معلومة

تأكيد خلط exon في الجين


أحاول أن أؤكد أن تسلسل الجين الجديد مشتق من خلط exon بين عدة جينات مختلفة. لدي تسلسل المروج ، تسلسل الجينات ، و mRNA (مع حدود exon / مقدمة محددة). لقد حاولت إجراء العديد من عمليات البحث في قاعدة البيانات باستخدام التسلسلات ، ولكن كل بحث ينتج مجموعة من الزيارات المختلفة غير ذات الصلة. كيف يمكن للمرء أن يستخدم هذه المعلومات لتأكيد فرضية خلط exon؟ هي موضع تقدير أي نصائح. شكرا!


ليس من الواضح ما هو "العديد من عمليات البحث في قاعدة البيانات مع التسلسلات". الحل الأكثر وضوحًا هو تفجير التسلسل الخاص بك حتى تتمكن من معرفة الجزء الذي لا يمكن محاذاته ثم تفجير الباقي. يمكنك اختيار تطبيقات مختلفة (megablast of blastn) واللعب باستخدام معلمات الخوارزمية لأنها قد لا تعمل من أجلك كما هي. لكنها ستعمل كما هي إذا قمت بتفجير exons بشكل منفصل. بهذه الطريقة يمكنك تحديد جينات المنشأ.


تؤكد الدراسات الحديثة حول جينومات الطلائعيات والنباتات والفطريات والحيوانات أن الزيادة في حجم الجينوم وعدد الجينات في سلالات مختلفة حقيقية النواة يتوازى مع انخفاض عام في انضغاط الجينوم وزيادة في عدد وحجم الإنترونات. وبالتالي يمكن التنبؤ بأن خلط exon أصبح ذا أهمية متزايدة مع تطور جينومات أكبر وأقل إحكاما. لاختبار صحة هذا التنبؤ ، قمنا بتحليل التوزيع التطوري للبروتينات المعيارية التي تطورت بشكل واضح عن طريق إعادة التركيب الداخلي. تشير نتائج هذا التحليل إلى أن البروتينات المعيارية متعددة المجالات التي تنتجها exon-shuffling مقيدة في توزيعها التطوري. على الرغم من وجود هذه البروتينات في جميع المجموعات الرئيسية للميتازوا من الإسفنج إلى الحبليات ، فلا يوجد عمليًا أي دليل على وجود بروتينات معيارية ذات صلة في مجموعات أخرى من حقيقيات النوى. أفضل تقدير للأهمية البيولوجية لهذا الاختلاف في تكوين البروتينات للحيوانات والفطريات والنباتات والطلائعيات عندما يتم تصنيف هذه البروتينات المعيارية فيما يتعلق بوظائفها البيولوجية. يمكن تخصيص غالبية هذه البروتينات لفئات وظيفية مرتبطة ارتباطًا وثيقًا بتعدد الخلايا للحيوانات ، ولها أهمية مطلقة في السماح للحيوانات بالعمل بطريقة متكاملة: مكونات المصفوفة خارج الخلية ، والبروتياز المشاركة في عمليات إعادة تشكيل الأنسجة ، والبروتينات المختلفة سوائل الجسم ، والبروتينات المرتبطة بالغشاء التي تتوسط تفاعلات الخلية والخلية والمصفوفة ، وبروتينات المستقبل المرتبطة بالغشاء التي تنظم الاتصالات بين الخلية والخلية ، وما إلى ذلك. على الرغم من أن بعض الأنواع الأساسية من البروتينات المعيارية تبدو مشتركة بين جميع المجموعات الرئيسية للميتازوا ، فهناك أيضًا مجموعات من البروتينات المعيارية التي يبدو أنها مقتصرة على سلالات تطورية معينة.

باختصار ، تشير النتائج إلى أن خلط exon-shuffling اكتسب أهمية كبيرة في وقت إشعاع الميتازوان. من المثير للاهتمام أن نلاحظ أن صعود exon-shuffling يتزامن مع انفجار مذهل للإبداع التطوري: الانفجار الكبير للإشعاع metazoan. يبدو من المحتمل أن تطور البروتين المعياري عن طريق خلط exon قد ساهم بشكل كبير في هذا التطور المتسارع للميتازوا ، لأنه سهل البناء السريع للبروتينات متعددة المجالات خارج الخلية وسطح الخلية التي لا غنى عنها لتعدد الخلايا.


ملخص منظم

المقدمة

كيف تتطور بنى البروتين الجديدة لا تزال غير مفهومة. تعد إعادة ترتيب المجالات ذات الوظائف الموجودة مسبقًا في بنى مركبة جديدة من خلال خلط exon مسارًا قويًا لتكوين جينات ترميز البروتينات بوظائف جديدة. على الرغم من أنه يُعتقد أن خلط exon هو المسؤول عن تطور العديد من هياكل البروتين ، إلا أنه نادرًا ما تم تحديد مصدر exons ومواقع لصق جديدة بالإضافة إلى الآليات التي يتم استيعابها من خلالها. في هذا العمل ، نحقق في مساهمة الينقولات DNA في تكوين جينات جديدة لترميز البروتين من خلال خلط exon أثناء تطور الفقاريات.

المبرر

ترانسبوزونات الدنا هي عناصر متنقلة واسعة الانتشار تقوم بترميز بروتينات الترانسبوزيز التي تعزز تكاثرها الأناني في جينومات العائل. تحتوي Transposases عادةً على نطاقات ربط DNA وحفازة ، والتي يمكن إعادة توجيهها للوظائف الخلوية. من خلال إدخال مجالات وظيفية في سياقات جينومية جديدة ، يمكن لتسلسلات ترانسبوزيز أن تولد جينات انصهار مضيف-ترانسبوسيز (HTF) من خلال التضفير البديل. العديد من الجينات ذات الوظائف التنموية الهامة ، مثل باكس يُعتقد أن عوامل النسخ قد ولدت من خلال هذه العملية. ومع ذلك ، فإن الآلية التي يتم من خلالها التقاط مجالات transposase لتوليد HTFs ، ومدى شيوع هذه العملية ، ووظائف معظم جينات HTF المعروفة تظل غير واضحة.

النتائج

استخدمنا علم الجينوم المقارن لمسح جميع جينومات رباعي الأرجل بنماذج الجينات المتاحة (596) لـ HTFs المفترضة. حددنا 106 HTFs مميزة مستمدة من 94 حدث اندماج مستقل على مدار

300 مليون سنة من التطور. وجدنا أن معظم HTFs تطورت من خلال التضفير البديل لمجالات المضيف لنقل البروتينات باستخدام مواقع لصق التي يوفرها الينقولات. تتطور مجالات ترانسبوزيز لجميع HTFs التي تم تحليلها (81) في ظل اختيار مطهر ، مما يشير إلى أنه تم الحفاظ عليها لوظيفة الكائن الحي. يشير تكوين المجال لبروتينات HTF إلى أن معظمها يتكون من نطاقات ربط DNA transposase مدمجة في المجالات المضيفة التي يُتوقع أن تعمل في تنظيم النسخ و / أو الكروماتين ، خاصةً المجال القمعي المرتبط بـ Krüppel (KRAB) (متورط في

30٪ من جميع HTFs) ، مما يشير إلى أن العديد من HTFs تعمل كمنظمين للنسخ. دعمًا لهذه الفرضية ، أظهرنا أن أربعة بروتينات انصهار KRAB-transposase تم تطويرها بشكل مستقل تقوم بقمع التعبير الجيني بطريقة محددة التسلسل في فحوصات المراسل. علاوة على ذلك ، كشفت تجارب فقدان الوظيفة والإنقاذ والجينوم التنظيمي في خلايا الخفافيش أن بروتين الاندماج KRABINER الخاص بالخفافيش يربط مئات من الترانسبوزونات على نطاق الجينوم ويتحكم في شبكة كبيرة من الجينات والعناصر المنظمة لرابطة الدول المستقلة.

استنتاج

تؤكد النتائج التي توصلنا إليها أن خلط exon هو قوة تطورية رئيسية تولد الجدة الجينية. نحن نقدم دليلًا على أن الينقولات DNA تعزز خلط exon عن طريق إدخال مجالات transposase في سياقات جينومية جديدة. توفر هذه العملية مسارًا معقولًا لظهور العديد من عوامل النسخ القديمة ذات الوظائف التنموية الهامة. من خلال توضيح كيف يمكن لعامل النسخ ومواقع الارتباط المتفرقة أن ينبثق في وقت واحد من عائلة الينقولات المفردة ، فإن نتائجنا تدعم وجهة النظر القائلة بأن الينقولات تلعب دورًا رئيسيًا في تطور شبكات تنظيم الجينات.

(أ) نموذج لكيفية حدوث التقاط transposase. (ب) وفرة وخصائص HTFs المحددة. (ج) ملخص لدور كرابينر كعامل نسخ (TF) في خلايا الخفافيش. TE ، عنصر tpase القابل للنقل ، DBDs transposase ، مجالات ربط الحمض النووي KO ، الضربة القاضية ChIP-seq ، تسلسل الكروماتين المناعي تسلسل PRO-seq ، تسلسل تشغيل دقيق TRE ، عنصر تنظيمي مكتوب.


مراجع

كابيتونوف ، ف. & amp Jurka، J. الينقولات الدائرة المتدحرجة في حقيقيات النوى. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 98, 8714–8719 (2001).

بولتر ، آر تي ، جودوين ، تي جيه. & أمبير بتلر ، M.I. helentrons الفقاريات ورواية أخرى الهليترونات . الجين 313, 201–212 (2003).

Lal، S.K.، Giroux، M.J.، Brendel، V.، Vallejos، CE & amp Hannah، L. يحتوي جينوم الذرة على أ هيليترون إدراج. الخلية النباتية 15, 381–391 (2003).

Fu، H. & amp Dooner، H.K. انتهاك غير محدد للعلاقة الخطية الوراثية وآثارها في الذرة. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 99, 9573–9578 (2002).

Song، R. & amp Messing، J. تعبير الجين لعائلة الجينات في الذرة على أساس أنماط الفردانية noncollinear. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 100, 9055–9060 (2003).

Brunner، S.، Fengler، K.، Morgante، M.، Tingey، S. & amp Rafalski، A. تطور تسلسل DNA nonhomologies بين سلالات الذرة. الخلية النباتية 17, 343–360 (2005).

Meyers، BC، Scalabrin، S. & amp Morgante، M. رسم الخرائط وتسلسل الجينومات المعقدة: دعنا نحصل على مادي! نات. القس جينيه. 5, 578–588 (2004).

جاردينر ، جيه وآخرون. ترسيخ 9371 ذرة تسلسل معبرًا عن تسلسل unigenes إلى خريطة كونتيج كروموسوم اصطناعية بكتيرية بواسطة تهجين مفرط ثنائي الأبعاد. نبات فيزيول. 134, 1317–1326 (2004).

Bennetzen، J.L.، Coleman، C.، Liu، R.، Ma، J. & amp Ramakrishna، W. التقدير المفرط المستمر لعدد الجينات في جينومات النبات المعقدة. بالعملة. رأي. مصنع بيول. 7, 732–736 (2004).

بالمر ، ل. وآخرون. تسلسل جينوم الذرة عن طريق الترشيح المثيلة. علم 302, 2115–2117 (2003).

العبث ، J. et al. تكوين التسلسل وتنظيم الجينوم للذرة. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 101, 14349–14354 (2004).

Ramakrishna، W.، Emberton، J.، Ogden، M.، SanMiguel، P. & amp Bennetzen، J.L. التحليل الهيكلي لمجمع الذرة rp1 يكشف عن العديد من المواقع والآليات غير المتوقعة لإعادة الترتيب المحلي. الخلية النباتية 14, 3213–3223 (2002).

كريج ، إن إل ، كريجي ، آر ، جيليرت ، إم آند لامبوويتز ، إيه إم. الحمض النووي المتنقل II (مطبعة الجمعية الأمريكية لعلم الأحياء الدقيقة ، واشنطن العاصمة ، 2002).

جوبتا ، إس ، جالافوتي ، أ ، سترايكر ، ج.أ ، شميدت ، آر جيه. & amp Lal، S.K. فئة رواية هيليترون- العناصر القابلة للنقل ذات الصلة في الذرة تحتوي على أجزاء من عدة جينات خادعة. مصنع مول. بيول. 57, 115–127 (2005).

Feschotte، C. & amp Wessler، S.R. كنوز في العلية: ينقولات دائرية متدحرجة اكتشفت في جينومات حقيقية النواة. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 98, 8923–8924 (2001).

Kynast ، R.G. وآخرون. مجموعة كاملة من إضافات كروموسوم الذرة الفردية إلى جينوم الشوفان. نبات فيزيول. 125, 1216–1227 (2001).

Okagaki ، R.J. وآخرون. تعيين تسلسل الذرة إلى الكروموسومات باستخدام مواد إضافة كروموسوم الذرة الشوفان. نبات فيزيول. 125, 1228–1235 (2001).

Song ، R. ، Llaca ، V. & amp Messing ، J. تنظيم فسيفساء للتسلسلات المتعامدة في جينومات العشب. الدقة الجينوم. 12, 1549–1555 (2002).

لاي ، ج. وآخرون. فقدان الجينات والحركة في جينوم الذرة. الدقة الجينوم. 14, 1924–1931 (2004).

Swigonova، Z.، Bennetzen، J.L. & amp Messing، J. هيكل وتطور مناطق الكروموسومات r / b في الأرز والذرة والذرة الرفيعة. علم الوراثة 169, 891–906 (2005).

Ilic، K.، SanMiguel، P.J. & amp Bennetzen، J.L. تاريخ معقد لإعادة الترتيب في منطقة متعامدة من الذرة والذرة الرفيعة وجينوم الأرز. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 100, 12265–12270 (2003).

هاملتون ، أ. & amp Baulcombe، D. علم 286, 950–952 (1999).

فان دير كرول ، A.R. ، Mur ، L.A. ، Beld ، M. ، Mol ، J.N. & amp Stuitje، A.R. جينات الفلافونويد في البطونية: قد تؤدي إضافة عدد محدود من نسخ الجينات إلى قمع التعبير الجيني. الخلية النباتية 2, 291–299 (1990).

Duvick ، ​​D.N. التكنولوجيا الحيوية في الثلاثينيات: تطوير الذرة المهجنة. نات. القس جينيه. 2, 69–74 (2001).

بيرشلر ، ج.أ ، أوجيه ، د. & amp Riddle، NC بحثًا عن الأساس الجزيئي للتغاير. الخلية النباتية 15, 2236–2239 (2003).

جيانغ ، N. ، باو ، Z. ، Zhang ، X. ، Eddy ، S.R. & amp Wessler، S.R. تتوسط العناصر القابلة للنقل Pack-MULE في تطور الجينات في النباتات. طبيعة سجية 431, 569–573 (2004).

Yu، Z.، Wright، S.I. & amp Bureau، T.E. العناصر الشبيهة بالمحول في نبات الأرابيدوبسيس thaliana. الهيكل والتنوع والتطور. علم الوراثة 156, 2019–2031 (2000).

Le، QH.، Wright، S.، Yu، Z. & amp Bureau، T. نبات الأرابيدوبسيس thaliana . بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 97, 7376–7381 (2000).

Lai، J.، Li، Y.، Messing، J. & amp Dooner، H.K. حركة الجينات هيليترون تساهم الينقولات في تقلب النمط الفرداني للذرة. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 102, 9068–9073 (2005).

مايرز ، كولومبيا البريطانية ، تينجي ، S.V. & amp Morgante، M. وفرة وتوزيع ونشاط نسخ العناصر المتكررة في جينوم الذرة. الدقة الجينوم. 11, 1660–1676 (2001).


تطور جينات Olig ودورها في تكوين الميالين

واحدة من السمات الخاصة للفقاريات هو نظامها العصبي النخاعي. من خلال زيادة سرعة التوصيل للمحاور ، يسمح الميالين بزيادة حجم الجسم والحركة السريعة والدماغ الكبير والمعقد. في الجهاز العصبي المركزي (CNS) ، الخلايا قليلة التغصن (OLs) هي الخلايا المكونة للمايلين. من المفترض أن عوامل النسخ OLIG1 و OLIG2 ، وهما المنظمان الرئيسيان لتطوير OL ، قد لعبت أيضًا دورًا أساسيًا أثناء تطور البرنامج الجيني الذي أدى إلى تكون الميالين في الجهاز العصبي المركزي. من البيانات الوراثية والتطور الوراثي المتاحة ، نحاول إعادة بناء الأحداث التطورية التي أدت إلى ظهور عائلة جينات Olig والتكهن حول الروابط بين جينات Olig وعناصرها التنظيمية المحددة وتطور المايلين. بالإضافة إلى ذلك ، أبلغنا عن سلف بروتين المايلين الأساسي المفترض (MBP) في الحشوات الحشوية Branchiostoma floridae ، التي تفتقر إلى المايلين المضغوط. يفتقر جين lancelet "Mbp" إلى مواقع ربط OLIG1 / 2- و SOX10 التي تميز متماثلات Mbp الفقارية ، مما يزيد من احتمال أن يكون إدخال عناصر تنظيم رابطة الدول المستقلة قد شارك في تطور برنامج الميالين.


نتائج

أحداث إدراج إكسون في مونتيوم ثابت ص-نيوجين

في دراسة سابقة ، قمنا باستنساخ 12 من 18 وتسلسلها كليًا أو جزئيًا مونتيومص-نيوجين. في سبعة أنواع (D. bicornuta, د. دافيدي, د. جامبولينا, نيكانو, D. seguyi, د. سيراتا, D. tsacasi)، حجم ص- يتوافق الجين مع الحجم المتوقع من أ ص-نيوجين مشابه لما هو موصوف في D. tsacasi ( رسم بياني 1ب) (Nouaud et al. 1999). في الأنواع الخمسة الأخرى (د. باكوي, د. بوكيتي, D. burlai, د. مالاغاسيا, د. فولكانا)، حجم ص-النيوجين أكبر من المتوقع ، مما يشير إلى وجود إدخال الحمض النووي. ال ص-نيوجين من د. بوكيتي (P-boc) و د. فولكانا (P- فول) تم تسلسلها بالكامل (أرقام الانضمام AF169142 و AY116625).

إدراج Exon ترميز جديد المصب من Exon 0 من P-Neogene لـ ذبابة الفاكهة بوكيتي

مقارنة بين هياكل D. tsacasi و د. بوكيتيص-نيوجين (الشكل 1ب و ج) يظهر أنه مشلول وداخلي محذوف ص-يتم إدخال العنصر داخل intron (0 ، 1) الذي يفصل exon 0 و exon 1 في د. بوكيتيص-نيوجين. هذه ص- إدخال التسلسل هو 556 نقطة أساس (رقم المدخل AF169142 من النيوكليوتيدات 1049 إلى 1604). إنه محاط بنسخة 8 نقاط أساس تقابل تكرار الموقع المستهدف ، مع عدم تطابق واحد. 31 نقطة أساس من التكرار المقلوب 3 الطرفية (TIR) ​​هي 87 ٪ متطابقة مع تسلسل D. melanogasterص- عنصر متحرك TIR. أول 13 نقطة أساس من 5 TIR مفقودة. يحتفظ هذا الإدخال الداخلي بإطار قراءة مفتوح سليم (ORF) يتوافق مع exon 0 من المتعارف عليه ص-عنصر. فيما بعد ، سيتم استدعاء هذا الإدراج InsPboc و exon الخاص به ، exon 0 ′. الهوية بين exon 0 ′ وأول ترميز exon (exon 0) من ص-boc النيوجين هو 54.4٪ و 43.3٪ عند مستويات النوكليوتيدات والأحماض الأمينية على التوالي. تم إجراء تحليل اللطخة الشمالية على بولي البالغ (A) + RNA باستخدام مسبار مضلع تم الحصول عليه من المنطقة المستنسخة الفرعية من exons 1 و 2 من P-tsa نيوجين. تم تصنيع المسبار باستخدام بوليميريز T7 RNA وتم تمييزه بـ [32 P] UTP. كما هو موضح في الشكل 1ج، تم الكشف عن نسخة 2.5 كيلو بايت ونسخة 2.1 كيلو بايت. يتوافق الفرق بين أحجام النسختين مع ذلك المتوقع في حالة حدوث تضفير بديل ، حيث ينضم إما إلى exon 0 إلى exon 0 ′ و exon 0 ′ إلى exon 1 ، أو exon 0 إلى exon 1. ينتج عن معالجة RNA الكاملة اثنين من mRNAs: واحد بما في ذلك exons –1 ، 0 ، 0 ′ ، 1 و 2 (2.5 كيلو بايت) والثاني بما في ذلك exons –1 ، 0 ، 1 و 2 (2.1 كيلو بايت) (الشكل 1)ج). نظرًا لأن المسبار المستخدم في اللطخة الشمالية يغطي نفس الجزء من النسختين ، فمن المحتمل أن يكون الاختلاف في الشدة بينهما ناتجًا عن الاختلافات الكمية في البالغين. تم تأكيد هذا الربط البديل بواسطة RT-PCR. تم استخراج النصوص من البالغين وتم تصنيع (كدنا) كما هو موضح في المواد والأساليب. يتم عرض الاشعال المصممة لتضخيم (كدنا) في الشكل 1ج. تؤكد تسلسلات المنتجات المضخمة أن اللصق البديل يستخدم مواقع التضفير المانحة والمقبلة المقابلة لتلك الموجودة في المتعارف عليه ص- عنصر قابل للنقل (لاسكي وآخرون 1986).

يحتوي تسلسل نسخة 2.1 كيلو بايت على قدرة تشفير لبروتين يبلغ طوله 574 من الأحماض الأمينية. سيُطلق على هذا البروتين فيما بعد اسم المكبِط 1 (RL1). يمكن أيضًا ترجمة نص 2.5 كيلوبايت من البداية التقليدية للترجمة الموجودة في exon 0 أو في exon 0. تتوقف الترجمة التي بدأت من exon 0 في بداية exon 0 بسبب وجود كودون توقف (الربط بين exon 0 و exon 0 لا يحافظ على المرحلة في exon 0 ′). في المقابل ، فإن الترجمة التي بدأت من AUG التقليدي لـ exon 0 تؤدي إلى بروتين 570 AA ، والذي سيُطلق عليه فيما بعد بروتين 2 الشبيه بالقمع (RL2).

تم العثور على هيكل مماثل في D. burlai. (رقم الانضمام AY116626) ، من الأنواع الشقيقة لـ بوكيتي مجمع الأنواع (Lemeunier et al. 1986). في هذه الأنواع ، فإن ص- يحتوي الجين الجديد على مادة إدخال تبلغ 501 نقطة أساس ، يتم إدخالها في نفس الموقع كما في د. بوكيتي، مما يشير إلى أن حدث الإدخال الأساسي حدث في سلف مشترك لكلا النوعين. هذا الإدراج ، فيما بعد يسمى InsPbur، حالية TIRs التي لها نفس خصائص InsPboc، باستثناء إدخال 7 نقاط أساس داخل 3 ′ TIR. وبالتالي ، لا يمكن أن يكون عبرحراك. InsPbur يقدم ORF مع 93 من الأحماض الأمينية التي تظهر هوية 92.5 ٪ مع exon 0 من InsPboc الهويات بين exon 0 ′ لـ InsPbur و exon 0 من ص-بور النيوجين 51.5٪ و 42.2٪ عند مستويات النيوكليوتيدات والأحماض الأمينية ، على التوالي. علاوة على ذلك ، يُظهر تحليل التسلسل الحفاظ على نفس مواقع لصق المحددة تجريبياً في P-boc نيوجين. وبالتالي ، فإن ف بور سيوفر النيوجين نوعين من البروتينات بنسبة 96.5 ٪ و 95.3 ٪ مع بروتينات RL1 و RL2 المقابلة ، على التوالي ، من P-boc نيوجين.

مثال آخر على خلط Exon Shuffling: إدراج Exon Upstream جديد لـ Exon 0 من د. فولكانا ف نيوجين

مقارنة بين هيكل D. tsacasiص-نيوجين مع أن د. فولكانا ( رسم بياني 1ب و د) يُظهر أن ملف داخلي محذوف ص-يتم إدخال العنصر داخل exon –1 من د. فولكاناص-نيوجين. هذا الإدراج ، فيما بعد يسمى InsPvulيبلغ طوله 350 نقطة أساس وقد حافظ على ORF سليمًا يتوافق مع exon 0 الموصوف أعلاه. هيكل عظمي ص- لا يزال من الممكن تحديد العنصر 5 ′ TIR في تسلسل المنبع من ORF هذا ، ولكن لا يمكن اكتشاف هوية مهمة مع 3-TIR في منطقة المصب. مقارنة النوكليوتيدات بين InsPvul تسلسل الترميز و exon 0 من P- فول يظهر النيوجين هوية 51.1٪. التشابه الهيكلي بين InsPboc و InsPvul وهوية تسلسل النوكليوتيدات العالية (83.9٪) تجعل من الممكن استنتاج النصوص المفترضة للنيوكليوتيدات. P- فول neogene من مواقع الربط التي تم تحديدها تجريبياً لـ P-boc نيوجين (انظر مناقشة).

ال ص-نيوجين من د. باكوي و د. مالاغاسيا تم تسلسلها جزئيًا في اتجاه المنبع من exon 0 ، فهي تقدم نفس الإدراج مثل P- فول نيوجين ، يقع في نفس الموقع المستهدف (البيانات غير معروضة). ينتمي هذان النوعان إلى نفس مجمع الأنواع مثل د. فولكانا (ال باكوي مجمع الأنواع ، Lemeunier et al. 1986). يشير هذا إلى أن حدث الإدراج هذا حدث في سلفهم المشترك. إضافات exons إلى ص-النيوجين الموصوف أعلاه غير مصحوب بأي تعديلات هيكلية أخرى. من اللافت للنظر ، كما هو مبين في الشكل 2 ، أن تسلسل تيار exon 1 محفوظ بدرجة كبيرة عند مقارنته بمنطقة المروج في ص-نيوجين D. tsacasi (نواود وآخرون 1999).

تحديد نسخة Exon 0 ′ Master

النوكليوتيدات تباعد بين المدخلات InsPboc أو InsPvul والمتعددة ص- النتائج المسجلة في بنوك البيانات كلها أكبر من 35٪ ، مما يعني أنها لا تنتمي إلى ما سبق وصفه ص-العنصر الفرعي (Clark and Kidwell 1997 Pinsker et al.2001). علاوة على ذلك ، يمكن أن ينتج كل منهم عن إدراج ملف كامل ص-element ، متبوعًا بحذف كبير ، وترك المنطقة (بما في ذلك منطقة التشفير الكاملة للإكسون الأول) مدرجة. بسبب هويتهم (83.9٪) ، يجب أن تكون هذه الإدخالات مشتقة من نفس الشيء ص-الفصيلة الفرعية. تدعم هذه النتائج الفرضية القائلة بأن جينوم الأنواع د. بوكيتي و د. فولكانا وأنواعها ذات الصلة تأوي نشاطًا نشطًا ص- عائلة العنصر التي هي في أصل exons 0 المحددة في عدة مونتيومص-نيوجين.

تم إجراء تجارب اللطخة الجنوبية باستخدام الحمض النووي الجيني لستة أنواع تنتمي إلى مونتيوم مجموعة فرعية (د. بوكيتي, د. بورلاي, د. kikkawai, نيكانو, D. tsacasi، و د. فولكانا). تم هضم عينات الحمض النووي مع Pst أنا نوكلياز ، وبعد الرحلان الكهربائي ، تم نقل شظايا التقييد مرتين إلى غشاء النيتروسليلوز. تم تهجين أحد المرشحات باستخدام جزء معين من exon تم تضخيمه باستخدام البادئات 1359 و 1632 من الاستنساخ الذي يحتوي على P-boc neogene كقالب (انظر المواد والأساليب). يوجد عدد من إشارات التهجين في د. بوكيتي، وكذلك في الأنواع الأخرى (شكل 3أ) ، مما يدل على أن الإدخالات InsPboc و InsPvul تنتمي إلى متفرقة متكررة ص-أسرة العنصر. في محاولة للعزل ص- العناصر الموجودة في أصل exon 0 ، تم إجراء تضخيم PCR بعيد المدى د. بوكيتي DNA كقالب مع التمهيدي (5′CATAATGGAATAACTATAAGGTGG3 ′) يتوافق مع أول 24 نقطة أساس من تسلسل 3 TIR من إنسبوك. كامل الطول ومحذوف صتم استنساخ العناصر بواسطة طريقة TA-cloning (Invitrogen) من منتجات PCR. تم تسلسل بعضها. تسلسل كامل ص-العنصر (رقم المدخل AY116624) ، الموصوف في الشكل 4 ، له قدرة تشفير مستقلة ص-عنصر. هذا العنصر يسمى K-bok-P-العنصر (كينيا-بوكيتيص-العنصر من أجل د. بوكيتي سلالة نشأت في كينيا). ستة أخرى K-boc التسلسلات متسلسلة جزئيًا. الاختلاف بينهما أقل من 5٪. كانت متوفرة عند الطلب. ال K-boc-P- طول العنصر 3300 نقطة أساس وتتكون نهايته من 31 نقطة أساس متكررة مقلوبة. الفرق في الطول بين K-boc-P والمتعارف عليه ص-العنصر (الشكل 1أ) ناتج عن ميزتين: (1) intron بين exon 0 و exon 1 طويل بشكل غير عادي K-boc-P (264 نقطة أساس مقابل حوالي 50 نقطة أساس في الأخرى ص-elements) ، و (2) exon 3 تمت مقاطعته بواسطة 172bp intron إضافي. ومع ذلك ، فإن K-boc-Pيشترك -element في عدد من الميزات الهيكلية مع المستقل ص- عنصر من أنواع ذبابة الفاكهة الأخرى (D. melanogaster, D. bifasciata, S. باليدا). تم العثور على التكرارات المقلوبة تحت الخطية (SIRs) بمقدار 10 نقاط أساس (المواضع 33-42 و 3259-3268) و 11 نقطة أساس مع عدم تطابق واحد (المواضع 127-137 و 3161-3171) في منطقتي 5 و 3 غير المشفرة. تتوافق هذه المواقع مع تلك الخاصة بـ SIRs في ص- عناصر من الأنواع الأخرى ، مما يعني ضمناً التكافؤ الوظيفي. علاوة على ذلك ، exon 1 ، مثل D. melanogaster و Scaptomyza pallidaص- العناصر (Simonelig and Anxolabéhère 1991) ، تقدم تكرارات مقلوبة بمقدار 17 نقطة أساس مفصولة بـ 29 نقطة أساس (المواضع 942-958 و 988-1004). يتم حفظ مواقع لصق الإجماع 5′- و 3′ للإكسونات ويحتفظ intron الإضافي داخل exon بقدرة التشفير الخاصة بـ K-boc-P-عنصر. يبلغ طول البروتين المفترض 721 حمضًا أمينيًا ويبلغ وزنه الجزيئي 83 كيلو دالتون (شكل 4). من اللافت للنظر أن Cys و His و Arg و Lys و Trp ممثلون بشكل كبير في أول 70 حمضًا أمينيًا من قسم N-terminal (35.7٪ مقارنة بـ 17.5٪ في بقية البروتين). علاوة على ذلك ، فإن موقع الربط المعدني المفترض CCHC موجود في الكنسي ص- يمكن التعرف على العنصر (Miller et al. 1995 Lee و Mul و Rio 1996 Miller et al. 1999) في نفس الموضع في K-bok-P بروتين. تشير هذه النتائج إلى أن ميزات مجالات ربط الحمض النووي موجودة في الأقسام الطرفية N من الترانسبوزيز المفترض للـ K-boc-P-عنصر. علاوة على ذلك ، بالمقارنة مع D. melanogasterص- العنصر ، والأقسام الأخرى المهمة وظيفيًا محفوظة أيضًا: تم العثور على الزخارف الثلاثة من leucine-zipper في نفس المواقع مثل شكل اللولب الدوراني اللولبي ، والذي يُظهر أربعة حالات عدم تطابق فقط من أصل 19 من البقايا (الشكل 4).

تم تهجين المرشح الثاني من عينات الحمض النووي ثنائية النقل الموصوفة أعلاه باستخدام منتج PCR تم تصنيعه من exon 3 الخاص بـ transposase الخاص بالنسخة المستنسخة K-boc-P-عنصر. كما هو موضح في الشكل 3ب، تم الكشف عن عدد من إشارات التهجين في د. بوكيتي, D. burlai, نيكانو, D. tsacasi، و د. فولكانا (لكن ليس في د. kikkawai) ، مما يدل على وجود العديد ص- العناصر التي تحتوي على exon 3 الخاص بتسلسل ترميز transposase.

لتحديد العلاقة بين K-boc-P-العنصر والتخصص ص-العناصر الفرعية كما تم وصفها سابقًا في د (نوع T) ، D. bifasciata (نوع M و O- نوع) ، D. helvetica (نوع M) ، D. melanogaster (نوع M) و Scaptomyza pallida (M-type) (للمراجعة ، انظر Hagemann، Miller، and Pinsker 1996) ، محاذاة النيوكليوتيدات والأحماض الأمينية لهذه العناصر مع K-boc-P- تم تنفيذ العنصر باستخدام برنامج Pileup الخاص بحزمة GCG (Madison، Wis.) وتم تحسينه يدويًا. يتم عرض المسافات الزوجية في الجدول 2. K-boc-P-العنصر بعيد جدا عن كل شيء آخر ص-العناصر (& gt0.45): هذا بالحجم الكامل الجديد ص-العنصر ينتمي إلى مجهول حتى الآن ص-عائلة. نحدد هذه العائلة الفرعية على أنها النوع K.

تم إجراء تحليل ربط الجار على البروتينات المفترضة لهذه البروتينات صعواقب واثنين إضافيين ص- العواقب من الأنواع الأبعد ، لوسيليا كوبينا (Calliphoridae) (بيركنز وهويلز 1992) و موسكا دومستيكا (Muscidae) (Lee ، Clark ، و Kidwell 1999) ، ينتج مخطط شجر الأسنان الذي فيه K-boc-P-مجموعات العناصر مع العناصر من ذبابة الفاكهة (الشكل 5). قام كلارك وكيدويل (1997) بإجراء تحليل جيني شامل لـ ص-النتيجة مع 40 نوعًا في ذبابة الفاكهة باستخدام جزء ص-النتيجة (449 نقطة أساس من إكسون 2). قدم هذا التحليل مخطط cladogram حيث يتم دعم 16 كليدًا جيدًا. لتحديد موقع K-boc عنصر متعلق بهذه ص-العنصر الفرعي ، تم إجراء تحليل ربط الجوار باستخدام هذا التسلسل الداخلي الجزئي. واحد أو اثنان فقط ص- تم تضمين عواقب ممثلة لكل كليد تم تحديده بواسطة عمل كلارك وكيدويل في التحليل. في مخطط cladogram الجديد (الشكل 6) K-boc-P-لا يتجمع العنصر داخل أي واجهات تم تحديدها مسبقًا ، مما يؤكد أن K-boc-P-لا ينتمي العنصر إلى إحدى العائلات الفرعية التي سبق وصفها.

يشير موضع وسعة تشفير exons 0 إلى إعادة ترتيبها ص-النيوجين تحت اختيار مستوى المضيف. يتم توفير الدليل المباشر عن طريق اختبار للاختيار على مستوى التسلسل. المقارنات الزوجية لمعدلات الاستبدال بين exon 0 من K-boc مكتمل الطول ص-العنصر والإكسون 0 من ص-نيوجين في د. بوكيتي, D. burlai، و د. فولكانا، معروضة في الجدول 3 (لم تكن بيانات التسلسل كافية متاحة للنيوجينات في د. مالاغاسيا و د. باكوي). كل النتائج المهمة (ص & lt 0.05) بسبب دن/دس & lt 1 ، لقد أظهروا دليلًا على الاختيار المحافظ. تتوافق هذه النتائج مع نتائج Witherspoon (1999) ، التي تم الحصول عليها باستخدام التسلسلات الجزئية لـ ص-نيوجين من د. دافيدي, D. tsacasi، و د. kikkawai. نظرًا لحدوث تغييرات قليلة جدًا بين exon 0 ′ لـ RL2bur و exon 0 من RL2boc ، فإن الاختبار لديه قوة أقل من المقارنات الأخرى مما يعطي إحصائية غير مهمة.


Kapitonov ، V. V. & amp Jurka ، J. Helitrons on a roll: حقيقيات النوى ينقولات دائرية. اتجاهات الجينات. 23, 521–529 (2007).

Thomas ، J. & amp Pritham ، E.J. Helitrons ، العناصر القابلة للتحويل بدائرة دائرية حقيقية النواة. ميكروبيول. سبيكتر. 3, 893–926 (2015).

ديدا ، ف.وآخرون. التركيب البلوري للمجال التحفيزي لـ HIV-1 Integrase: التشابه مع عمليات نقل polynucleotidyl الأخرى. علم 266, 1981–1986 (1994).

Kapitonov ، V. V. & amp Jurka ، J. الينقولات الدائرية المتدحرجة في حقيقيات النوى. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 98, 8714–8719 (2001).

Ilyina، T. V. & amp Koonin، E. V. الرسوم المتسلسلة المحفوظة في البروتينات البادئة لتكرار الحمض النووي للدائرة المتدحرجة المشفرة بواسطة نسخ متماثلة متنوعة من eubacteria و eucaryotes و archaebacteria. الدقة الأحماض النووية. 20, 3279–3285 (1992).

Koonin، E. V. & amp Ilyina، T. V. تشريح بمساعدة الكمبيوتر لتكرار الحمض النووي للدائرة المتداول. الأنظمة الحيوية 30, 241–268 (1993).

فان مانسفيلد ، إيه دي ، فان تيفيلين ، إتش إيه ، باس ، بي دي أند يانش ، إتش إس تشارك مجموعتان متجاورتان من التيروسيل-أوه في الانقسام المحفز للبروتين وربط الحمض النووي. الدقة الأحماض النووية. 14, 4229–4238 (1986).

تشاندلر ، م وآخرون. كسر وضم الحمض النووي أحادي الجديلة: عائلة نوكلياز HUH الفائقة. نات. القس Microbiol.y 11, 525–538 (2013).

del Pilar Garcillan-Barcia ، M. ، Bernales ، I. ، Mendiola ، M. V. & amp de la Cruz ، F. وسيطات الحمض النووي أحادية الجديلة في تبديل الدائرة المتداول IS91. مول. ميكروبيول. 39, 494–501 (2001).

Garcillan-Barcia، M.P & amp de la Cruz، F. توزيع متواليات إدخال عائلة IS91 في الجينوم البكتيري: الآثار التطورية. FEMS ميكروبيول. ايكول. 42, 303–313 (2002).

Mendiola ، M. V. ، Bernales ، I. & amp de la Cruz ، F. الأدوار التفاضلية لمصطلح الترانسبوسون في تبديل IS91. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 91, 1922–1926 (1994).

Mendiola، M. V. & amp de la Cruz، F. يرتبط ترانسبوزيز IS91 ببروتينات التكرار من نوع الدائرة المتدحرجة لعائلة pUB110 من البلازميدات. الدقة الأحماض النووية. 20, 3521 (1992).

Pritham، E.J & amp Feschotte، C. تضخيم هائل من الينقولات ذات الدائرة المتدحرجة في سلالة الخفاش Myotis lucifugus. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 104, 1895–1900 (2007).

توماس ، ج ، فيليبس ، سي دي ، بيكر ، آر جيه ، وأمبير بريثام ، إي.جيه.نقلات الدائرة المتدحرجة تحفز الابتكار الجيني في سلالة الثدييات. جينوم بيول. Evol. 6, 2595–2610 (2014).

Thomas، J.، Sorourian، M.، Ray، D.، Baker، R.J & amp Pritham، E.J. التوزيع المحدود للهيليترونات على خفافيش vesper يدعم النقل الأفقي. الجين 474, 52–58 (2011).

Coates ، B. S. ، Hellmich ، R. L. ، Grant ، D. M. & amp Abel ، C. A. تعبئة جينوم Lepidoptera من خلال مكاسب تسلسل جديدة وإنشاء النهاية بواسطة Lep1 Helitrons غير المستقلة. الدقة DNA. 19, 11–21 (2012).

Du، C.، Fefelova، N.، Caronna، J.، He، L. & amp Dooner، H.K. مشهد Helitron متعدد الألوان لجينوم الذرة. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 106, 19916–19921 (2009).

Lal، S. K.، Giroux، M. J.، Brendel، V.، Vallejos، C.E & amp Hannah، L.C يحتوي جينوم الذرة على إدخال هيليترون. الخلية النباتية 15, 381–391 (2003).

Xiong ، W. ، He ، L. ، Lai ، J. ، Dooner ، H.K & amp Du ، C. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 111, 10263–10268 (2014).

مورغانتي ، إم وآخرون. تولد الازدواجية الجينية وخلط exon بواسطة الينقولات الشبيهة بالهيليترون تنوعًا بين الأنواع في الذرة. نات. جينيه. 37, 997–1002 (2005).

دونغ ، واي وآخرون. التوصيف الهيكلي للهليترونات والتقاطها التدريجي لشظايا الجينات في جينوم الذرة. علم الجينوم BMC 12, 609 (2011).

Toleman، M.A، Bennett، P. M. & amp Walsh، T.R. عناصر ISCR: أنظمة جديدة لالتقاط الجينات في القرن الحادي والعشرين؟ ميكروبيول. مول. بيول. القس. 70, 296–316 (2006).

ياسين ، هـ وآخرون. دليل تجريبي على التحويل بوساطة IS1294b لجين blaCMY-2 سيفالوسبوريناز في Enterobacteriaceae. J. Antimicrob. كيميائي. 70, 697–700 (2015).

Brunner، S.، Pea، G. & amp Rafalski، A. الأصول والتنظيم الجيني ونسخ عائلة من عناصر الهليترون غير المستقلة في الذرة. مصنع J. 43, 799–810 (2005).

Feschotte، C. & amp Wessler، S. R. الكنوز في العلية: الينقولات الدائرية المتدحرجة المكتشفة في جينومات حقيقية النواة. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 98, 8923–8924 (2001).

تمبل ، س. ، نيكولاس ، ج. ، العمراني ، أ. وأمبير كوي ، 1. أسفر التحديد المستند إلى النموذج عن Helitrons عن تصنيف جديد لعائلاتهم في Arabidopsis thaliana. الجين 403, 18–28 (2007).

الاصحاب ، ل. وآخرون. يتيح التطور الجزيئي لمركب ترانسبوزيز للجمال النائم الجديد مفرط النشاط نقل جيني قوي ومستقر في الفقاريات. نات. جينيه. 41, 753–761 (2009).

Bird، L. E.، Subramanya، H. S. & amp Wigley، D. B. Helicases: موضوع هيكلي موحد؟ بالعملة. رأي. هيكل. بيول. 8, 14–18 (1998).

هان ، إم جيه وآخرون. تحديد وتطور هيليترونات دودة القز ومساهمتها في النصوص. الدقة DNA. 20, 471–484 (2013).

Yang، L. & amp Bennetzen، J.L الاكتشاف القائم على الهيكل ووصف الهليترونات النباتية والحيوانية. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 106, 12832–12837 (2009).

Yang، L. & amp Bennetzen، J.L. توزيع وتنوع وتطور وبقاء الهليترونات في جينوم الذرة. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 106, 19922–19927 (2009).

Harrow، J. et al. GENCODE: شرح الجينوم البشري المرجعي لمشروع الترميز. الدقة الجينوم. 22, 1760–1774 (2012).

أندرسون ، آر وآخرون. أطلس من المعززات النشطة عبر أنواع الخلايا البشرية والأنسجة. طبيعة سجية 507, 455–461 (2014).

Guelen، L. et al. تم الكشف عن تنظيم المجال للكروموسومات البشرية من خلال تعيين تفاعلات الصفيحة النووية. طبيعة سجية 453, 948–951 (2008).

كارلسون ، سي م وآخرون. طفرات الينقولات في سلالة جرثومية الفأر. علم الوراثة 165, 243–256 (2003).

Fischer، S. E.، Wienholds، E. & amp Plasterk، R.H. النقل المنظم للينقولات السمكية في خط جرثومة الفأر. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 98, 6759–6764 (2001).

Luo، G.، Ivics، Z.، Izsvak، Z. & amp Bradley، A. النقل الكروموسومي لعنصر يشبه Tc1 / بحار في الخلايا الجذعية الجنينية للفأر. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 95, 10769–10773 (1998).

Tower، J.، Karpen، G.H، Craig، N. & amp Spradling، A.C. النقل التفضيلي لعناصر ذبابة الفاكهة P إلى مواقع الكروموسومات القريبة. علم الوراثة 133, 347–359 (1993).

تون هوانج ، ب. وآخرون. تبديل ISHp608 ، عضو في عائلة غير عادية من متواليات الإدخال البكتيري. EMBO J. 24, 3325–3338 (2005).

تون هوانج ، ب. وآخرون. يقترن نقل الحمض النووي أحادي السلسلة بتكرار المضيف. زنزانة 142, 398–408 (2010).

Dayn, A., Malkhosyan, S. & Mirkin, S. M. Transcriptionally driven cruciform formation in vivo. الدقة الأحماض النووية. 20, 5991–5997 (1992).

Krasilnikov, A. S., Podtelezhnikov, A., Vologodskii, A. & Mirkin, S. M. Large-scale effects of transcriptional DNA supercoiling in vivo. جيه مول. بيول. 292, 1149–1160 (1999).

Strick, T. R., Allemand, J. F., Bensimon, D. & Croquette, V. Behavior of supercoiled DNA. بيوفيز. ج. 74, 2016–2028 (1998).

Liu, L. F. & Wang, J. C. Supercoiling of the DNA template during transcription. Proc.Natl Acad. علوم. الولايات المتحدة الأمريكية 84, 7024–7027 (1987).

Rahmouni, A. R. & Wells, R. D. Direct evidence for the effect of transcription on local DNA supercoiling in vivo. جيه مول. بيول. 223, 131–144 (1992).

Parsa, J. Y. et al. Negative supercoiling creates single-stranded patches of DNA that are substrates for AID-mediated mutagenesis. بلوس جينيت. 8، e1002518 (2012).

Faurez, F., Dory, D., Grasland, B. & Jestin, A. Replication of porcine circoviruses. فيرول. ج. 6, 60 (2009).

Feschotte, C. Transposable elements and the evolution of regulatory networks. نات. Rev. Genet. 9, 397–405 (2008).

Jiang, N., Bao, Z., Zhang, X., Eddy, S. R. & Wessler, S. R. Pack-MULE transposable elements mediate gene evolution in plants. طبيعة سجية 431, 569–573 (2004).

Langmead ، B. ، Trapnell ، C. ، Pop ، M. & amp Salzberg ، S. L. محاذاة فائقة السرعة وفعالة للذاكرة لتسلسلات الحمض النووي القصيرة مع الجينوم البشري. جينوم بيول. 10، R25 (2009).

Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. الدقة الأحماض النووية. 31, 3406–3415 (2003).


نتائج

We analyzed 105 cases of alternative DNA processing identified in the س. trifallax micronuclear genome ( Chen et al. 2014 ). We excluded cases that do not involve new genes, including noncoding chromosomes, multigene chromosomes that share exactly one gene, and chromosomes that only share noncoding regions (see Methods). The remaining 69 cases involve 69 germline loci that encode MDS segments for 153 MAC chromosomes with shared 5′ or 3′ terminal regions, or both ( table 1 ). شكل 1ب shows the distribution of the fraction of shared coding regions relative to the total length of the coding region. This portion ranges from just a few percent to over 90%. There is no strong bias for sharing of 5′ versus 3′ end regions. Most loci contain two genes that share single-copy MDSs. There are six loci that each contain a set of three genes with shared MDSs. Three loci contain four genes that share MDSs, and there exists one locus that gives rise to five such genes.

Summary of Alternative MDS Processing Cases Investigated in this Study

. Total . Share 5′ . Share 3′ . Share 5′ and 3′ . No. of Nonscrambled . No. of Scrambled .
No. of MIC loci 69 32 31 6 31 38
No. of MAC chromosomes 153 75 65 13 80 73
No. of MDSs 2,420 330 349 183 2,191 229
. Total . Share 5′ . Share 3′ . Share 5′ and 3′ . No. of Nonscrambled . No. of Scrambled .
No. of MIC loci 69 32 31 6 31 38
No. of MAC chromosomes 153 75 65 13 80 73
No. of MDSs 2,420 330 349 183 2,191 229

Summary of Alternative MDS Processing Cases Investigated in this Study

. Total . Share 5′ . Share 3′ . Share 5′ and 3′ . No. of Nonscrambled . No. of Scrambled .
No. of MIC loci 69 32 31 6 31 38
No. of MAC chromosomes 153 75 65 13 80 73
No. of MDSs 2,420 330 349 183 2,191 229
. Total . Share 5′ . Share 3′ . Share 5′ and 3′ . No. of Nonscrambled . No. of Scrambled .
No. of MIC loci 69 32 31 6 31 38
No. of MAC chromosomes 153 75 65 13 80 73
No. of MDSs 2,420 330 349 183 2,191 229

Alternative MDS Processing Creates New Genes

We investigated the emergence of these 69 cases of alternative DNA splicing by examining their orthologs in related species. We sequenced and assembled the macronuclear genomes of six stichotrich ciliates Urostyla ص. ، Paraurostyla ص. ، Laurentiella ص. ، سtylonychia lemnae , Sterkiella histriomuscorum ، و Tetmemena sp., whose ribosomal DNA has a closest hit (98%) to Tetmemena pustulata ribosomal DNA (GenBank accession AF508775). We also used the preliminary macronuclear genome assembly of Euplotes crassus , an earlier diverging Spirotrich ciliate, described in Swart et al. (2013) . The assembled stichotrich genomes contain a large percentage of completely assembled somatic chromosomes ( table 2 ). Analyses of CEGs and tRNA complement suggest that our assemblies are complete (see Methods). Aeschlimann et al. (2014) previously reported a Stylonychia lemnae macronuclear genome assembly for a different strain 130c, whose assembly size (50.2 Mb) and total number of contigs (19,851) and two telomere contigs (16,059) are similar to our Stylonychia الجمعية العامة.

Length Statistics of Stichotrich Genome Assemblies

. N20 . N50 . Average Length . Total Complexity . No. of Contigs . 5′ Telomere . 3′ Telomere . Both Telomeres .
Urostyla sp. 5,571 2,898 2,105 42.62M 20,244 15,569 15,960 13,496
Sterkiella histriomuscorum5,058 2,822 2,011 66.36M 32,996 19,368 20,756 16,924
Stylonychia lemnae5,643 3,089 2,333 54.71M 23,449 19,324 19,443 18,058
Laurentiella sp. 5,466 3,043 2,293 49.04M 21,383 17,789 17,766 16,399
Paraurostyla sp. 5,326 2,882 2,249 57.10M 25,391 21,028 21,019 19,135
Tetmemena sp. 5,714 3,312 2,404 60.63M 25,219 18,718 18,166 16,577
Oxytricha trifallax JRB510 5,767 3,392 2,558 57.45M 22,458 18,055 18,335 15,918
. N20 . N50 . Average Length . Total Complexity . No. of Contigs . 5′ Telomere . 3′ Telomere . Both Telomeres .
Urostyla sp. 5,571 2,898 2,105 42.62M 20,244 15,569 15,960 13,496
Sterkiella histriomuscorum5,058 2,822 2,011 66.36M 32,996 19,368 20,756 16,924
Stylonychia lemnae5,643 3,089 2,333 54.71M 23,449 19,324 19,443 18,058
Laurentiella sp. 5,466 3,043 2,293 49.04M 21,383 17,789 17,766 16,399
Paraurostyla sp. 5,326 2,882 2,249 57.10M 25,391 21,028 21,019 19,135
Tetmemena sp. 5,714 3,312 2,404 60.63M 25,219 18,718 18,166 16,577
Oxytricha trifallax JRB510 5,767 3,392 2,558 57.45M 22,458 18,055 18,335 15,918

Length Statistics of Stichotrich Genome Assemblies

. N20 . N50 . Average Length . Total Complexity . No. of Contigs . 5′ Telomere . 3′ Telomere . Both Telomeres .
Urostyla sp. 5,571 2,898 2,105 42.62M 20,244 15,569 15,960 13,496
Sterkiella histriomuscorum5,058 2,822 2,011 66.36M 32,996 19,368 20,756 16,924
Stylonychia lemnae5,643 3,089 2,333 54.71M 23,449 19,324 19,443 18,058
Laurentiella sp. 5,466 3,043 2,293 49.04M 21,383 17,789 17,766 16,399
Paraurostyla sp. 5,326 2,882 2,249 57.10M 25,391 21,028 21,019 19,135
Tetmemena sp. 5,714 3,312 2,404 60.63M 25,219 18,718 18,166 16,577
Oxytricha trifallax JRB510 5,767 3,392 2,558 57.45M 22,458 18,055 18,335 15,918
. N20 . N50 . Average Length . Total Complexity . No. of Contigs . 5′ Telomere . 3′ Telomere . Both Telomeres .
Urostyla sp. 5,571 2,898 2,105 42.62M 20,244 15,569 15,960 13,496
Sterkiella histriomuscorum5,058 2,822 2,011 66.36M 32,996 19,368 20,756 16,924
Stylonychia lemnae5,643 3,089 2,333 54.71M 23,449 19,324 19,443 18,058
Laurentiella sp. 5,466 3,043 2,293 49.04M 21,383 17,789 17,766 16,399
Paraurostyla sp. 5,326 2,882 2,249 57.10M 25,391 21,028 21,019 19,135
Tetmemena sp. 5,714 3,312 2,404 60.63M 25,219 18,718 18,166 16,577
Oxytricha trifallax JRB510 5,767 3,392 2,558 57.45M 22,458 18,055 18,335 15,918

For two genes A and B that share MDSs in Oxytricha , we queried the presence of their orthologs in other species and assessed whether their orthologs also share sequences, which would suggest that they are also products of alternative MDS processing. Our query in any species X yielded three possible scenarios ( fig. 2أ ). First, the presence of both orthologs that shared sequences could suggest the conservation of alternative DNA processing. Second, the presence of only the ortholog of A would suggest the creation of novel gene B via the reuse of a subset of existing segments for gene A after the divergence of species X. Another possibility in this case is that B was created before the divergence of species X but later lost from species X. Third, the absence of either ortholog would suggest that both genes were created after the divergence of species X. If no other species contains either ortholog, this would suggest that both genes were new to the Oxytricha lineage and that an intermediate species with just one gene should exist but was not included in our survey.

The presence of alternative DNA processing is associated with the emergence of new genes. ( أ ) Inference of the origin of alternative MDS processing based on the presence of orthologs and MDS sharing in other ciliates. ( ب ) Mapping of all cases of alternative MDS processing onto a phylogeny generated from 100 bootstrap replicates with PhyML (with the HKY85 substitution model) based on a MAFFT concatenated multiple sequence alignment of 18S and 28S rRNA genes from 8 ciliate species, including 2 Oxytricha trifallax strains. The tree is rooted with Euplotes crassus . All bootstrap values are above 90%. The scale below the phylogeny illustrates branch substitutions per site. Numbers in red at the tree nodes represent the inferred numbers of cases of alternative processing that emerged before the divergence at each node. The numbers in parenthesis indicate corrected values after examining individual phylogenetic trees, which reveal the loss of paralogs in a few cases.

The presence of alternative DNA processing is associated with the emergence of new genes. ( أ ) Inference of the origin of alternative MDS processing based on the presence of orthologs and MDS sharing in other ciliates. ( ب ) Mapping of all cases of alternative MDS processing onto a phylogeny generated from 100 bootstrap replicates with PhyML (with the HKY85 substitution model) based on a MAFFT concatenated multiple sequence alignment of 18S and 28S rRNA genes from 8 ciliate species, including 2 Oxytricha trifallax strains. The tree is rooted with Euplotes crassus . All bootstrap values are above 90%. The scale below the phylogeny illustrates branch substitutions per site. Numbers in red at the tree nodes represent the inferred numbers of cases of alternative processing that emerged before the divergence at each node. The numbers in parenthesis indicate corrected values after examining individual phylogenetic trees, which reveal the loss of paralogs in a few cases.

Because we never observed a case where both orthologs are present but they do not share MDSs, we conclude that the emergence of alternative MDS processing is associated with the creation of new genes (gene B) from an existing gene (gene A), by reuse of some of gene A’s germline precursor segments. We mapped the number of new genes created in each lineage onto a phylogeny ( fig. 2ب ). All examples appear to have originated in the stichotrich lineages (i.e., none are conserved in Euplotes ) and a large number (28) appear specific to the Oxytricha lineage and thus probably emerged fairly recently. This is a parsimonious estimate, given the possibility that some genes could have emerged earlier but been lost in some species. Corrections are discussed in the next section. In cases where two orthologs share MDSs, the length of the shared regions is usually conserved relative to that in Oxytricha (all but 4 are similar within 50 bp or 10%, whichever is larger, of the length of the shared gene segments in Oxytricha ).

Most Alternative MDSs Derived from Segmental Duplications

For each group of Oxytricha genes that share MDSs with each other, we compared the unique alternative MDS sequences, that is, the regions (often the 5′ or 3′ ends) that differ from each other in the mature chromosomes, with each other. The majority of these (54 out of 69 cases) are more than 40% similar at the protein level (BLASTP, alignment length >80% of the unique regions and ه -value <1e-10 Camacho et al. 2009 ), suggesting that the new, alternative segments arose by duplication of ancestral MDSs. Duplication of partial gene loci most likely occurred, instead of entire genes. It is also possible that duplication of complete gene loci was followed by partial loss of gene regions, resulting in the requirement for sharing of the missing segments (similar to a proposed model for the origin of scrambled genes Gao et al. 2015 ), although careful examination of neighboring MIC sequences did not reveal traces of degenerate or lost duplicate copies of the constitutive MDSs. Figure 3أ shows the germline MDS–IES map for two paralogous genes with shared MDSs. Their germline precursor loci overlap, with the alternatively spliced MDSs downstream of the shared, constitutive MDSs. Figure 3ب shows a translated alignment of the somatic versions of both sequences. The boundaries between segments 6 and 7 in the duplicated, alternative regions are precisely conserved in location between the two genes, including short regions of microhomology at recombination junctions (marked by the overlap between consecutive MDSs). The boundaries between segments 8 and 9 in the pink gene and segments 7 and 8 in the gray gene differ in location by just 1 bp, and the boundaries between segments 9 and 10 in the pink gene and 8 and 9 in the gray gene differ by just 3 bp. This suggests that the germline duplication preserved MDS junctions and then two new IESs were inserted into the pink gene after duplication.

Duplication is the major mechanism for creation of alternative gene segments. ( أ ) Germline map of a locus with two nonscrambled genes that share five DNA segments at the 5′ end. Arrows represent MDSs and gaps represent IESs. Gray: Contig8.0 pink: Contig22835.0. ( ب ) Translated alignment (nucleotide alignment guided by amino acid sequence) of the MAC contigs from Panel A showing paralogy between the duplicated MDSs downstream of MDS 5 (MDS 1–5 are shared) and that the locations of MDS boundaries are conserved between the two paralogs (conserved precisely between MDS 6 and 7 in both pink and gray 1 bp different in location between MDS 8 and 9 in pink and MDS 7 and 8 in gray 3 bp different between MDS 9 and 10 in pink and MDS 8 and 9 in gray). Unique bases or gaps on each sequence are annotated with a vertical black bar, and identical regions are highlighted in light gray. Wide arrows in different colors represent exons (labeled as CDS, yellow), introns (white), start and stop codons, and MDSs. The overlaps between MDSs contain short regions of microhomology at recombination junctions. ( ج ) A maximum-likelihood tree, constructed using the alternative MDS regions of two paralogous genes that share MDSs, shows accelerated evolution of gene B after MDS duplication. Gene A: Contig13046.0 gene B: Contig12964.0. The phylogeny, rooted with the Urostyla ortholog, was generated by PhyML with a single substitution rate category and the JTT substitution model, optimized for tree topology and branch length. Numbers at the tree nodes indicate bootstrap values for 100 replicates. The multiple sequence alignment was produced with MAFFT v6.956b (default parameters) and trimmed with trimAl v1.2 with the “-automated1” parameter to remove excess gaps and poorly aligned regions. The scale below the phylogeny illustrates branch substitutions per site.

Duplication is the major mechanism for creation of alternative gene segments. ( أ ) Germline map of a locus with two nonscrambled genes that share five DNA segments at the 5′ end. Arrows represent MDSs and gaps represent IESs. Gray: Contig8.0 pink: Contig22835.0. ( ب ) Translated alignment (nucleotide alignment guided by amino acid sequence) of the MAC contigs from Panel A showing paralogy between the duplicated MDSs downstream of MDS 5 (MDS 1–5 are shared) and that the locations of MDS boundaries are conserved between the two paralogs (conserved precisely between MDS 6 and 7 in both pink and gray 1 bp different in location between MDS 8 and 9 in pink and MDS 7 and 8 in gray 3 bp different between MDS 9 and 10 in pink and MDS 8 and 9 in gray). Unique bases or gaps on each sequence are annotated with a vertical black bar, and identical regions are highlighted in light gray. Wide arrows in different colors represent exons (labeled as CDS, yellow), introns (white), start and stop codons, and MDSs. The overlaps between MDSs contain short regions of microhomology at recombination junctions. ( ج ) A maximum-likelihood tree, constructed using the alternative MDS regions of two paralogous genes that share MDSs, shows accelerated evolution of gene B after MDS duplication. Gene A: Contig13046.0 gene B: Contig12964.0. The phylogeny, rooted with the Urostyla ortholog, was generated by PhyML with a single substitution rate category and the JTT substitution model, optimized for tree topology and branch length. Numbers at the tree nodes indicate bootstrap values for 100 replicates. The multiple sequence alignment was produced with MAFFT v6.956b (default parameters) and trimmed with trimAl v1.2 with the “-automated1” parameter to remove excess gaps and poorly aligned regions. The scale below the phylogeny illustrates branch substitutions per site.

Phylogenetic tree reconstruction using just the alternative MDSs permits visualization and inference of the duplication events. Figure 3ج shows a phylogeny based on the unique regions of two paralogous genes with shared MDSs. The phylogeny suggests that duplication of the alternative MDS region occurred after the divergence of Paraurostyla , and that gene B evolved faster than gene A post duplication. There are 11 cases where the phylogenetic analysis suggests that the duplication occurred earlier than would be inferred based on ortholog presence and that one copy was lost in some lineages. The numbers in parenthesis in figure 2ب show the corrected numbers of inferred origins after examining individual phylogenetic trees.

There are 15 cases where the alternative MDSs show no similarity at the protein level (BLASTP, e-value cutoff 1 e-6), suggesting that they did not arise through duplication. These alternative MDSs could be derived from MIC-limited mobile elements, although their sequences do not correspond to any known transposons in Oxytricha . The lower GC content of some of these segments suggests that they could even be derived from retention of MIC-limited noncoding sequences in the MAC (as demonstrated between strains in Möllenbeck et al. 2006 , and experimentally in Fang et al. 2012 ). For 9 of the 15 cases, no stichotrich species contains just one ortholog (precluding our ability to distinguish ancestral from novel genes) however, we could unambiguously assign the novel gene in the other 6 examples (i.e., gene B in fig. 2أ ). Among these, the GC content of the alternative regions in five genes (0.261, 0.305, 0.306, 0.310, 0.310) falls below the lower quartile among all genes in the MAC genome (0.313), suggesting that they may have been acquired from MIC-limited noncoding sequences, which typically have a lower GC content (average 0.284) than the MAC genome.

Evolution of Alternative and Constitutive MDSs

We compared the substitution rates between alternative and constitutive MDSs by using amino acid divergence and the ratio of nonsynonymous to synonymous substitution rates (d نس ). Because the divergence levels among the ciliate species are so high that the rate of synonymous substitutions per synonymous site (d س ) is highly saturated, we used the comparison between two س. trifallax laboratory strains, JRB310 and JRB510, to infer the d نس ratio. We sequenced and assembled the macronuclear genome of the O. trifallax strain JRB510 and compared it with the MAC genome of strain JRB310 reported by Swart et al. (2013) . The distance between these strains is suitable for calculating d نس ratios (median dN: 0.0097 median dS: 0.15 median d نس : 0.066). The d نس ratios between JRB310 and JRB510 orthologs only represent evolutionary rates after divergence of the two strains, but not immediately after the formation of new genes. We find that alternative MDSs evolve faster than shared MDSs, with higher amino acid substitution rates ( fig. 4أ , Wilcoxon signed-rank test, ص = 6.21e-09). There is no significant difference between synonymous substitution rates ( fig. 4ب , ص = 0.173), but the nonsynonymous substitution rates of alternative MDSs are significantly higher ( fig. 4ج , ص = 3.3e-6), as well as the d نس ratios ( fig. 4د , ص = 3.89e-8). This faster substitution rate is consistent with either stronger functional constraints on the shared regions or, conversely, either weaker selective constraints on the alternative MDSs or greater functional divergence. Shared, constitutive MDSs are intrinsically more constrained because they are translated in more than one gene product, whereas alternative MDSs should have more opportunity to diverge.

Substitution rates for alternative versus shared gene segments. ( أ ) Amino acid substitution rates of alternative versus constitutive MDSs. ( ب ) Synonymous substitution rates (d س ) of alternative versus constitutive MDSs. ( ج ) Nonsynonymous substitution rates (d ن ) of alternative versus constitutive MDSs. ( د ) d نس values of alternative versus constitutive MDSs.

Substitution rates for alternative versus shared gene segments. ( أ ) Amino acid substitution rates of alternative versus constitutive MDSs. ( ب ) Synonymous substitution rates (d س ) of alternative versus constitutive MDSs. ( ج ) Nonsynonymous substitution rates (d ن ) of alternative versus constitutive MDSs. ( د ) d نس values of alternative versus constitutive MDSs.

Potential Functional Divergence of Genes with Shared MDSs

Newly created genes sometimes undergo functional divergence (neofunctionalization or subfunctionalization) to acquire different cellular roles, especially genes that arise through duplication ( Zhang 2003 Conant and Wolfe 2008 ). Similarly, functional divergence could be possible for genes with alternative MDSs that arise through duplication or other mechanisms. We investigated whether the new genes that emerged from alternative MDS processing have evolved either different domain organization or expression patterns. Protein domain analysis did not identify any novel combinations of protein domains in our data set of 69 cases. Instead, the unique MDSs for each group either do not contain any recognizable protein domains or encode the same protein domains.

Although the DNA copy number for genes with shared MDSs is usually similar to each other (only four show a difference above 3-fold fig. 5أ ), their overall RNA expression levels differ greatly across all time points during macronuclear development ( Swart et al. 2013 ) (only nine show a difference below 2-fold fig. 5ب ), suggesting the possibility of distinct or specialized roles. We also compared the expression profiles for genes with shared MDSs by assessing whether their gene expression levels peak at the same time point. We excluded genes that have total normalized expression levels below ten (i.e., ten normalized RNA-seq reads per kb, represented by the dashed dotted vertical line in fig. 5ب ), because low expression may affect the accuracy of the peak analysis. This filter excluded 1 out of 32 cases of genes with shared 5′ DNA regions, 15 out of 31 groups of genes with shared 3′ regions (a higher percentage because RNA-seq is biased toward the 3′ end of a transcript due to poly(A) enrichment during Oligo(dT) priming, but only RNA-seq reads mapping to 5′ ends were scored for these genes), and 2 out of 6 cases of genes that share both 5′ and 3′ regions. For these excluded genes, we verified that their expression is higher than ten normalized RNA-seq reads per kb at other nondevelopmental time points, to exclude the possibility that they are nonfunctional pseudogenes. Among the remaining 31 cases with shared 5′ regions, only 9 show expression peaks at the same time point, and the other 71% have different peaks of expression, consistent with possible functional divergence of the latter cases. Among the remaining 16 cases with shared 3′ regions, only 3 cases have gene expression peaks at the same time point, also suggesting the opportunity for functional divergence among the other 13 cases (81%). Two of the remaining four groups of genes that share both 5′ and 3′ regions have gene expression peaks at the same time point (50%). الشكل 5جه show distinct expression profiles of genes with shared 5′ or 3′ regions, or both, and that passed the expression filter, suggesting that some new genes created by alternative DNA processing may have undergone functional divergence.

Divergent expression profiles of genes that share precursor segments. ( أ ) DNA copy number of genes that share MDSs. For each group of genes that share MDSs, the lowest copy number is plotted on the x -axis and the highest copy number on the ذ -محور. The solid, dashed, and dotted lines represent ذ = x , ذ = 2 x ، و ذ = 3 x ، على التوالى. ( ب ) Total expression level of genes that share MDSs across a developmental time course. Gene expression levels are represented by a number of normalized RNA-seq counts per kb. The three lines ذ = x , ذ = 2 x ، و ذ = 3 x are as in Panel A. The dashed dotted vertical line represent the cutoff of total expression level of ten normalized RNA-seq reads per kb. ( ج ) Gene expression profiles of 31 groups of genes that share 5′ regions. The developmental time course includes six time points: Vegetative, asexually growing stage (Veg) and 0, 10, 20, 40, 60 h post mixing of compatible mating types (strains JRB310 and JRB510) to initiate conjugation and macronuclear development. ( د ) Gene expression profiles of 16 groups of genes that share 3′ regions. ( ه ) Gene expression profiles of four groups of genes that share both 5′ and 3′ regions.

Divergent expression profiles of genes that share precursor segments. ( أ ) DNA copy number of genes that share MDSs. For each group of genes that share MDSs, the lowest copy number is plotted on the x -axis and the highest copy number on the ذ -محور. The solid, dashed, and dotted lines represent ذ = x , ذ = 2 x ، و ذ = 3 x ، على التوالى. ( ب ) Total expression level of genes that share MDSs across a developmental time course. Gene expression levels are represented by a number of normalized RNA-seq counts per kb. The three lines ذ = x , ذ = 2 x ، و ذ = 3 x are as in Panel A. The dashed dotted vertical line represent the cutoff of total expression level of ten normalized RNA-seq reads per kb. ( ج ) Gene expression profiles of 31 groups of genes that share 5′ regions. The developmental time course includes six time points: Vegetative, asexually growing stage (Veg) and 0, 10, 20, 40, 60 h post mixing of compatible mating types (strains JRB310 and JRB510) to initiate conjugation and macronuclear development. ( د ) Gene expression profiles of 16 groups of genes that share 3′ regions. ( ه ) Gene expression profiles of four groups of genes that share both 5′ and 3′ regions.


We acknowledge funding of this research project by the Research Council of Norway (RCN) and the University of Hamburg (Hamburg, Germany). We are grateful to Prof. C. Benning (Michigan State University, East Lansing, United States) for providing the expression vector pNoc ox Venus. We also would like to thank Elke Wölken (Department of Aquatic Ecophysiology and Phycology, University of Hamburg) for analyses of immunogold-labeled N. oceanica transformants by transmission electron microscopy.

aa, amino acid ALNS, allantoin synthase ASW, artificial sea water At, نبات الأرابيدوبسيس thaliana CaMV, cauliflower mosaic virus DC, decarboxylase DECR, 2,4-dienoyl-CoA reductase DHNS, 1,4-dihydroxy-2-naphthoyl-CoA synthase dpt, days post transformation EMB8, embryogenesis-associated protein 8 EPA, eicosapentaenoic acid EYFP/GFP, enhanced yellow/green fluorescent protein HIT, histidine triad family protein HIUase, 5-hydroxyisourate hydrolase IndA, indigoidine synthase A MDH, malate dehydrogenase MLS, malate synthase Ng, Nannochloropsis gaditana OHCU, 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline PEX, peroxin PfkB, 6-phosphofructokinase PGL3, 6-phosphogluconolactonase 3 PKT, peroxisomal 3-ketoacyl thiolase PTS1/2, peroxisomal targeting signal type 1/2 PUFA, polyunsaturated fatty acid PUKI, pseudouridine kinase PUMY, pseudouridine monophosphate glycosylase TEM, transmission electron microscopy.


الملخص

β-defensins (BD) are the largest family of vertebrate defensins with potent antimicrobial, chemotactic and immune-regulatory activities. Four BD genes (BD1-4) have been cloned previously in rainbow trout but none have been reported in other salmonids. In this study seven BD genes (BD1a-b, 2–4, 5a-b) are characterised in Atlantic salmon and additional BD genes (BD1b and BD5) in rainbow trout. Bioinformatic analysis revealed up to seven BD genes in the genomes of other salmonids that belong to five subfamilies (BD1-5) due to whole genome duplications. BD1-2 and BD4-5 are also present in basal teleosts but only BD1 and/or BD5 are present in advanced teleosts due to loss of one chromosomal locus. BD3 is salmonid specific. Fish BD have a unique three-coding exon structure. Fish BD are highly divergent between subfamilies but conserved within each subfamily. Atlantic salmon BD genes are differentially expressed in tissues, often with low level expression in systemic immune organs (head kidney and spleen) yet with at least one BD gene highly expressed in mucosal tissues, heart, blood and liver. This suggests an important role of these BD genes in innate immunity in mucosa, liver and blood in Atlantic salmon.


شاهد الفيديو: Webinar: Retrieving Exon and Coding Region Sequences for Genes (كانون الثاني 2022).