير الذهبية لاكتشاف CNV واختلال الصيغة الصبغية من مدخلات أحادية الخلية ومستوى picogram.

تفاعل البوليميراز المتسلسل (PCR) معترف به كواحد من أكثر التقنيات تمكينًا في البيولوجيا الجزيئية. 1 مهد ظهور الجيل التالي من التسلسل (NGS) الطريق لعدد كبير من تطبيقات PCR الجديدة. باستثناء البروتوكولات الخالية من تفاعل البوليميراز المتسلسل (التي أصبحت المعيار الذهبي لتسلسل الجينوم البشري الكامل) ، فإن غالبية الاستراتيجيات المستخدمة لتحويل العينات إلى مكتبات NGS جاهزة للتسلسل تتضمن خطوة واحدة أو أكثر من خطوات تفاعل البوليميراز المتسلسل. بالإضافة إلى ذلك ، يتم استخدام الأساليب القائمة على PCR في مراحل أخرى من عملية تحضير العينة ، بما في ذلك مراقبة الجودة و / أو خطوات القياس الكمي.

تقدم NGS العديد من التحديات لتقنية PCR. وتشمل هذه الكميات المحدودة من النموذج ، وجودة عينة منخفضة أو متغيرة. تتطلب خطوات تضخيم المكتبة تكرارًا حقيقيًا (غير متحيز) لمجموعات معقدة للغاية من الجزيئات. الدقة العالية للغاية ضرورية للحد من أخطاء تفاعل البوليميراز المتسلسل (PCR) التي قد تؤدي إلى مكالمات متغيرة وراثية خاطئة. سواء كنت تقوم بإنشاء مكتبات amplicon ، أو تضخيم أو تحديد مكتبات جاهزة للتسلسل ، أو تستخدم PCR لغرض مختلف في سير عمل إعداد نموذج NGS الخاص بك ، كفاءة تضخيم عالية ، انحياز تضخيم منخفض ودقة عالية هناك حاجة إلى معالجة المزيد من العينات بنجاح ، والحصول على مزيد من المعلومات من كل عينة وتحسين موارد التسلسل. مكنتنا منصة التطور الموجهة المستخدمة في KAPA من تطوير الجيل التالي من بوليمرات الحمض النووي المصممة خصيصًا لمواجهة هذه التحديات.

تطبيقات مميزة

تقدم حلول Roche Sample Prep مجموعة من الإنزيمات المصممة لتضخيم قوي لأنواع مختلفة من القوالب لمجموعة واسعة من التطبيقات. مكنت إنزيمات KAPA علوم الحياة والبحوث لأكثر من عقد من الزمان. تعرف على المزيد حول فوائد الإنزيمات لدينا ، وكيف يستخدمها الباحثون لأغراض مختلفة في مهام سير عمل NGS.


تسلسل الرنا الريباسي 16S: تقنية قائمة على PCR لتحديد الأنواع البكتيرية

كوكب الأرض هو موطن لملايين الأنواع البكتيرية ، ولكل منها خصائص محددة. يستخدم تحديد الأنواع البكتيرية على نطاق واسع في علم البيئة الميكروبية لتحديد التنوع البيولوجي للعينات البيئية وعلم الأحياء الدقيقة الطبية لتشخيص المرضى المصابين. يمكن تصنيف البكتيريا باستخدام طرق علم الأحياء الدقيقة التقليدية ، مثل الفحص المجهري ، والنمو على وسط معين ، والاختبارات البيوكيميائية والمصلية ، ومقايسات حساسية المضادات الحيوية. في العقود الأخيرة ، أحدثت طرق علم الأحياء الدقيقة الجزيئي ثورة في التعرف على البكتيريا. طريقة شائعة هي التسلسل الجيني 16S ribosomal RNA (rRNA). هذه الطريقة ليست أسرع وأكثر دقة من الطرق التقليدية فحسب ، ولكنها تسمح أيضًا بتحديد السلالات التي يصعب نموها في ظروف المختبر. علاوة على ذلك ، فإن تمايز السلالات على المستوى الجزيئي يتيح التمييز بين البكتيريا المتطابقة ظاهريًا (1-4).

ينضم 16S rRNA مع مجمع من 19 بروتينًا لتشكيل وحدة فرعية 30S من الريبوسوم البكتيري (5). يتم ترميزه بواسطة جين 16S rRNA ، الموجود ومحفوظ بشكل كبير في جميع البكتيريا نظرًا لوظيفته الأساسية في تجميع الريبوسوم ، ومع ذلك ، فإنه يحتوي أيضًا على مناطق متغيرة قد تكون بمثابة بصمات أصابع لأنواع معينة. جعلت هذه الميزات جين 16S rRNA جزءًا جينيًا مثاليًا لاستخدامه في تحديد البكتيريا ومقارنتها وتصنيفها (6).

يعتمد التسلسل الجيني 16S rRNA على تفاعل البلمرة المتسلسل (PCR) (7-8) متبوعًا بتسلسل الحمض النووي (9). PCR هي طريقة بيولوجيا جزيئية تُستخدم لتضخيم أجزاء معينة من الحمض النووي من خلال سلسلة من الدورات التي تشمل:

ط) تمسخ لقالب الحمض النووي المزدوج الذين تقطعت بهم السبل
2) تلدين البادئات (قليل النوكليوتيدات القصيرة) التي تكون مكملة للقالب
ج) تمديد البادئات بواسطة إنزيم بوليميراز الدنا ، الذي يصنع خيطًا جديدًا من الحمض النووي

يتم عرض نظرة عامة تخطيطية للطريقة في شكل 1.


شكل 1: نظرة عامة تخطيطية لتفاعل PCR. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

هناك العديد من العوامل المهمة لنجاح تفاعل تفاعل البوليميراز المتسلسل ، أحدها جودة قالب الحمض النووي. يمكن إجراء عزل الحمض النووي الصبغي من البكتيريا باستخدام البروتوكولات القياسية أو المجموعات التجارية. يجب توخي الحذر بشكل خاص للحصول على DNA خالٍ من الملوثات التي يمكن أن تمنع تفاعل PCR.

تسمح المناطق المحفوظة لجين الرنا الريباسي 16S بتصميم أزواج التمهيدي العالمية (أحدهما للأمام والآخر للخلف) التي يمكنها الارتباط بالمنطقة المستهدفة وتضخيمها في أي نوع بكتيري. يمكن أن تختلف المنطقة المستهدفة في الحجم. في حين أن بعض أزواج التمهيدي يمكنها تضخيم معظم جين الرنا الريباسي 16S ، فإن البعض الآخر يقوم بتضخيم أجزاء منه فقط. يتم عرض أمثلة من البادئات شائعة الاستخدام في الجدول 1 ومواقع الربط الخاصة بهم موضحة في الشكل 2.

اسم التمهيدي تسلسل (5 & # 39 & # 85943 & # 39) إعادة المرجعي
8F ب) AGAGTTTGATCCTGGCTCAG إلى الأمام -1
27F AGAGTTTGATCMTGGCTCAG إلى الأمام -10
515F جتككاجكمجككجكجتا إلى الأمام -11
911 ص GCCCCCGTCAATTCMTTTGA يعكس -12
1391 ص GACGGGCGGTGTGTRCA يعكس -11
1492 ص GGTACCTTGTTACGACTT يعكس -11

الجدول 1: أمثلة على قليل النيوكليوتيدات القياسية المستخدمة في تضخيم جينات الرنا الريباسي 16S أ).
أ) يمكن تقدير الأطوال المتوقعة لمنتج PCR الذي تم إنشاؤه باستخدام مجموعات التمهيدي المختلفة عن طريق حساب المسافة بين مواقع الربط للأمام والتمهيدي العكسي (انظر الشكل 2) ، على سبيل المثال حجم منتج PCR باستخدام زوج التمهيدي 8F-1492R هو

1500 نقطة أساس ، وللزوج التمهيدي 27F-911R

900 نقطة أساس
ب) تُعرف أيضًا باسم fD1


الشكل 2: رقم تمثيلي لتسلسل الرنا الريباسي 16S ومواقع الربط التمهيدي. يتم تلوين المناطق المحفوظة باللون الرمادي وتملأ المناطق المتغيرة بخطوط قطرية. للسماح بأعلى دقة ، يتم استخدام التمهيدي 8F و 1492R (الاسم بناءً على الموقع على تسلسل الرنا الريباسي) لتضخيم التسلسل بالكامل ، مما يسمح بتسلسل عدة مناطق متغيرة من الجين. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

شروط ركوب الدراجات لـ PCR (بمعنى آخر. تعتمد درجة الحرارة والوقت اللازمين لتحريف طبيعة الحمض النووي ، وتلدينه باستخدام مواد أولية ، وتوليفه) على نوع البوليميراز المستخدم وخصائص البادئات. يوصى باتباع إرشادات الشركة المصنعة & # 39s لبوليميراز معين.

بعد اكتمال برنامج PCR ، يتم تحليل المنتجات بواسطة الاغاروز الكهربائي للهلام. ينتج عن PCR الناجح نطاق واحد بالحجم المتوقع. يجب تنقية المنتج قبل التسلسل لإزالة البادئات المتبقية ، ديوكسي ريبونوكليوتيدات ، بوليميراز ، والمخزن الذي كان موجودًا في تفاعل تفاعل البوليميراز المتسلسل. عادةً ما يتم إرسال شظايا الحمض النووي المنقى للتسلسل إلى خدمات التسلسل التجاري ، ومع ذلك ، تقوم بعض المؤسسات بإجراء تسلسل الحمض النووي في منشآتها الأساسية الخاصة.

يتم إنشاء تسلسل الحمض النووي تلقائيًا من مخطط كروماتوجرافي للحمض النووي بواسطة الكمبيوتر ويجب فحصه بعناية للتأكد من جودته ، حيث يلزم أحيانًا التحرير اليدوي. بعد هذه الخطوة ، تتم مقارنة تسلسل الجينات بالتسلسلات المودعة في قاعدة بيانات 16S rRNA. يتم تحديد مناطق التشابه ، ويتم تسليم التسلسلات الأكثر تشابهًا.

إجراء

  1. أثناء التعامل مع الكائنات الحية الدقيقة ، يجب اتباع الممارسات الميكروبيولوجية الجيدة. يجب معاملة جميع الكائنات الحية الدقيقة ، وخاصة العينات غير المعروفة ، على أنها مسببات أمراض محتملة. اتبع تقنية التعقيم لتجنب تلويث العينات أو الباحثين أو المختبر. اغسل يديك قبل وبعد التعامل مع البكتيريا واستخدم القفازات وارتداء الملابس الواقية.
  2. إجراء تقييم المخاطر للبروتوكول التجريبي لعزل الحمض النووي الجيني وتنقية المنتج PCR. قد تكون بعض الكواشف ضارة!
  3. الثقافة النقية ضرورية لتسلسل الرنا الريباسي 16S. قبل الشروع في عزل الحمض النووي الجيني ، تأكد من أن مادة البداية نقية تمامًا. يمكن القيام بذلك عن طريق الطلاء الخطي لعزل المستعمرات الفردية. يمكن زراعتها بشكل إضافي مخططة على أطباق منفردة ، أو في مرق ، إذا لزم الأمر.
  4. معدات المختبرات المطلوبة:
    1. جهاز التدوير الحراري لـ PCR. تتمثل وظيفة جهاز التدوير الحراري في رفع درجة الحرارة وخفضها وفقًا لبرنامج محدد. أثناء إنشاء البرنامج ، سيُطلب منك إدخال قيم درجة الحرارة والوقت لكل خطوة PCR بالإضافة إلى العدد الإجمالي للدورات.
    2. نظام الاغاروز الكهربائي للهلام. يتم استخدامه لفصل أجزاء الحمض النووي بناءً على حجمها وشحنها. في هذا البروتوكول ، سيتم استخدام الاغاروز الكهربائي للهلام لتصور جودة الحمض النووي الجيني المعزول ومنتجات PCR.

    ملحوظة: ينطبق البروتوكول الموضح على التسلسل الجيني 16S rRNA من ثقافة نقية للبكتيريا. لا ينطبق على دراسات الميتاجينوميات.

    1. زراعة البكتيريا لعزل الحمض النووي الجيني (gDNA).
      1. تنمو الكائنات الحية الدقيقة الخاصة بك على وسط مناسب. يمكن استخدام كل من الوسائط السائلة والصلبة في هذه الخطوة. اختر الظروف التي تحقق أفضل نمو. أثناء التخطيط للتجربة ، ضع في اعتبارك أن البكتيريا بطيئة النمو قد تحتاج إلى عدة أيام للوصول إلى مرحلة النمو المتأخر / الثابت. في هذا البروتوكول ، العصوية الرقيقة نمت 168 في مرق ليسوجيني (LB) طوال الليل في حاضنة اهتزازية عند 200 دورة في الدقيقة ، 37 & # 176 درجة مئوية.
      1. إذا نمت البكتيريا على وسط صلب ، اكشط بعض الخلايا باستخدام حلقة معقمة وأعد تعليقها في 1 مل من الماء المقطر
      2. إذا نمت البكتيريا في وسط سائل ، استخدم ما يقرب من 1.5 مل من الثقافة بين عشية وضحاها.
      3. قم بتكوير الخلايا بالطرد المركزي (1 دقيقة ، 12000 - 16000 & # 215 جم) ، قم بإزالة المادة الطافية ، واستخدم الخلايا لعزل gDNA باستخدام مجموعة تجارية أو بروتوكولات قياسية [على سبيل المثال إعداد الحمض النووي الكلي CTAB (13) أو استخراج الفينول كلوروفورم (14)]. هنا ، تم استخدام مجموعة تجارية لعزل جدنا من 1.5 مل من B. الرقيقة 168 ثقافة ليلية ، OD600 = 1.5.
        ملاحظة 1: بالنسبة لبعض البكتيريا سالبة الجرام ، يمكن حذف هذه الخطوة واستبدالها بإطلاق بسيط للحمض النووي من الخلايا عن طريق الغليان. أعد تعليق الحبيبات البكتيرية في الماء المقطر واحتضانها في كتلة تسخين على درجة 100 & # 176 درجة مئوية لمدة 10 دقائق.
        ملاحظة 2: يصعب تعطيل الخلايا البكتيرية إيجابية الجرام. لذلك يوصى باختيار طريقة أو مجموعة عزل gDNA مخصصة للعزل عن هذه المجموعة من البكتيريا.
      1. تحقق من جودة المعزولة جدنا بواسطة الاغاروز الكهربائي للهلام. أولاً ، قم بخلط 5 & # 181L من gDNA المعزول مع 1 & # 181L من صبغة التحميل (6x) ، وقم بتحميل العينة على هلام agarose 0.8٪ يحتوي على كاشف تلطيخ DNA.
      2. قم بتحميل معيار الكتلة الجزيئية وقم بتشغيل الرحلان الكهربائي حتى تصل مقدمة الصبغة إلى قاع الجل.
      3. بمجرد اكتمال الرحلان الكهربي ، تصور الهلام على ضوء ترانسيلوميتور مناسب (سواء الأشعة فوق البنفسجية أو الضوء الأزرق). يظهر gDNA كحزمة جزيئية عالية سميكة (فوق 10 كيلو بايت). يتم عرض مثال على فحص جودة جدنا في الشكل 3.
      4. إذا اجتاز gDNA مراقبة الجودة (أي. الشريط الجزيئي العالي موجود ولا يوجد تلطيخ ضئيل أو معدوم لـ gDNA) ، قم بتخفيف الـ gDNA الخاص بك بشكل متسلسل عن طريق وضع العلامات الأولى على 3 أنابيب للطرد المركزي الدقيق على النحو التالي: & # 3410x & # 34، & # 34100x & # 34 و & # 341000x & # 34 .
      5. ماصة 90 & # 181 لترًا من الماء المقطر المعقم في كل من الأنابيب الثلاثة.
      6. خذ 10 & # 181L من محلول gDNA وأضفه إلى الأنبوب الذي يحمل علامة & # 3410x & # 34.
      7. بيبيت الحجم الكامل (بمعنى آخر. 100 & # 181L) لأعلى ولأسفل تمامًا لضمان خلط المحلول بشكل موحد. ثم ، خذ 10 & # 181L من المحلول من هذا الأنبوب وانقله إلى الأنبوب المميز بعلامة & # 34100x & # 34.
      8. امزج كما هو موضح من قبل وكرر نفس الإجراء عن طريق نقل 10 & # 181L من المحلول من الأنبوب & # 34100x & # 34 إلى الأنبوب & # 341000x & # 34. سيتم استخدام هذه التخفيفات كقالب في تفاعل PCR.


      الشكل 3: عزل الرحلان الكهربائي للهلام الاغاروز من جدنا المعزول من العصوية الرقيقة. المسار 1: م - محدد الكتلة الجزيئية (من أعلى إلى أسفل: 10000 نقطة أساس ، 8000 نقطة أساس ، 6000 نقطة أساس ، 5000 نقطة أساس ، 4000 نقطة أساس ، 3500 نقطة أساس ، 3000 نقطة أساس ، 2500 نقطة أساس ، 2000 نقطة أساس ، 1500 نقطة أساس ، 1000 نقطة أساس). المسار 2: gDNA - الحمض النووي الجيني المعزول من العصوية الرقيقة. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

      1. تضخيم جين 16S rRNA بواسطة PCR
        ملحوظة: تم تحسين بروتوكول PCR أدناه من أجل بوليميريز DNA معين وزوج تمهيدي 8F - 1492R (انظر الجدول 1). مطلوب تحسين البروتوكول لكل زوج من البوليميراز والتمهيدي.
        1. قم بإذابة جميع الكواشف على الجليد.
        2. قم بإعداد مزيج PCR الرئيسي كما هو موضح في الجدول 2. نظرًا لأن بوليميريز الحمض النووي نشط في درجة حرارة الغرفة ، يجب إجراء إعداد التفاعل على الجليد ، بمعنى آخر. يجب الاحتفاظ بأنابيب PCR ومكونات التفاعل على الجليد طوال الوقت. تحضير رد فعل واحد لكل عينة جدنا ورد فعل واحد للسيطرة السلبية. التحكم السلبي هو مزيج PCR بدون قالب gDNA ويستخدم لضمان عدم تلوث المكونات الأخرى للتفاعل.
          ملحوظة: في حالة وجود عينات متعددة ، يتم تحضير مزيج رئيسي بشكل شائع. المزيج الرئيسي عبارة عن محلول يحتوي على جميع مكونات التفاعل باستثناء القالب. فهي تساعد على حذف الماصات المتكررة ، وتجنب أخطاء الماصات ، وتضمن الاتساق العالي بين العينات. لتحضير المزيج الرئيسي ، اضرب حجم كل مكون (باستثناء قالب الحمض النووي) في عدد العينات المختبرة. خلط جميع المكونات في أنبوب microcentrifuge و pipet حجم كامل لأعلى ولأسفل عدة مرات.
        3. قسامة 49 & # 181L من المزيج الرئيسي في أنابيب PCR الفردية.
        4. أضف قالب 1 & # 181L في الأنابيب باستخدام المزيج الرئيسي. للتحكم السلبي أضف 1 & # 181 لتر من الماء المعقم. للتأكد من خلط المكونات جيدًا ، امص الخليط برفق لأعلى ولأسفل

        الجدول 2: مكونات تفاعل PCR. * استخدم 10x أو 100x أو 1000x جدنا المخفف من الخطوة 2.3.

        خطوة درجة حرارة زمن دورات
        الأولي تمسخ 98 & # 176 ج 30 ثانية
        تمسخ 98 & # 176 ج 10 ثوانى 25-30
        التلدين 60 و # 176 ج 30 ثانية
        تمديد 72 # 176 ج 45 ثانية
        التمديد النهائي 72 # 176 ج 7 دقائق
        معلق 4 & # 176 ج

        الجدول 3: برنامج PCR لتضخيم جين 16S rRNA.


        الشكل 4: تم تضخيم الرحلان الكهربائي للهلام Agarose لمنتجات PCR باستخدام البادئات 8F و 1492R و gDNA كقالب. عينة جدنا من B. الرقيقة (انظر الشكل 3) تم تخفيفه 10 و 100 و 1000 مرة من أجل اختبار أفضل نتيجة. المسار 1: م - علامة الكتلة الجزيئية (من أعلى إلى أسفل: 10000 نقطة أساس ، 8000 نقطة أساس ، 6000 نقطة أساس ، 5000 نقطة أساس ، 4000 نقطة أساس ، 3500 نقطة أساس ، 3000 نقطة أساس ، 2500 نقطة أساس ، 2000 نقطة أساس ، 1500 نقطة أساس ، 1000 نقطة أساس ، 750 نقطة أساس ، 500 نقطة أساس ، 250 نقطة أساس ). المسار 2: تفاعل PCR مع قالب مخفف 10x. المسار 3: تفاعل PCR مع قالب مخفف 100x. المسار 4: تفاعل PCR مع قالب مخفف 1000x. المسار 5: (C-) - تحكم سلبي (تفاعل بدون قالب DNA). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

        3. تحليل البيانات والنتائج

        ملحوظة: يتم تسلسل منتج PCR باستخدام البادئات الأمامية (هنا 8F) والعكس (هنا 1492R). لذلك ، يتم إنشاء مجموعتين من تسلسل البيانات ، واحدة للأمام والأخرى للعكس التمهيدي. لكل تسلسل يتم إنشاء نوعين على الأقل من الملفات: 1) ملف نصي يحتوي على تسلسل الحمض النووي و 2) مخطط كروماتوجرافي للحمض النووي ، والذي يوضح جودة تشغيل التسلسل.

        1. بالنسبة إلى التمهيدي الأمامي ، افتح مخطط الكروماتوغرام ، وافحص التسلسل بعناية. يجب أن يحتوي المخطط اللوني المثالي لتسلسل الجودة على قمم متباعدة بشكل متساوٍ وإشارات خلفية قليلة أو معدومة (الشكل 5أ).
        2. إذا لم يكن مخطط الكروماتوجرام عالي الجودة ، فيجب التخلص من التسلسل ، أو يجب مراجعة ملف نص التسلسل وفقًا لما يلي:
          1. يشير وجود قمم مزدوجة في جميع أنحاء الكروماتوجرام إلى وجود العديد من قوالب الحمض النووي. يمكن أن يكون هذا هو الحال إذا لم تكن الثقافة البكتيرية نقية. يجب التخلص من هذا التسلسل (الشكل 5ب).
          2. قد ينشأ مخطط كروماتوغرافي غامض من وجود قمم ملونة مختلفة في نفس الموقع. أحد الأخطاء الأكثر شيوعًا هو وجود قمتين مختلفتين بالألوان في نفس الموضع والتخصيص غير المناسب للقواعد بواسطة برنامج التسلسل (الشكل 5ج). قم يدويًا بتصحيح أي نيوكليوتيدات تم تعيينها بشكل غير صحيح وتحريرها في الملف النصي.
          3. يمكن أن تؤدي مخططات الكروماتوجرام منخفضة الدقة إلى & # 34 ذروة واسعة & # 34 التي تسبب غالبًا حسابًا خاطئًا للنيوكليوتيدات في هذه المناطق (الشكل 5د). يصعب تصحيح هذا الخطأ ، وبالتالي لا ينبغي التعامل مع حالات عدم التطابق المحتملة في خطوة المحاذاة الإضافية على أنها موثوقة.
          4. يُلاحظ ضعف جودة قراءة مخطط الكروماتوجرام ووجود قمم متعددة بشكل شائع في طرفي التسلسل 5 & # 39 و 3 & # 39. تقوم بعض برامج جهاز التسلسل بإزالة هذه الأجزاء منخفضة الجودة تلقائيًا (الشكل 5ه) ، ولم يتم تضمين النيوكليوتيدات في الملف النصي. إذا لم يتم اقتطاع تسلسلك تلقائيًا ، فحدد الأجزاء منخفضة الجودة (على سبيل المثال إشارة ضعيفة ، قمم متداخلة ، فقدان الدقة) في النهايات وإزالة القواعد المعنية من الملف النصي.


          الشكل 5: أمثلة على استكشاف أخطاء تسلسل الحمض النووي وإصلاحها. أ) مثال على تسلسل كروماتوجرام عالي الجودة (قمم متساوية المسافات لا لبس فيها). ب) تسلسل رديء الجودة يحدث عادة في بداية الكروماتوجرام. تعتبر المنطقة الرمادية منخفضة الجودة وتتم إزالتها تلقائيًا بواسطة برنامج التسلسل. يمكن قطع المزيد من القواعد يدويًا. ج) وجود القمم المزدوجة (المشار إليها بالسهام). تمت قراءة النيوكليوتيدات المشار إليها بالسهم الأحمر بواسطة منظم التسلسل كـ & # 34T & # 34 (الذروة الحمراء) ، لكن القمة الزرقاء أقوى ، ويمكن أيضًا تفسيرها على أنها & # 34C & # 34. د) القمم المتداخلة تشير إلى تلوث الحمض النووي (بمعنى آخر. أكثر من قالب واحد). هـ) فقدان الدقة وما يسمى بـ & # 34 قمم واسعة & # 34 (مميزة بالمستطيل) والتي تمنع الاتصال الأساسي الموثوق به. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

          1. كرر 3.1 و 3.2 لعكس التمهيدي.
          2. أخيرًا ، قم بتجميع التسلسلات الأمامية والعكسية في تسلسل واحد متجاور. ينتج عن تشغيل التسلسل الجيد تسلسل يصل إلى 1100 نقطة أساس. بالنظر إلى أن منتج PCR هو

          1. دمج التسلسلين باستخدام برنامج تجميع تسلسل الحمض النووي ، على سبيل المثال أداة مجانية مثل CAP3 (http://doua.prabi.fr/software/cap3) (15).
          2. أدخل التسلسلين بتنسيق FASTA في المربع المشار إليه. انقر فوق الزر & # 34 إرسال & # 34 وانتظر عودة النتائج.
          3. لعرض التسلسل المجمع ، اضغط على & # 34Contigs & # 34 في علامة تبويب النتيجة. لعرض تفاصيل المحاذاة ، اضغط على & # 34 تفاصيل التجميع & # 34.
            ملاحظة 1: إذا تم استخدام برنامج CAP3 للتجميع المتواصل ، فلا داعي لتحويل تسلسل التمهيدي العكسي إلى تكميلي عكسي ، ومع ذلك ، فقد تكون هذه الخطوة مطلوبة في حالة استخدام برنامج آخر.
            ملاحظة 2: تنسيق FASTA هو تنسيق قائم على النص لتمثيل تسلسل النيوكليوتيدات. يبدأ السطر الأول (سطر الوصف) في ملف FASTA بالرمز & # 34 & # 62 & # 34 متبوعًا بالاسم أو المعرف الفريد للتسلسل. يتبع سطر الوصف تسلسل النيوكليوتيدات. الصق التسلسلات بالتنسيق التالي:

          1. حدد أداة & # 34Nucleotide BLAST & # 34 لمقارنة تسلسلك بقاعدة البيانات.
          2. أدخل التسلسل الخاص بك (تم تجميع contig في 3.5) في مربع النص & # 34Query chain & # 34 ، ثم حدد قاعدة البيانات & # 3416S تسلسل rRNA (Bacteria and Archea) & # 34 في قائمة التمرير لأسفل.
          3. اضغط على الزر & # 34BLAST & # 34 أسفل الصفحة. سيتم إرجاع التسلسلات الأكثر تشابهًا. يتم عرض نتيجة BLAST كمثال في الشكل 6. في التجربة المقدمة ، كانت النتيجة الأعلى هي B. الرقيقة سلالة 168 ، تظهر هوية 100 ٪ مع التسلسل المتاح في قاعدة بيانات بلاست.
          4. إذا كانت النتيجة العليا لا تعرض هوية 100٪ ، فانتقل إلى المحاذاة وتحقق من عدم التطابق. عند النقر فوق الضربة العلوية ، سيتم توجيهك إلى تفاصيل المحاذاة. سيتم ربط النيوكليوتيدات المحاذاة بخطوط عمودية قصيرة بينما يوجد فجوة بين النيوكليوتيدات غير المتطابقة. ارجع إلى مخطط الكروماتوغرام الذي تلقيته من شركة التسلسل وراجع التسلسل مرة أخرى مع التركيز على المنطقة غير المتطابقة. قم بتصحيح التسلسل إذا تم العثور على أي أخطاء إضافية. قم بتشغيل BLAST مرة أخرى باستخدام التسلسل المصحح.


          الشكل 6: مثال على نتيجة بلاست النيوكليوتيدات. تسلسل الجينات الرنا الريباسي 16S من ثقافة نقية B. الرقيقة تم استخدام 168 كتسلسل استعلام. تُظهر النتيجة الأعلى هوية 100٪ (تحتها خط) إلى B. الرقيقة سلالة 168 ، كما هو متوقع. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

          الأرض هي موطن لملايين الأنواع البكتيرية ، ولكل منها خصائص فريدة. تحديد هذه الأنواع أمر بالغ الأهمية في تقييم العينات البيئية. يحتاج الأطباء أيضًا إلى التمييز بين الأنواع البكتيرية المختلفة لتشخيص المرضى المصابين.

          لتحديد البكتيريا ، يمكن استخدام مجموعة متنوعة من التقنيات ، بما في ذلك المراقبة المجهرية للتشكل أو النمو على وسائط معينة لمراقبة مورفولوجيا المستعمرة. نمت شعبية التحليل الجيني ، وهي تقنية أخرى لتحديد البكتيريا ، في السنوات الأخيرة ، ويرجع ذلك جزئيًا إلى تسلسل جينات RNA الريبوزومي 16S.

          الريبوسوم البكتيري عبارة عن مركب بروتيني RNA يتكون من وحدتين فرعيتين. تحتوي الوحدة الفرعية 30S ، الأصغر من هاتين الوحدتين الفرعيتين ، على 16S rRNA ، والذي يتم ترميزه بواسطة جين 16S rRNA الموجود في الحمض النووي الجيني. يتم الحفاظ على مناطق معينة من الرنا الريباسي 16S بشكل كبير ، بسبب وظيفتها الأساسية في تجميع الريبوسوم. في حين أن المناطق الأخرى ، الأقل أهمية في العمل ، قد تختلف بين الأنواع البكتيرية. يمكن أن تكون المناطق المتغيرة في 16S rRNA بمثابة بصمات جزيئية فريدة للأنواع البكتيرية ، مما يسمح لنا بتمييز السلالات المتطابقة ظاهريًا.

          بعد الحصول على عينة جودة من جدنا ، يمكن أن يبدأ تفاعل البلمرة المتسلسل لجين ترميز الرنا الريباسي 16S. PCR هي طريقة بيولوجيا جزيئية شائعة الاستخدام ، وتتكون من دورات تمسخ لقالب الحمض النووي مزدوج الشريطة ، وتصلب أزواج التمهيدي العالمية ، والتي تضخّم المناطق المحفوظة للغاية من الجين ، وتمديد البادئات بواسطة بوليميراز الحمض النووي. بينما تعمل بعض البادئات على تضخيم معظم جين تشفير الرنا الريباسي 16S ، فإن البعض الآخر يضخم أجزاء منه فقط. بعد تفاعل البوليميراز المتسلسل ، يمكن تحليل المنتجات عن طريق الاغاروز الكهربائي للهلام. إذا كان التضخيم ناجحًا ، يجب أن يحتوي الجل على نطاق واحد بالحجم المتوقع ، اعتمادًا على زوج التمهيدي المستخدم ، حتى 1500 نقطة أساس ، الطول التقريبي لجين الرنا الريباسي 16S.

          After purification and sequencing, the obtained sequences can then be entered into the BLAST database, where they can be compared with reference 16S rRNA sequences. As this database returns matches based on the highest similarity, this allows confirmation of the identity of the bacteria of interest. In this video, you will observe 16S rRNA gene sequencing, including PCR, DNA sequence analysis and editing, sequence assembly and database searching.

          When handling microorganisms, it is essential to follow good microbiological practice, including using aseptic technique and wearing appropriate personal protective equipment. After performing an appropriate risk assessment for the microorganism or environmental sample of interest, obtain a test culture. In this example, a pure culture of العصوية الرقيقة يستخدم.

          To begin, grow your microorganism on a suitable medium in the appropriate conditions. In this example, العصوية الرقيقة 168 is grown in LB broth overnight in a shaking incubator set to 200 rpm at 37 degrees Celsius. Next, use a commercially available kit to isolate genomic DNA or gDNA from 1.5 milliliters of the B. subtilis overnight culture.

          To check the quality of the isolated DNA, first mix five microliters of the isolated gDNA with one microliter of DNA gel loading dye. Then, load the sample onto a 0.8% agarose gel, containing DNA staining reagent, such as SYBR safe or EtBr. After this, load a one kilobase molecular mass standard onto the gel, and run the electrophoresis until the front dye is approximately 0.5 centimeters from the bottom of the gel. Once the gel electrophoresis is complete, visualize the gel on a blue light transilluminator. The gDNA should appear as a thick band, above 10 kilobase in size and have minimal smearing.

          After this, to create serial dilutions of the gDNA, label three microcentrifuge tubes as 10X, 100X, and 1000X. Then, use a pipette to dispense 90 microliters of sterile distilled water into each of the tubes. Next, add 10 microliters of the gDNA solution to the 10X tube. Pipette the whole volume up and down to ensure the solution is mixed thoroughly. Then, remove 10 microliters of the solution from the 10X tube and transfer this to the 100X tube. Mix the solution as previously described. Finally, transfer 10 microliters of the solution in the 100X tube, to the 1000X tube.

          To begin the PCR protocol, thaw the necessary reagents on ice. Then, prepare the PCR master mix. Since the DNA polymerase is active at room temperature, the reaction set up must occur on ice. Aliquot 49 microliters of the master mix into each of the PCR tubes. Then, add one microliter of template to each of the experimental tubes and one microliter of sterile water to the negative control tube, pipetting up and down to mix. After this, set the PCR machine according to the program described in the table. Place the tubes into the thermocycler and start the program.

          Once the program is complete, examine the quality of your product via agarose gel electrophoresis, as previously demonstrated. A successful reaction using the described protocol should yield a single band of approximately 1.5 kilobase. In this example, the sample containing 100X diluted gDNA yielded the highest quality product. Next, purify the best PCR product, in this case, the 100X gDNA, with a commercially available kit. Now the PCR product can be sent for sequencing.

          In this example, the PCR product is sequenced using forward and reverse primers. Thus, two data sets, each containing a DNA sequence and a DNA chromatogram, are generated: one for the forward primer and the other for the reverse primer. First, examine the chromatograms generated from each primer. An ideal chromatogram should have evenly spaced peaks with little to no background signals.

          If the chromatograms display double peaks, multiple DNA templates may have been present in the PCR products and the sequence should be discarded. If the chromatograms contained peaks of different colors in the same location, the sequencing software likely miscalled nucleotides. This error can be manually identified and corrected in the text file. The presence of broad peaks in the chromatogram indicates a loss of resolution, which causes miscounting of the nucleotides in the associated regions. This error is difficult to correct and mismatches in any of the subsequent steps should be treated as unreliable. Poor chromatogram reading quality, indicated by the presence of multiple peaks, usually occurs at the five prime and three prime ends of the sequence. Some sequencing programs remove these low quality sections automatically. If your sequence was not truncated automatically, identify the low quality fragments and remove their respective bases from the text file.

          Use a DNA assembly program to assemble the two primer sequences into one continuous sequence. Remember, sequences obtained using forward and reverse primers should partially overlap. In the DNA assembly program, insert the two sequences in FASTA format into the appropriate box. Then, click the submit button and wait for the program to return the results.

          To view the assembled sequence, click on Contigs in the results tab. Then, to view the details of the alignment, select assembly details. Navigate to the website for the basic local alignment search tool, or BLAST, and select the nucleotide BLAST tool to compare your sequence to the database. Enter your sequence into the query sequence text box and select the appropriate database in the scroll down menu. Finally, click the BLAST button on the bottom of the page, and wait for the tool to return the most similar sequences from the database.

          In this example, the top hit is B. subtilis strain 168, showing 100% identity with the sequence in the BLAST database. If the top hit does not show 100% identity to your expected species or strain, click on the sequence which most closely matches your query to see the details of the alignment. Aligned nucleotides will be joined by short vertical lines and mismatched nucleotides will have gaps between them. Focusing on the identified mismatched regions, revise the sequence and repeat the BLAST search if desired.

          الاشتراك المطلوبة. يرجى التوصية بـ JoVE لأمين المكتبة الخاص بك.

          التطبيقات والملخص

          Identifying bacterial species is important for different researchers, as well as for those in healthcare. 16S rRNA sequencing was initially used by researchers to determine phylogenetic relationships between bacteria. In time, it has been implemented in metagenomic studies to determine biodiversity of environmental samples and in clinical laboratories as a method to identify potential pathogens. It enables a quick and accurate identification of bacteria present in clinical samples, facilitating earlier diagnosis and faster treatment of patients.

          الاشتراك المطلوبة. يرجى التوصية بـ JoVE لأمين المكتبة الخاص بك.

          مراجع

          1. Weisburg, W.G., Barns, S.M., Pelletier, D.A. and Lane D.J. 16S ribosomal DNA amplification for phylogenetic study. J باكتيريول.173 (2): 697-703. (1991)
          2. Drancourt, M., Bollet, C., Carlioz, A., Martelin, R., Gayral, J.P., Raoult D. 16S ribosomal DNA sequence analysis of a large collection of environmental and clinical unidentifiable bacterial isolates. ياء كلين ميكروبيول.38 (10):3623-3630. (2000)
          3. Woo, P.C., Lau, S.K., Teng, J.L., Tse, H., Yuen, K.Y. Then and now: use of 16S rDNA gene sequencing for bacterial identification and discovery of novel bacteria in clinical microbiology laboratories. Clin Microbiol Infect.14 (10):908-934. (2008)
          4. Tang, Y.W., Ellis, N.M., Hopkins, M.K., Smith, D.H., Dodge, D.E., Persing, D.H. Comparison of phenotypic and genotypic techniques for identification of unusual aerobic pathogenic gram-negative bacilli. ياء كلين ميكروبيول.36 (12):3674-3679. (1998)
          5. Tsiboli, P., Herfurth, E., Choli, T. Purification and characterization of the 30S ribosomal proteins from the bacterium Thermus thermophilus. Eur J Biochem.226 (1):169-177. (1994)
          6. Woese, C.R. Bacterial evolution. Microbiol Rev.51 (2):221-271. (1987)
          7. Bartlett, J.M., Stirling, D. A short history of the polymerase chain reaction. Methods Mol Biol.226:3-6. (2003)
          8. Wilson, K.H., Blitchington, R.B., Greene, R.C. Amplification of bacterial 16S ribosomal DNA with polymerase chain reaction. ياء كلين ميكروبيول.28 (9):1942-1946. (1990)
          9. Shendure, J., Balasubramanian, S., Church, G.M., Gilbert, W., Rogers, J., Schloss, J.A., Waterston, R.H. (2017) DNA sequencing at 40: past, present and future. طبيعة سجية.550:345-353.
          10. Lane, D.J. 16S/23S rRNA sequencing. (1991) In Nucleic acid techniques in bacterial systematics. (Goodfellow, M. and Stackebrandt, E., eds.) p.115-175. Wiley and Sons, Chichester, United Kingdom.
          11. Turner, S., Pryer, K.M., Miao, V.P., Palmer, J.D. (1999) Investigating deep phylogenetic relationships among cyanobacteria and plastids by small subunit rRNA sequence analysis. J Eukaryot Microbiol.46:327-338.
          12. Fredricks, D.N., Relman, D.A. (1998) Improved amplification of microbial DNA from blood cultures by removal of the PCR inhibitor sodium polyanetholesulfonate. ياء كلين ميكروبيول.36:2810-2816.
          13. Wilson, K. Preparation of genomic DNA from bacteria. (2001) Curr Protoc Mol Biol. Chapter 2:Unit 2.4.
          14. Wright, M. H., Adelskov, J., Greene, A.C. (2017) Bacterial DNA extraction using individual enzymes and phenol/chloroform separation. J Microbiol Biol Educ.18:18.2.48.
          15. Huang, X., Madan, A. (1999). CAP3: A DNA sequence assembly program. الدقة الجينوم.9:868-877.

          كشف الدرجات

          Earth is home to millions of bacterial species, each with unique characteristics. Identifying these species is critical in evaluating environmental samples. Doctors also need to distinguish different bacterial species to diagnose infected patients.

          To identify bacteria, a variety of techniques can be employed, including microscopic observation of morphology or growth on a specific media to observe colony morphology. Genetic analysis, another technique for identifying bacteria has grown in popularity in recent years, due in part to 16S ribosomal RNA gene sequencing.

          The bacterial ribosome is a protein RNA complex consisting of two subunits. The 30S subunit, the smaller of these two subunits, contains 16S rRNA, which is encoded by the 16S rRNA gene contained within the genomic DNA. Specific regions of 16S rRNA are highly conserved, due to their essential function in ribosome assembly. While other regions, less critical to function, may vary among bacterial species. The variable regions in 16S rRNA, can serve as unique molecular fingerprints for bacterial species, allowing us to distinguish phenotypically identical strains.

          After obtaining a quality sample of gDNA, PCR of the 16S rRNA encoding gene can begin. PCR is a commonly used molecular biology method, consisting of cycles of denaturation of the double-stranded DNA template, annealing of universal primer pairs, which amplify highly conserved regions of the gene, and the extension of primers by DNA polymerase. While some primers amplify most of the 16S rRNA encoding gene, others only amplify fragments of it. After PCR, the products can be analyzed via agarose gel electrophoresis. If amplification was successful, the gel should contain a single band of an expected size, depending upon the primer pair used, up to 1500bp, the approximate length of the 16S rRNA gene.

          After purification and sequencing, the obtained sequences can then be entered into the BLAST database, where they can be compared with reference 16S rRNA sequences. As this database returns matches based on the highest similarity, this allows confirmation of the identity of the bacteria of interest. In this video, you will observe 16S rRNA gene sequencing, including PCR, DNA sequence analysis and editing, sequence assembly and database searching.

          When handling microorganisms, it is essential to follow good microbiological practice, including using aseptic technique and wearing appropriate personal protective equipment. After performing an appropriate risk assessment for the microorganism or environmental sample of interest, obtain a test culture. In this example, a pure culture of Bacillus subtilis is used.

          To begin, grow your microorganism on a suitable medium in the appropriate conditions. In this example, Bacillus subtilis 168 is grown in LB broth overnight in a shaking incubator set to 200 rpm at 37 degrees Celsius. Next, use a commercially available kit to isolate genomic DNA or gDNA from 1.5 milliliters of the B. subtilis overnight culture.

          To check the quality of the isolated DNA, first mix five microliters of the isolated gDNA with one microliter of DNA gel loading dye. Then, load the sample onto a 0.8% agarose gel, containing DNA staining reagent, such as SYBR safe or EtBr. After this, load a one kilobase molecular mass standard onto the gel, and run the electrophoresis until the front dye is approximately 0.5 centimeters from the bottom of the gel. Once the gel electrophoresis is complete, visualize the gel on a blue light transilluminator. The gDNA should appear as a thick band, above 10 kilobase in size and have minimal smearing.

          After this, to create serial dilutions of the gDNA, label three microcentrifuge tubes as 10X, 100X, and 1000X. Then, use a pipette to dispense 90 microliters of sterile distilled water into each of the tubes. Next, add 10 microliters of the gDNA solution to the 10X tube. Pipette the whole volume up and down to ensure the solution is mixed thoroughly. Then, remove 10 microliters of the solution from the 10X tube and transfer this to the 100X tube. Mix the solution as previously described. Finally, transfer 10 microliters of the solution in the 100X tube, to the 1000X tube.

          To begin the PCR protocol, thaw the necessary reagents on ice. Then, prepare the PCR master mix. Since the DNA polymerase is active at room temperature, the reaction set up must occur on ice. Aliquot 49 microliters of the master mix into each of the PCR tubes. Then, add one microliter of template to each of the experimental tubes and one microliter of sterile water to the negative control tube, pipetting up and down to mix. After this, set the PCR machine according to the program described in the table. Place the tubes into the thermocycler and start the program.

          Once the program is complete, examine the quality of your product via agarose gel electrophoresis, as previously demonstrated. A successful reaction using the described protocol should yield a single band of approximately 1.5 kilobase. In this example, the sample containing 100X diluted gDNA yielded the highest quality product. Next, purify the best PCR product, in this case, the 100X gDNA, with a commercially available kit. Now the PCR product can be sent for sequencing.

          In this example, the PCR product is sequenced using forward and reverse primers. Thus, two data sets, each containing a DNA sequence and a DNA chromatogram, are generated: one for the forward primer and the other for the reverse primer. First, examine the chromatograms generated from each primer. An ideal chromatogram should have evenly spaced peaks with little to no background signals.

          If the chromatograms display double peaks, multiple DNA templates may have been present in the PCR products and the sequence should be discarded. If the chromatograms contained peaks of different colors in the same location, the sequencing software likely miscalled nucleotides. This error can be manually identified and corrected in the text file. The presence of broad peaks in the chromatogram indicates a loss of resolution, which causes miscounting of the nucleotides in the associated regions. This error is difficult to correct and mismatches in any of the subsequent steps should be treated as unreliable. Poor chromatogram reading quality, indicated by the presence of multiple peaks, usually occurs at the five prime and three prime ends of the sequence. Some sequencing programs remove these low quality sections automatically. If your sequence was not truncated automatically, identify the low quality fragments and remove their respective bases from the text file.

          Use a DNA assembly program to assemble the two primer sequences into one continuous sequence. Remember, sequences obtained using forward and reverse primers should partially overlap. In the DNA assembly program, insert the two sequences in FASTA format into the appropriate box. Then, click the submit button and wait for the program to return the results.

          To view the assembled sequence, click on Contigs in the results tab. Then, to view the details of the alignment, select assembly details. Navigate to the website for the basic local alignment search tool, or BLAST, and select the nucleotide BLAST tool to compare your sequence to the database. Enter your sequence into the query sequence text box and select the appropriate database in the scroll down menu. Finally, click the BLAST button on the bottom of the page, and wait for the tool to return the most similar sequences from the database.

          In this example, the top hit is B. subtilis strain 168, showing 100% identity with the sequence in the BLAST database. If the top hit does not show 100% identity to your expected species or strain, click on the sequence which most closely matches your query to see the details of the alignment. Aligned nucleotides will be joined by short vertical lines and mismatched nucleotides will have gaps between them. Focusing on the identified mismatched regions, revise the sequence and repeat the BLAST search if desired.


          Sequencing and Genomic Technologies

          The Sequencing and Genomic Technologies Core Facility has purchased an Oxford Nanopore GridION sequencer and will start offering Oxford Nanopore sequencing services in the coming months.

          January 8, 2021

          The Sequencing and Genomic Technologies Core now offers single-cell multi-omics assays on the Tapestri Platform. This innovative platform analyzes genotype and phenotype simultaneously from the same single cells, which lets you reveal clonal heterogeneity and target comprehensive biomarkers.

          November 16, 2020

          COVID-19: The COVID-19 pandemic is generating various supply chain issues for lab consumables, such as tips, 96-well plates and more recently, Illumina sequencing reagents (NovaSeq S-Prime flow cells, in particular). As a consequence, the turnaround time for some of our sequencing services may be impacted. We are doing our best to secure necessary supplies, and we thank you for your patience during these difficult times.

          Reminder, the lab is located at
          Duke Center for Genomic and Computational Biology
          جامعة ديوك
          Chesterfield Bldg.
          701 W. Main Street
          Suite 320
          Durham NC 27701

          Next-Generation Sequencing Solutions
          Illumina, PacBio, NGS Library preparation including single-cell RNA-seq

          The Sequencing and Genomic Technologies Shared Resource is a basic research oriented core facility affiliated with the Duke Cancer Institute (DCI). This Shared Resource has a track record more than a decade-long of providing constantly updated, state-of-the-art genomic services. The Sequencing and Genomic Technologies Shared Resource offers the full range of genomic technologies, making it much simpler for researchers to find the right service for their needs.

          Director Nicolas Devos is available for face-to-face project consultations on campus in the CIEMAS building or at our new facility.

          PUBLICATION ACKNOWLEDGEMENT

          For all publications that include data generated in the Sequencing and Genomic Technologies Shared Resource, we kindly request that you acknowledge this support:

          We thank the Duke University School of Medicine for the use of the Sequencing and Genomic Technologies Shared Resource, which provided _________ service.


          What are PCR Primers?

          Polymerase Chain Reaction (PCR) is a genetic technique that is utilized in the field of molecular biology in order to amplify a single or few copies of a particular DNA segment and to obtain many millions of identical copies. In a PCR reaction, different components are used including primers. Primers are short DNA strands with a nucleotide length of 18-25 making them compatible with the start and the end region of the DNA fragments to be amplified. Primers can be a forward primer and reverse primer. These primers bind to the DNA fragment at the specific points where it makes DNA polymerase to bind to the specific primer at the location and initiate the synthesis of the new DNA strand.

          The selection of primers is an important aspect of PCR process. The selection of the length of the primer is important. The ideal length would be 18-25 nucleotides. If the length is too short or too long, the primers will not bind to the DNA sequence to be amplified accurately. Primers that are too short in length leads to non-specific primer annealing at different locations of the DNA sequence.

          Figure 01: PCR Primers

          The Guanine and Cytosine (GC) content in a good primer should be in the range of 40-60. The primer annealing temperature and melting temperature are vital factors during PCR. The melting temperature should be calculated accurately, and the primer annealing temperature should be 5 0 C less than the melting temperature. The melting temperature should be 60 °C and 75 °C. Too high or too low temperatures will result in less active DNA polymerase activity.


          What is the PCR process?

          Step 1: Denaturation

          As in DNA replication, the two strands in the DNA double helix need to be separated.

          The separation happens by raising the temperature of the mixture, causing the hydrogen bonds between the complementary DNA strands to break. This process is called denaturation.

          Step 2: Annealing

          Primers bind to the target DNA sequences and initiate polymerisation. This can only occur once the temperature of the solution has been lowered. One primer binds to each strand.

          Step 3: Extension

          New strands of DNA are made using the original strands as templates. A DNA polymerase enzyme joins free DNA nucleotides together. This enzyme is often Taq polymerase, an enzyme originally isolated from a thermophilic bacteria called Thermus aquaticus. The order in which the free nucleotides are added is determined by the sequence of nucleotides in the original (template) DNA strand.

          The result of one cycle of PCR is two double-stranded sequences of target DNA, each containing one newly made strand and one original strand.

          The cycle is repeated many times (usually 20–30) as most processes using PCR need large quantities of DNA. It only takes 2–3 hours to get a billion or so copies.

          PCR technology is still developing. There is continuing development and refinement of the processes and tools used, allowing the process to be adapted to meet specialist needs. For instance, new methods and refinements are being developed and used, especially when quantification of DNA in a sample is needed. New methods include real-time PCR or quantitative PCR (qPCR) and digital PCR (dPCR). In qPCR, the amplification of DNA is monitored in real time, allowing the quantification of target DNA throughout the process. dPCR is a new, more refined approach that breaks the PCR process up into many smaller steps. It offers increased precision, more reliable measurements and absolute quantification from very small or mixed samples.


          شاهد الفيديو: تسلسل الأنبياء والرسل بالشكل الصحيح من آدم إلى محمد ﷺ وصلة القرابة بينهم (أغسطس 2022).