معلومة

خوارزميات التمهيدي Dimer / Hairpin


ما هي الخوارزميات / الطرق المستخدمة لحساب ثنائيات التمهيدي ودبابيس الشعر؟

على سبيل المثال ، ستقوم أداة OligoAnalyzer الخاصة بـ IDT بإنشاء هذه التحليلات في ضوء تسلسلات معينة.

يبدو لي أن تحليل homo-dimer هو مجرد مسح منزلق لمتتابعين عبر بعضهما البعض. أفترض أن هذا لا يأخذ في الاعتبار مشاكل دبوس الشعر المحتملة؟ أو أن مثل هذه الهياكل أقل احتمالًا مقارنة بعدد لا يحصى من المشكلات الأخرى الأكثر شيوعًا. بالإضافة إلى ذلك ، كيف يتم حساب قيم ΔG مع الأخذ في الاعتبار نمط ثنائي الأبعاد معين؟


من المهم تصور المزيد من الوجوه لتصميم تجارب التمهيدي أو oligo و PCR:

- حساب المعلمات الديناميكية الحرارية لتهجين الحمض النووي (Oligo / Template)

  • حساب حلقة دبوس الشعر ، و dimer ، وقواعد القاعدة ودرجة حرارة الانصهار حول التمهيدي أو التمهيدي الزوجي

  • احسب إحصائيات حول درجة حرارة الانصهار مع التغيير في التركيب وخلط تركيز PCR

مع google ، يمكنك العثور على المزيد من الأدوات ولكن يجب عليك اختيار أداة لفريق التسلسل. تستخدم جميع الأدوات تقريبًا خوارزمية mfold ، فهي بسيطة وفعالة:

إم زوكر ودي إتش ماثيوز ودي إتش تيرنر. الخوارزميات والديناميكا الحرارية للتنبؤ بالهيكل الثانوي للـ RNA: دليل عملي في الكيمياء الحيوية والتكنولوجيا الحيوية ، 11-43 ، J. Barciszewski و B. F.C Clark ، محرران. ، الناتو ASI Series، Kluwer Academic Publishers، Dordrecht، NL، 1999.

عملت في فريق التسلسل وكان هناك مبرمج. طور أدوات رائعة. إنه يتحدث الإنجليزية قليلاً ، لكن يمكنه دعمك: http://promix.cribi.unipd.it/cgi-bin/promix/melting/melting_main.exe


علم الأحياء: التمهيدي ديمر

أ التمهيدي ديمر (PD) منتج ثانوي محتمل في تفاعل البلمرة المتسلسل (PCR) ، وهي طريقة بيوتكنولوجية شائعة. كما يوحي اسمها ، يتكون PD من جزيئين تمهيديين تم ربطهما (مهجنين) ببعضهما البعض بسبب سلاسل القواعد التكميلية في البادئات. نتيجة لذلك ، يضخم بوليميراز الحمض النووي PD ، مما يؤدي إلى التنافس على كواشف PCR ، وبالتالي يحتمل أن يثبط تضخيم تسلسل الحمض النووي المستهدف لتضخيم PCR. في PCR الكمي ، قد تتداخل PDs مع القياس الكمي الدقيق.


تشغيل AutoDimer

1. قم بإعداد ملف إدخال يحتوي على اثنان على الأقل التسلسلات التي تتبع تنسيق ملف الإدخال.

ملاحظة: أنت يجب استخدام ملف الإدخال. لا يمكن إدخال التسلسلات يدويًا في مربع النص الأزرق.

2. فتح ملف من قائمة "ملف".

3. تأكد من قراءة العدد المناسب من التسلسلات من خلال مراجعة "مربع عدد التسلسلات".

4. إذا رغبت في ذلك ، قم بتغيير معلمات النتيجة ، [+ Na] أو تركيز حبلا الحمض النووي الكلي (Cتي).

5. انقر فوق "Primer Dimer Checker" أو "Hairpin Checker" سيشير المقياس إلى التقدم.

6. يتم عرض الهياكل المحتملة في مربع النص في الجزء السفلي من شاشة البرنامج.

7. إذا كنت ترغب في حفظ نتائج الفرز ، انتقل إلى "ملف" و "حفظ باسم". يمكن فتح المعلومات لاحقًا في Word و Excel و Notebook وما إلى ذلك.

8. يمكن أيضًا طباعة النتائج مباشرةً من برنامج AutoDimer.

أثناء تشغيل الخوارزمية ، يقوم AutoDimer بحفظ الملفات المؤقتة على محرك الأقراص "C" (C: ). يقوم بمسح هذه الملفات عند الخروج من البرنامج. ومع ذلك ، إذا قمت بتحميل البرنامج على محرك أقراص D ، E (غير C) أو إذا كان محرك الأقراص "C" ممتلئًا ، فستواجه مشكلات في تشغيل البرنامج.

يرجى إرسال التعليقات أو الاقتراحات الخاصة بقاعدة البيانات هذه إلى فريق STRBase على [email protected]

لقد بذلنا وسنواصل بذل جهود كبيرة لضمان دقة واكتمال البيانات المدرجة في قاعدة بيانات STR هذه. ستتم إضافة المعلومات من وقت لآخر للحفاظ على هذا الموقع محدثًا قدر الإمكان. لا يتحمل المعهد الوطني للمعايير والتكنولوجيا (NIST) بأي حال من الأحوال المسؤولية عن المعلومات المقدمة من خلال هذا الموقع ، بما في ذلك الارتباطات التشعبية لمصادر المواد التجارية. تم تحديد بائعين تجاريين معينين في موقع الويب هذا لإفادة مجتمع كتابة الحمض النووي. لا يعني هذا التحديد بأي حال من الأحوال توصية أو تأييد من NIST ولا يعني بالضرورة أن المواد أو الأداة أو المعدات المحددة هي بالضرورة أفضل ما هو متاح لاختبار الهوية البشرية.

يوافق جميع المستخدمين على أن الوصول إلى هذا الموقع واستخدامه وعلى أي موقع مرتبط بهذا الموقع ومحتوياته يكون على مسؤوليتهم الخاصة. لا يتحمل المعهد الوطني للمعايير والتكنولوجيا (NIST) ولا مسؤول الموقع الخاص بقاعدة بيانات STR DNA على الإنترنت المسؤولية أو المسؤولية عن محتوى الصفحات خارج هذا الموقع.


المواد والأساليب

افتراض

لإنشاء بيانات تدريب على RNN ، تم تخطيط تفاعل PCR بالكامل بشكل تخطيطي. (الشكل & # x000a0 1). لا يقتصر ارتباط التمهيدي بالقالب على طوله الكامل ويفترض أنه قد يتم ربط جزء فقط من 3 & # x02032 (الشكل & # x000a0 1 ب). يُفترض أن تكون بنية دبوس الشعر الخاصة بالبرايمر وثنائياته قد تشكلت قبل ربط التمهيدي بالقالب (الشكل & # x000a0 1 ب). وبالتالي ، يُفترض أن تخليق الحمض النووي يحدث من بعض هياكل دبوس الشعر وثنائياتها 21 ، 22. مع استمرار توليف الحمض النووي من الاشعال المرتبط جزئيًا ، بدأ تصنيع منتجات PCR المكملة تمامًا للبادئات (الشكل & # x000a0 1 C). في النهاية ، تصبح معظم منتجات PCR مكملة تمامًا للبادئات (الشكل & # x000a0 1 D).

رسم تخطيطي لعملية PCR للاشعال مع تجانس غير كامل مع القالب. رسم تخطيطي للتفاعل الذي يفترضه تفاعل البوليميراز المتسلسل من البادئات المتطابقة جزئيًا. قد يبدأ استطالة الحمض النووي من البادئات التي تتطابق معها جزئيًا 3 & # x02032-end (ب). في نهاية الدورة الثانية ، تتطابق النهاية 3 & # x02032 للحمض النووي الممدود تمامًا مع التمهيدي (ج). في نهاية الدورة الثالثة ، يتم مطابقة الحمض النووي المركب تمامًا على طرفي الحمض النووي المركب (د).

للتعبير عن علاقات هذه المخططات ككلمات ، قررنا التعبير عن دبوس الشعر ، وثنائي التمهيدي ، ورابط القالب التمهيدي ، ورابط منتج PCR التمهيدي ككلمات. تؤثر قوة رابطة القالب التمهيدي على الجانبين الأمامي والخلفي بشكل كبير على إنشاء تفاعل PCR. بالنسبة للتركيبات التي ليست من قالب التمهيدي الأصلي ، يجب تحديد موضع الربط بواسطة PCR من الارتباط المحتمل لقوالب التمهيدي المتعددة. مع هذا ، قمنا ببناء الكلمات لتعلم RNN.

قوالب PCR

تم تصنيع جزء من تسلسل النوكليوتيدات 16S rRNA (v6-v8) (الملحق 1 ، الجدول 1) بواسطة OE-PCR (الملحق 1 ، الجدول 2) لـ 30 phyla كقوالب لتجارب نموذج PCR. من بين 30 شعبة ، تم تصنيع متواليات الرنا الريباسي 16S في Firmicutes إلى جنسين ، Bacillus و Calditerricola. كانت هذه التسلسلات مختلفة بشكل كبير في v6-v8. تم تحضير واحد وثلاثين من الحمض النووي المزدوج الذي تقطعت به السبل مع 435 إلى 481 قاعدة كقالب لتجربة نموذج PCR باستخدام مؤشر الديناميكا الحرارية القياسي.

تجربة PCR كبيانات أساسية لتصميم التمهيدي باستخدام RNN

تصميم مجموعات التمهيدي للتعلم الأولي لـ RNN

لقد صممنا 72 مجموعة من بادئات PCR القادرة على تضخيم 31 قالبًا من قوالب الحمض النووي ، وفقًا لخصائص تسلسل التمهيدي للقالب المحدد وحجم التضخيم لحوالي 100 & # x02013150 (الجدول & # x200B (الجدول 1). 1). في تجربة أولية عندما تم تصميم الاشعال باستخدام برنامج التصميم التمهيدي Primer3 ، قامت جميع البادئات بتضخيم جميع القوالب الـ 31 (البيانات غير معروضة). من نتائجه ، قمنا بتصميم 72 مجموعة من بادئات PCR في هذه المرحلة متجاهلين بعض درجات حرارة التلدين المعروفة تقليديًا وبعض المؤشرات مثل تجنب تكرار قاعدة واحدة. تم ضبط حجم البرايمر على 19 & # x0201322 قاعدة. المؤشر الأكثر أهمية هو التشابه العالي للقالب المستهدف والتماثل المنخفض للآخرين.

الجدول 1

مجموعات التمهيدي للتجربة الرئيسية.

التمهيدي لا.اسم التمهيديتسلسل
1الهدف_1fجتككاججكتكاكاكاتجكتا
الهدف_22rتجتاككاكتتكاتجاكجتج
2الهدف_71fاجكجكاكككتكاككتاتجت
الهدف_94rGGGACCGGATTTTGAGATTAG
3الهدف_122fTTCAGTGGGCACTCGTAAGGA
الهدف_94rGGGACCGGATTTTGAGATTAG
4الهدف_94كتاتكتكاكاااتككجتككك
الهدف_143rكتكاكجاجتتكاككتاجت
5الهدف_94كتاتكتكاكاااتككجتككك
الهدف_147rكتكاكككككتكاكجاجتتك
6الهدف_161fGAGGTGGAGCGAATCCCAGAAA
الهدف_194rCTTACCAAGCATACCTTAGGCA
7الهدف_263fCAAATCCCAGAAAGCCGCTCTC
الهدف_250rأكاجكككتجككجتكجكجككت
8الهدف_348fجتتجككتاجكاتاجاتكت
الهدف_282rتجكتجكككتكتجتكتاتجككات
9الهدف_386fجكتجاججاكتاتجاكتج
الهدف_394rAGACAGCTTTAAGGATTCC
10الهدف_386fجكتجاججاكتاتجاكتج
الهدف_461rCCGATCCGGACTGAGACAGCTT
11الهدف_394fGGAAATCCCTTAAAAGCTGTCT
الهدف_436rكجاجكجتكتتججتاكتككتج
12الهدف_468fGGCGGAGGAAATCCTAAAACT
الهدف_515rكتكاجاتاكتكججتجكجاك
13الهدف_555fأكججاكتجككجكجااجكج
الهدف_562rGGGCCCACCTTTTGCGATTAG
14الهدف_599fجتجكتاكاكججتاجكجاك
الهدف_652rCCGCCGAGGCGGAGTTGGTCA
15الهدف_764fكتاتككتتجتجككاجكجت
الهدف_744rكجاكاتاكتتاتجاجتككجك
16الهدف_812fCTGCCAGTGATAAACTGGAGGA
الهدف_744rكجاكاتاكتتاتجاجتككجك
17الهدف_842fTCTCATAAAACCGTTCTCAGTT
الهدف_848rتجتاكااكتكتكجتجتجتج
18الهدف_1016fكتاتكججاااجككجككتك
الهدف_1036rأتجاتاكاككتتججكجكت
19الهدف_1209fجتكججتاجتاكاجتجتكت
الهدف_1159rأتجتكجتجككاتجتاجكجت
20الهدف_1248fكجككجتجاككجكجاججاجاج
الهدف_1193rCCGCGCCATGGCTGATACGCGG
21الهدف_1175fتكجككتااكجتجتكتكاجتج
الهدف_1264rتككاجتكجكجكككتجككت
22الهدف_1177fGCCTAAACGTGGTCTCAGTGCA
الهدف_1264rتككاجتكجكجكككتجككت
23الهدف_1316fCTAGTGGGACAGCCGGAGTAAT
الهدف_1285rتجكآتككجاكتاجاكاج
24الهدف_1332fCCGAGTAATCCGAGGAAGGT
الهدف_1276rAGGTTTTTGAGGTTGGCTCACT
25الهدف_1285fكتجتكتتاجتكجاتجكا
الهدف_1293rجكتكتجكاجااككجاكتتك
26الهدف_1401fتجاجتجتكجكتاجتككا
الهدف_1368rجكتاجكتجككتكتكتجتككككك
27الهدف_1401fتجاجتجتكجكتاجتككا
الهدف_1383rتتججاتاجكاتاكجتكاك
28الهدف_1415fجاجتجتكجكتاجتككات
الهدف_1368rجكتاجكتجككتكتكتجتككككك
29الهدف_1447fاجتكاتجكتجاجاكتكتجا
الهدف_1368rجكتاجكتجككتكتكتجتككككك
30الهدف_1447fاجتكاتجكتجاجاكتكتجا
الهدف_1391rTTCGATCCGAACTGAGAGAGGA
31الهدف_1391fتككتكتكتكاجتكجاتكجا
الهدف_1465rككتاجاكجاتككتجكجت
32الهدف_1549fججتاتجككججتاكاكاج
الهدف_1504rكاتجتكككتجككاكتجتاجكج
33الهدف_1504fكجكتاكاجتجكاجاكاتج
الهدف_1550rتاجكتكجججاكتككاتجا
34الهدف_1758fGCCAATACAAACAGTGCAAAT
الهدف_1775rتاككاجكتكاتاجتتجاكج
35الهدف_1770fكتجتااجتجتكتكاجتكج
الهدف_1775rتاككاجكتكاتاجتتجاكج
36الهدف_1770fكتجتااجتجتكتكاجتكج
الهدف_1811rكتكككتاجاكاتجكجكتككت
37الهدف_1948fCAAAGGCAGCGACATAGTGAT
الهدف_1984rأتجاجككجتاجكتجاتجككات
38الهدف_2085fAGTACAGAAGGTAGCAAGATCG
الهدف_2138rاكجتاتكاكجكجتاتجك
39الهدف_2109fجاتجاغكااتككتااجكت
الهدف_2164rتكاكجاكتاجتااكا
40الهدف_2292fGGTTAAGTCCCCTAACGAGCGA
الهدف_2247rأتجاكتتجكاجككتاجكاكج
41الهدف_2547fتكجاكتاكاتجاغتججاتك
الهدف_2581rتاكجتاجككتجكتاكتكا
42ai2_1242_fتاكتجتكتاكجاجاكتجكك
ai2_1242_rCGAACTGAGACCAACTTTACAG
43ai2_100_fأكجككججاججاجاج
ai2_100_rأككككججااكجتاتكاكك
44ai2_1213_fكتاكاكككتجتكجتجتجكاج
ai2_1213_rتاجكتكجججاكتككاتجا
45ai2_1325_fتاججاكتجككككجاتاك
ai2_1325_rجكجكتتكتجاجاتكجكتكاج
46ai2_6_fكاجتكجاجكجاجاجات
ai2_6_rجتاتاكككاتككتتكجات
47ai2_1194_fGCGGGTGACCGTATGCTAATCC
ai2_1194_rCTTGCGGTTACGTACTTCAGGT
48ai2_1315_fكجتجكتاجكتجكاجتكات
ai2_1315_rGCGGCTCCGGCGACTTCGGATG
49ai2_1147_fكجككجتجاككجكجاججاجاج
ai2_1147_rكاكتجاجاككاكجتتاجكجا
50ai2_23_fجاجاكتجككجتجاكاكاك
ai2_23_rAGTTGCAGACTCCAATCCGGA
51ai2_1244_fGCCAATACAAACAGTGCAAAT
ai2_1244_rتاككاجكتكاتاجتتجاكج
52ai2_1125_fأكجكتجكاككككجكجاججت
ai2_1125_rتججكجكتجكتككتكتجكجت
53ai2_1238_fجكاكاجتجتجكاكجككجت
ai2_1238_rGGCATAAGGGCACGAGTACCT
54ai2_1166_fCCGAGTAATCCGAGGAAGGT
ai2_1166_rتجكآتككجاكتاجاكاج
55ai2_1143_fتجككجككجتجاككجكجاججا
ai2_1143_rكاكتجاجاككاكجتتاجكجا
56ai2_1124_fأكجكتجكاككككجكجاججت
ai2_1124_rأجكجكاككجاكتكتاجتكا
57ai2_1284_fأكجاكتجككتججتتااكا
ai2_1284_rAGCTTTAAGGATTGCTCCATC
58ai2_1288_fCTGCCTGGTTAACCAGGAGGA
ai2_1288_rGAACTGGGCCAGCTTTAAGGA
59ai2_1090_fAAAGGAGACTGCCAGTGATAAA
ai2_1090_rتككاتككجاكتاكجاكاتاك
60ai2_1142_fجتكججتاجتاكاجتجتكت
ai2_1142_rكاكتكككككتكاكجججكج
61ai2_1195_fGCGGGTGACCGTATGCTAATCC
ai2_1195_rككتاجاكجاتككتجكجت
62ai2_101_fجتكجتكجتكاجكتكجتجكك
ai2_101_rCTCCTTCCTCCGCCTCGTC
63ai2_1189_fكجتكجتاجاتجتجاجاجت
ai2_1189_rTTCGATCCGAACTGAGAGAGGA
64ai2_1088_fكتاتككتتجتجككاجكجت
ai2_1088_rتككاتككجاكتاكجاكاتاك
65ai2_1192_fGGGGGTACAGAAGGCAGCTAGC
ai2_1192_rCTTGCGGTTACGTACTTCAGGT
66ai2_1303_fGCCATAACGCCGTGAATACGTT
ai2_1303_rCTTCATCCTAGTCATCAGCCTC
67ai2_1102_fAAGTTGGGCAGTCTAAGGTGAC
ai2_1102_rتكتجكاجكتكتتجتاككجتك
68ai2_54_fكججتجاجتااكاكجتاتكتا
ai2_54_rتكتكاجتكجكتاكجتاتكات
69ai2_1275_fتجاتجاجكجاتكككا
ai2_1275_rجكتجككتككتجكاجكاجت
70ai2_1327_fCTGAGCGAATCTCAGAAAGCGC
ai2_1327_rتكجكتججتججككككجك
71ai2_10_fكتجكجكجتجاتاجاكا
ai2_10_rأتججكتاتكككككتكاج
72ai2_1071_fاجكجاتجكككككجكاكجج
ai2_1071_rكتجكككجتاجكتكككجكجا

يتم عرض رقم زوج التمهيدي واسم التمهيدي وتسلسل القاعدة (5 & # x02032 & # x02009 & # x02192 & # x020093 & # x02032) المستخدمة في تجارب تدريب RNN. يتم استخدام مواد التمهيدي التي لها نفس رقم زوج التمهيدي كمجموعة من البادئات.

قمنا أيضًا بتصميم 54 مجموعة من البادئات الخاصة باللجوء ، والتي تم تصميمها بناءً على التحليل باستخدام بادئات الاختبار الأولية (الجدول & # x200B (الجدول 2). 2). كطريقة تصميم ، تم أولاً استخراج مجموعة من المرشحين التمهيدي من تسلسل القالب ، وتم استخدام مجموعة من المرشحين التمهيدي المستخرج كمرشح زوج تمهيدي. تم تحديد زوج التمهيدي الذي من المتوقع حدوث PCR له فقط في شعبة بكتيرية معينة بواسطة RNN كمجموعة أولية لتجربة اختبار.

الجدول 2

مجموعة التمهيدي لا.اسم التمهيديتسلسل التمهيدي
11_f_180آكجكجكتجكجاجككتجتجا
1_369ككاكاججتاجككاكت
21_f_180آكجكجكتجكجاجككتجتجا
1_397ATCGCCGATCCCACCTTCGA
31_f_180آكجكجكتجكجاجككتجتجا
1_400CCAATCGCCGATCCCACCTT
41_f_180آكجكجكتجكجاجككتجتجا
1_r_408ACTTCGTCCCAATCGCCGAT
51_f_186CTGCGAGCCTGTGAGGTGA
1_369ككاكاججتاجتككاكت
61_f_186CTGCGAGCCTGTGAGGTGA
1_397ATCGCCGATCCCACCTTCGA
71_f_186CTGCGAGCCTGTGAGGTGA
1_400CCAATCGCCGATCCCACCTT
81_f_186CTGCGAGCCTGTGAGGTGA
1_r_408ACTTCGTCCCAATCGCCGAT
92_f_50تكاجتجكاكتكجتاج
2_342تججاكاجاككاكتكجت
104_f_251كتااجكاكككككاجتكا
4_395CTCTTCGCCTGACTTCGGT
114_f_251كتااجكاكككككاجتكا
4_403تكججكاجكتكتكجككتجا
125_f_0تجككتججاجككتاجكاكا
5_r_228كككتتاكججتتكجكتكك
135_f_223كاجاججاجكاكككجتا
5_410تكججججتججاتاجكجا
146_f_66GCCTAGCAATAGGATCTCTC
6_r_211GGGCATAGTTTAGGGATTGG
156_f_211CCAATCCCTAAACTATGCCC
6_363أجاكجاككتجاجكاكتكتج
166_f_211CCAATCCCTAAACTATGCCC
6_r_385TACTAATCACAACTTAGGGC
177_f_205أتككتاااجكتجتكتك
7_347اجكجتكتتججتاكتككتج
188_f_78ACTGCCCAGATCAACTGGGA
8_r_349تجكتكاجاتاكتكجت
198_f_78ACTGCCCAGATCAACTGGGA
8_359تككتجكججتجكتكاجا
209_f_87جاكتجكككجكجااجكججا
9_r_181جتجككججتجكاتكجكت
2110_f_226تككتااااجكاتككتكاج
10_r_381أججكجاجتججتكاكتجا
2212_f_190جكاتاتاكااجاجكج
12_395تاجكجكككتككجاجت
2312_f_216كجاجكاجكجاككتكات
12_395تاجكجكككتككجاجت
2412_f_236آآجتاتجتكجتاجتككججا
12_395تاجكجكككتككجاجت
2513_f_203جتاكااجاجكتجكاجاك
13_397CTCCAAAAAGGTACCCCAC
2614_f_64جكاجججكككتكتجاجا
14_r_341تاجكاكتككتكتكتكككا
2715_f_60تجكجااككجككتكجاتا
15_r_349CTCCCTTGCGGTAGCGCAC
2818_f_17تجتكجتاجتاكاجتجتك
18_177جاتكتجكاكتجاجاكاكجت
2918_f_173كتااكجتجتكتكاجتجكا
18_r_330تككككجاكتججتاجكاك
3019_f_83تاجتجاكاجككجاجتا
19_177اجتكجكاتككجتتجتككت
3119_f_90أكاجككجاجاجتااتككجاجاج
19_371كتاتك جاجاتكجتكاك
3219_f_196تكجكجاجتجاجكاككت
19_r_346تكتجكاجااككجاكتتكج
3319_f_196تكجكجاجتجاجكاككت
19_371كتاتك جاجاتكجتكاك
3420_f_225أتككآآاتككتكتكتكاج
20_r_382جاكجاتككتتجكجتتاكجت
3521_f_61ججتاتجككججتاكتكاك
21_r_211أكاكجاكاججتتاجج
3621_f_61ججتاتجككججتاكتكاك
21_r_217أتكتجكاككاكجاكاججت
3721_f_61ججتاتجككججتاكتكاك
21_r_227جكاكككتكاتكتجكاكا
3821_f_179آاتججكتجكاكجكجكتا
21_359جتاجكتكجججاكتكجا
3921_f_216آاكككتجتكجتجتجكاجا
21_r_348جاكتككجاتجاكككجاكت
4023_f_151أتجاكجتكاجتاكتكجتجك
23_r_437كككككتكاككاجتكتكك
4124_f_84CTGCCAACGTAAGTGGAGG
24_r_360CTTGCGGTAGCAACACGGT
4226_f_74أجاكتجكككجتجتاجكج
26_169تكاكتاتجتكجكتجككتت
4326_f_74AGACTGCCCGTGTTAAGCGG
26_358CTGCAAGCAGGTTGCGCAA
4428_f_165آاتجججكجاكاجكجت
28_333كككككجكتتجتجتجكتجا
4528_f_165آاتجججكجاكاجكجت
28_397اكتاجتكككاتكاكججت
4628_f_170غجكجاكاجكجتتجكتاج
28_339جاتجككككككجكتتجتج
4728_f_173GGACAGAGCGTTGCTAGGCT
28_333كككككجكتتجتجتجكتجا
4828_f_192تجكاكاجتكاتجكتاتكجك
28_333كككككجكتتجتجتجكتجا
4928_f_192تجكاكاجتكاتجكتاتكجك
28_397اكتاجتكككاتكاكججت
5028_f_204كتاتكجكاجااككجتكك
28_397اكتاجتكككاتكاكججت
5129_f_237GCGAATCTCAGAAAGCGCTC
29_437ككاجتكجككاجككاتاكا
5230_f_128كاتجكتاكجاكاجك
30_r_306تكججكجتجكاكاكتك
5330_f_128كاتجكتاكجاكاجك
30_328CCACAAGGTTGGAGTAACG
5430_f_128كاتجكتاكجاكاجك
30_r_342تكجكجتككتككتكاكاكا

يتم عرض رقم زوج التمهيدي واسم التمهيدي وتسلسل القاعدة (5 & # x02032 - & # x02009 & # x0003e & # x020093 & # x02032) المستخدمة في تجارب اختبار RNN. يتم استخدام مواد التمهيدي التي لها نفس رقم زوج التمهيدي كمجموعة من البادئات.

تجارب تضخيم PCR

باستخدام مجموعات 72-Primer للتعلم والتحقق من صحة مجموعات RNN و 54-primer لاختبار RNN ، حاولنا تضخيم جميع القوالب الـ 31. تم تنفيذ PCR باستخدام 2 & # x000d7 & # x02009GoTaq Green Hot Master Mix (Promega) لما مجموعه 3،906 PCRs مع 31 قالبًا و 126 (72 plus 54) مجموعة من البادئات. احتوى حل PCR على 0.5 & # x000a0 & # x000b5M Primer ، و 100000 نسخة من القالب ، وتم تعديله إلى 1 & # x000d7 & # x02009GoTaq Green Hot Master Mix عن طريق إضافة الماء و 2 & # x000d7 & # x02009GoTaq Green Hot Master Mix. بعد التعديل ، تعرض محلول PCR للتمسخ عند 95 & # x000a0 & # x000b0C لـ 2 & # x000a0min وتليها 33 دورة عند 95 & # x000a0 & # x000b0C لـ 30 & # x000a0s و 56 & # x000a0 & # x000b0C لـ 30 & # x000a0s، 72 & # x x000b0C لـ 30 & # x000a0s ، ويتبعها الحضانة عند 72 & # x000a0 & # x000b0C لـ 2 & # x000a0min. بعد التبريد إلى 8 & # x000a0 & # x000b0C ، تم تخزينه في 4 & # x000a0 & # x000b0C حتى تتم معالجته في agarose gel electrophoresis.تم فصل منتجات PCR باستخدام 1.5٪ agarose في المخزن المؤقت 1 & ​​# x000d7 & # x02009TBE عند 100 & # x000a0V لمدة 40 & # x000a0min. تم تلوين هلام الاغاروز في محلول إيثيديوم بروميد 1 & # x000a0 & # x000b5g / ml وتم تصويره تحت الأشعة فوق البنفسجية.

رموز لتعلم RNN

تتكون البيانات الخاصة بتعلم RNN من رمز (الجدول & # x200B (الجدول 3) 3) تم إنشاؤه من بنية دبوس الشعر التمهيدي ، و dimer التمهيدي ، والتماثل بين التمهيدي والقالب ، والعديد من الرموز المكونة من 5 أحرف (pentacode ) تم إنشاؤه من الرمز (الشكل & # x000a0 2). كانت بيانات الإجابة الصحيحة لـ RNN هي نتيجة PCR لكل مجموعة وقالب تمهيدي. نظرًا لأن RNN مُحسَّن لتعلم جمل اللغة الطبيعية ، التي تتكون من كلمات ، يُطلق على الرمز الخماسي المُنشأ كلمة زائفة ، ويُطلق على الرمز الخماسي المُدرج وفقًا لتسلسل النوكليوتيدات في القالب اسم جملة زائفة. يتم وصف طرق التصميم المحددة في قسم إنشاء الكلمات الزائفة والجمل الزائفة.

الجدول 3

أحرف الزوج الأساسي للمعنى أو الاتجاه المعاكس.

زوج القاعدة (قاعدة التمهيدي و # x02013 قاعدة القالب)قالب التمهيديدبوس الشعر التمهيدي أو ديمر
المرحلة الأوليةالمرحلة المتوسطة
إلى الأماميعكسإلى الأماميعكس
A-T ، T-AأFصشك
سي-جي ، جي-سيبزفالخامسل
A-A ، A-G ، G-A ، G-G ، C-Cجحصثم
T-T ، T-C ، C-Tدأناسxن
C-A ، A-C ، G-T ، T-Gهيرذا

رمز لتوليد الكلمات الزائفة لتعلم ال RNN. يتم تعيين الرموز في النيوكليوتيدات المزدوجة على كل زوج أساسي في الموضع التكميلي. قد تظهر أزواج القاعدة غير المتطابقة مثل A-A و T-T و C-A داخل المنطقة التكميلية جزئيًا. يتم تجميع أزواج القاعدة بناءً على تأثير استقرار الخيوط التكميلية جزئيًا.

تظهر عملية توليد الكلمات الزائفة والجمل الزائفة. يتم إنشاء الكلمات الكاذبة فيما يتعلق بزوج تمهيدي وقالب معين. أولاً ، قم بإعداد زوج التمهيدي وبيانات القالب بتنسيق يمكن قراءته بواسطة برنامج التحليل (أ). ثم ، بدائل التسلسل الأساسي التي تم تصنيعها على دبوس الشعر التمهيدي (ب) وديمير (ج) إلى تسلسل التمهيدي الأصلي. يُفترض تشكيل الخيط المزدوج المعقول المتوقع بين مجموعات التمهيدي والقالب ويتم التعبير عنه بأحرف (د& # x02013ه). أولاً ، يتم سرد جزء من التمهيدي التكميلي بما في ذلك جزء من التمهيدي والقالب وموضع القالب (د) ، ويتم التعبير عن تفاعلهم بحرف لكل زوج أساسي (ه). يظهر الرمز المكون من حرف واحد المستخدم للتعبير عن التفاعل المستخدم في ذلك الوقت بتنسيق ه. من أجل القيام بالتعلم الآلي باستخدام RNN ، من الضروري التنبؤ بموضع ربط التمهيدي في القالب ، وهو مصدر إنتاج منتج PCR. بناءً على التنبؤ ، يتم تصنيف مواضع الربط التمهيدي الأخرى إلى مواضع ربط غير مرتبطة بإنتاج منتج PCR. في هذه الدراسة ، تم حساب الطاقة الحرة لكل موضع ربط تمهيدي معقول على القالب لجميع مواضع ربط التمهيدي الممكنة. بالإشارة إلى الطاقة الحرة لمواضع الربط ، تم تحديد موضعين للربط التمهيدي ، لهما حد أدنى من الطاقة الحرة ، على أنهما مواضع ربط التمهيدي القابل للتضخيم بواسطة PCR. بالنسبة لهذه التحديدات ، تم حساب الطاقة الحرة على ثنائيات متداخلة وجمع الطاقات الحرة على مواضع ربط القالب التمهيدي (F). يتم حساب الطاقات الحرة من المحتوى الحراري والدخول ودرجة الحرارة المطلقة للثنائيات المتداخلة. وفقًا للطاقات المجانية في مواضع ربط القالب التمهيدي ، حددنا موقعين لربط قالب التمهيدي ، من المرجح أن يبدأ PCR منهما ، ونستفيد من رسائل تفاعل النوكليوتيدات (جي). على غرار تفاعلات القالب التمهيدي ، يبحث البرنامج عن تشكيل دبوس الشعر أو خافت في التمهيدي والبرايمر. يتم إنشاء رموز من حرف واحد لكل زوج أساسي في دبوس الشعر و dimer (ح). تم تقسيم سلاسل التفاعلات بين البادئات أو بين البادئات والقوالب إلى 5 أحرف (رموز مكونة من خمسة أحرف) ككلمات ونسخها لتعكس أهميتها اعتمادًا على طولها وموضعها من النهاية (3) (أنا). وبالمثل ، يتم توقع التفاعل لمنتج PCR ويتم تعيين الاشعال الموضحة في الشكل & # x200B الشكل 1D ، 1 D ، ويتم تعيين أحرف مختلفة عن التفاعل المفترض في منتصف العملية (ي). يتم إنشاء جملة زائفة عن طريق ترتيب جميع الرموز المكونة من خمسة أحرف المعينة بهذه الطريقة في المواضع بناءً على مجموعة القوالب (ك).

إنشاء كلمات زائفة وجمل زائفة من العلاقة بين البادئات والقوالب

بالنسبة لدبابيس الشعر والثنائيات ، تم التنبؤ بتوليف الحمض النووي من المنطقة التكميلية وأضيفت البادئات المركبة إلى مجموعة التمهيدي. بالنسبة للمنطقة التكميلية بين دبوس الشعر ، و dimer ، والقالب التمهيدي ، ومنتج Primer-PCR ، تم تعيين الأحرف المقابلة للزوج الأساسي التكميلي للمنطقة التكميلية بأكملها ، وتم إنشاء تسلسل الكود الزائف. تم تقسيم سلسلة الأحرف المقابلة إلى 5 قواعد بالترتيب من النهاية 3 & # x02032 ، وتم إنشاء 5 قواعد بشكل متكرر وفقًا لطول المنطقة التكميلية بين قالب التمهيدي ومنتج التمهيدي- PCR (كلمة زائفة). تم إنشاء الكلمات الزائفة النهائية بترتيب مواضع الشد الأمامي ، و dimer ، والقالب.

تم البحث عن دبوس الشعر في كل جهاز تمهيدي. تم البحث أيضًا عن خافضات الإضاءة عن التوليفات الممكنة من البادئات المدرجة في مجموعة التمهيدي. تم البحث عن رابطة الهيدروجين بين التمهيدي والقالب من خلال أي مجموعة من قالب التمهيدي ، التمهيدي التمهيدي ونهاية 5 & # x02032 و 3 & # x02032 نهاية التمهيدي.

في التحقيق في مجموعة التمهيدي المفترضة ، تم إجراء البحث لكل من مجموعة التمهيدي والقالب المزدوج الذين تقطعت بهم السبل (الشكل & # x000a0 2 أ). تم افتراض أن المنطقة التكميلية ذات 5 قواعد أو أكثر تشكل دبوس شعر أو ثنائى ، ويتم البحث في المنطقة ذات الصلة. إذا كان موجودًا ، فقد تم البحث في المحطة الطرفية 3 & # x02032 من الازدواج الجزئي. بافتراض أنه تم تصنيع الخيوط التكميلية من الازدواج الجزئي. عند توليف الحمض النووي من الاشعال المزدوج الجزئي ، تم دمج الاشعال الإضافية بالتتابع في مجموعة التمهيدي (الشكل & # x000a0 2 ب ، ج).

كقاعدة عامة ، تم تأكيد التناظر بين تسلسل التمهيدي المقسم إلى 5 إلى 22 قاعدة وتم تأكيد تسلسل القالب ، وعندما كان عدد القواعد في الملحق 2 الجدول 1 هو نفسه (حوالي 80 ٪) ، تم إنشاء رمز زائف (الشكل & # x000a0 2 د). فيما يتعلق بالتماثل ، المنطقة المراد إنشاؤها كرمز زائف ، تم تحديد الكود الزائف من خلال الرجوع إلى الجدول & # x200B Table3 3 للتماثل بأكمله ، وتم إنشاء جميع الرموز الزائفة ذات الأحرف الصغيرة (الشكل & # x000a0) 2 ه).

تحتوي العديد من مجموعات قوالب مجموعة التمهيدي على مناطق تكميلية متعددة تتطلب تحديد مواضع أولية. نظرًا لأن المنطقة التكميلية التي يجب تحديد موضع التمهيدي لها قصيرة بدرجة كافية ، فمن المتوقع أن تكون المجموعة الأكثر استقرارًا من المناطق التكميلية هي موضع التمهيدي. لتحديد المنطقة التكميلية الأكثر استقرارًا ، تم تعيين مجموعة المناطق التكميلية مع الحد الأدنى من طاقة جيبس ​​كوضع فتيل (الشكل & # x000a0 2 F). تم حساب طاقة جيبس ​​وفقًا لصيغة DG & # x02009 = & # x02009DH-TDS عن طريق حساب الانتروبيا والمحتوى الحراري لقاعدتي التمهيدي وقاعدتي القالب في الموضع التكميلي ، بافتراض درجة حرارة التلدين بالتسلسل 56 & # x000a0 & # x000b0C. لذلك ، بعد حساب جميع مجموعات القاعدتين التكميليتين ، تم تقليل القيمة الإجمالية إلى الحد الأدنى ، وتم تعيين المواضع التكميلية للأمام والخلف ، والتي يتم فصلها بـ 100 قاعدة أو أكثر ، على أنها مواضع أولية. باستخدام القيم العددية المرجعية 23 ، تم إجراء حسابات مجموعة ثنائيات تكميلية للإنتروبيا والمحتوى الحراري حيث تم استخدام قيمها الأصلية والقيم المستقرأة لدينا (الملحق 2 ، الجدول 4). تم تحويل الكود الزائف للموضع التكميلي ، والذي كان من المتوقع أن يكون موضع الفتح ، إلى أحرف كبيرة (الشكل & # x000a0 2 G). تم البحث عن مواقع متجانسة من 6 قواعد أو أكثر عن دبابيس الشعر وثنائياتها ، وتم إنشاء الأكواد الكاذبة للمناطق المتجانسة المقابلة (الشكل. & # x000a0 2 H). بالنسبة لتسلسل الكود الزائف الذي تم إنشاؤه بين التمهيدي والقالب ، تم استخراج 5 أحرف بالتتابع من 3 & # x02032 end من التمهيدي للحصول على رمز خماسي. تم إنشاء الكود الزائف عن طريق تكرار جزء من pentacode وفقًا لطول المنطقة المتجانسة للتعبير عن قوة الارتباط بين التمهيدي والقالب (الشكل & # x000a0 2 I).

بالنسبة لمنتج PCR ، فإن المنطقة التكميلية من التمهيدي هي أيضًا مكملة تمامًا للبرايمر لأن التوليف يستمر باستخدام التمهيدي كقالب في تفاعل الامتداد (الشكل & # x000a0 1 D). بالنسبة للرمز الزائف في هذه المنطقة ، تم تعيين رمز زائف يختلف عن العلاقة بين القالب والتمهيدي ، وتم إنشاء رمز زائف بنفس الطريقة كما في المنطقة التكميلية لقالب التمهيدي (الشكل. & # x000a0 2 J). تم وضع الأكواد الخماسية التي تم إنشاؤها من دبابيس الشعر ، ثم وضع الثنائيات أولاً ، متبوعًا بقوالب التمهيدي ، والرموز الخماسية التي تم إنشاؤها من منتجات PCR التمهيدي بترتيب الخيوط الأمامية للقالب. تم إنشاء الرمز الخماسي ووضعه من مجموعة من البادئات وتم استخدام قالب كجمل زائفة لقالب مجموعة التمهيدي (الشكل & # x000a0 2 K). تم إنشاء جمل زائفة لجميع مجموعات التمهيدي والقالب واستخدامها كبيانات تعليمية أثناء التعلم الآلي.

نصوص لمولد الجملة الزائفة

تم استخدام نصوص Ruby و Python لإنشاء جمل زائفة بالترتيب الموضح في الشكل. & # x000a0 2 (الملحق 3 ، القائمة 1 & # x020139). قرأ نص روبي بنية التسلسل الأساسي للقالب ، وتسلسل قاعدة التمهيدي ، ومجموعة التمهيدي ، وقام بإنشاء جمل زائفة وفقًا للترتيب الموضح في الشكل. & # x000a0 2. تم استخدام SeqKit (https://bioinf.shenwei.me/seqkit/، v0.14.0) للبحث عن التماثل بين التمهيدي والقالب. تم تصنيف الجمل الزائفة التي تم إنشاؤها لكل مجموعة قالب تمهيدي أولاً من خلال نتائج PCR ، وتم تصنيف كل منها إلى 5 مجموعات. لم يتم استخدام إحدى المجموعات الخمس للتعلم كمجموعة للتحقق من تعلم RNN ولكن تم استخدامها للتنبؤ بدقة التنبؤ لكل حقبة.

لاحظنا أن مجموعة برايمر معينة أنتجت العديد من نتائج PCR الإيجابية ونظمت المجموعة لتفريق آثارها. تم إنشاء خمس مجموعات بشكل عشوائي لكل نتيجة إيجابية وسلبية لـ PCR بعد جمع النتائج لكل قالب. لتقسيم النتيجة الإجمالية إلى 5 مجموعات ، تم دمج بيانات قالب الزوج التمهيدي ، وهي وحدة البيانات ، بحيث يكون العدد الإجمالي زوجيًا لكل مجموعة. عندما نعادل نسبة إيجابيات وسلبيات PCR ، يتم تعديل البيانات المكتسبة بحيث تكون الأرقام متساوية في مرحلة جمع النتائج لكل قالب (أخذ عينات أقل).

تم استخدام Axlsx (https://github.com/randym/axlsx، v3.0.0) لتلوين أوراق الانتشار (الجداول & # x200B (الجداول 4 و 4 و # x200B و 7). 7). تم استخدام MatPlotLib (https://matplotlib.org/ ، v3.3.3) لإنشاء رسوم بيانية خطية بدقة العصور (الشكل & # x000a0 4). تم استخدام GnuPlot (http://www.gnuplot.info/ ، v5.4) لإنشاء مخطط مبعثر لطاقات جيبس ​​(الشكل & # x000a0 5).

الجدول 4

نتائج تفاعل البوليميراز المتسلسل مع مزيج من 72 مجموعة أولية و 31 قالبًا.

يتم التعبير عن نتائج PCR بالقيم العددية التالية بناءً على الملاحظة على المواد الهلامية agarose. رقم 0: لا يوجد منتج PCR ، 1: يمكن تأكيد منتج PCR. يتم عرض النتائج على أزواج البرايمر التي لها نتائج إيجابية على أكثر من 20 نموذجًا بخلفية وردية. وبالمثل ، يتم عرض أزواج التمهيدي التي لها نتائج فردية أو غير إيجابية في 31 نموذجًا بخلفية كلسية أو زرقاء ، على التوالي.

متوسط ​​دقة التنبؤ في مجموعات التحقق في التحقق المتبادل. تم حساب متوسط ​​دقة التنبؤ على 5 مجموعات تحقق في التحقق المتبادل. (أ) تم استخدام مجموعات كاملة في مجموعات قالب 72-primer-31 للتعلم أو التحقق من الصحة. (ب) تم التحكم في عدد مجموعات قالب زوج التمهيدي في قالب 72-primer-31 إلى 1: 1 عن طريق أخذ العينات. المجموعات برتقالية: مجموعات قوالب زوج التمهيدي الموجب لـ PCR ، والأخضر: مجموعات قوالب زوج التمهيدي السلبي PCR ، والأزرق: جميع مجموعات القوالب الزوجية الأولية. تم عرض الانحراف المعياري ضمن مجموعات التحقق كأشرطة خطأ.

الجدول 7

التلخيص اللوني لنتائج وتنبؤات PCR ، (أ) تنبؤات من البيانات الكاملة ، (ب) تنبؤات من بيانات أقل من العينات.

عروض ملونة لنتيجة PCR وتنبؤ RNN. تظهر الألوان النتائج والتنبؤات التالية باللون الأحمر: PCR-إيجابي-تنبؤ إيجابي-إيجابي ، وردي: PCR-إيجابي-تنبؤ-سلبي ، أزرق: تنبؤ سلبي-سلبي PCR-سلبي ، أزرق فاتح: تنبؤ سلبي-سلبي-إيجابي ، أبيض: مجموعات قالب زوج التمهيدي المستبعدة من التنبؤات أثناء أخذ العينات المنخفض.

مخطط مبعثر لنتائج وتنبؤات تفاعل البوليميراز المتسلسل. ارسم نتائج PCR وتنبؤات RNN مقابل طاقة Gibbs عند رابطة الهيدروجين في الأمام (المحور الأفقي) والعكس (المحور الرأسي) مواقع فتيلة محددة في وقت تحديد الجملة الزائفة (الشكل & # x000a0 2). تظهر الألوان والشكل النتائج والتنبؤات التالية مثلث أحمر: PCR-إيجابي-تنبؤ إيجابي-إيجابي ، مثلث وردي: PCR-إيجابي-تنبؤ-سلبي ، دائرة زرقاء: PCR-سلبي-تنبؤ سلبي ، دائرة زرقاء فاتحة: PCR-سلبي- تنبؤ إيجابي. لم يتم رسم مجموعات قوالب زوج التمهيدي المستبعدة من التنبؤات أثناء أخذ العينات السفلي.

نتائج التعلم

تم تعيين نتائج PCR التي تم إجراؤها مع درجات حرارة التلدين عند 56 & # x000a0 & # x000b0C كنصوص زائفة تم إنشاؤها من كل مجموعة قالب تمهيدي وتم تدريبها بواسطة RNN. لتعلمها ، تم استخدام الجملة الزائفة التي تم إنشاؤها لمزيج من التمهيدي والقالب كبيانات إدخال ، وتم ترتيب نتائج PCR كمدرس. بالنسبة لـ RNN ، تم استخدام وحدة RNN-Long للذاكرة قصيرة المدى (LSTM) من PyTorch (https://pytorch.org/ ، v1.7.1). تمت كتابة نصوص Python لتعلم الجمل الزائفة واستخراج نتائج التنبؤ بناءً على النصوص المنشورة في كتاب (Shinqiao Du ، "يمكن استخدامها في الميدان! مقدمة لتطوير PyTorch إنشاء نموذج التعلم العميق والتنفيذ في التطبيق" ، Shosuisha 2018 / 9/18 باللغة اليابانية). بعد قراءة الجمل الزائفة ونتائج PCR لكل قالب زوج تمهيدي ، أنشأ RNN خوارزمية قرار تطابق نتائج المخرجات لجميع جمل الإدخال الزائفة (الخوارزمية المكتسبة) (الشكل & # x000a0 3). كعنصر تحكم سلبي في الجمل ، تم محاذاة خماسيات النوكليوتيدات المختارة عشوائيًا على أنها جمل زائفة لا معنى لها.

التعلم والتنبؤ بواسطة RNN. رسم تخطيطي لكيفية تعلم الجمل الزائفة بواسطة RNN. يُظهر الصف العلوي المعالجة أثناء التعلم ، ويعرض الصف السفلي المعالجة أثناء الاختبار. يتم حفظ نتائج التعلم في الملف المحدد بواسطة PyTorch ، ويتم قراءتها أثناء الاختبار واستخدامها لخطوة التنبؤ.

تم تأكيد دقة التنبؤ للخوارزمية المدربة الناتجة عن طريق التحقق المقسم (التحقق المتقاطع). تم تقسيم مجموعات القوالب الزوجية التمهيدية إلى خمس مجموعات ، وتم تعلم RNN باستخدام أربع مجموعات فيما بينها والتعلم. لم يتم استخدام المجموعة الوحيدة المتبقية كبيانات تعلم ولكن تم استخدامها كبيانات تحقق. تم التحقق أثناء خطوات التعلم.

عند تقييم التنبؤ بواسطة RNN ، تم التعامل مع ما إذا كان نطاق PCR المتوقع في الرحلان الكهربائي لهلام الاغاروز على أنه الظروف الحقيقية ، وتم التعامل مع التنبؤ بواسطة RNN على أنه الشروط التنبؤية. تم حساب النتيجة الإيجابية الحقيقية والسلبية الخاطئة والإيجابية الكاذبة والسلبية الحقيقية والحساسية والنوعية والدقة وفقًا لذلك. تم إجراء اختلافات كبيرة في الحساسية والنوعية والدقة بين الشروط بناءً على اختبار الطالب و Welch & # x02019s 24.


خوارزميات Primer Dimer / Hairpin - علم الأحياء

أليغنوكليوتيدات الدنا هي مكونات أساسية لعدد كبير من التقنيات في البيولوجيا الجزيئية. يتمثل الحدث الرئيسي لكل مقايسة على أساس قليل النوكليوتيد في الارتباط المحدد بين قليل النوكليوتيدات والحمض النووي المستهدف. ومع ذلك ، تميل جزيئات الحمض النووي أحادية الشريطة أيضًا إلى الارتباط بأهداف غير مقصودة أو نفسها. يزيد احتمال مثل هذا الارتباط غير المحدد مع تعقيد المقايسة. لذلك ، فإن إدارة البيانات الدقيقة وتصميم سير العمل ضروريان لتحسين في السيليكو تصميم الاشعال والمجسات. يجب مراعاة الاعتبارات الهامة المتعلقة بالبنية التحتية الحسابية ووقت التشغيل لكل من إدارة البيانات وعملية التصميم. يعد استرجاع البيانات وتحديثات البيانات والتخزين والتصفية والتحليل الأجزاء الرئيسية لنظام إدارة بيانات التسلسل. يحتاج كل جزء إلى التنفيذ الجيد لأن التسلسلات الناتجة تشكل الأساس لتصميم قليل النوكليوتيد. يجب مراعاة السمات الرئيسية المهمة ، مثل طول قليل النوكليوتيد ، ودرجة حرارة الانصهار ، والتركيبات الثانوية ، وتشكيل ثنائي الطبقة التمهيدي ، فضلاً عن الخصوصية ، في في السيليكو اختيار قليل النوكليوتيدات. يتطلب تطوير سير عمل تصميم قليل النوكليوتيد الفعال التوازن الصحيح بين دقة نماذج الكمبيوتر المطبقة ، والإنفاق العام للوقت ، وعبء العمل الحسابي.

تقدم هذه الورقة نظرة عامة على المعلمات المهمة أثناء عملية التصميم ، بدءًا من استرجاع البيانات ، وحتى معلمات التصميم لتصميم قليل النوكليوتيد المحسن.


كيف تكتشف ديمر التمهيدي؟

احترس أكثر من ذلك بكثير. الى جانب ذلك ، ما الذي يسبب ديمر التمهيدي؟

الأسباب من PCR /برايمر ديمرز في تسلسل تلوث تفاعلات القالب ، التمهيدي أو غيرها من الكواشف التسلسلية مع التمهيدي ديمرز. انخفاض شديد في درجة حرارة التلدين أثناء عملية تفاعل البوليميراز المتسلسل. اثنين التمهيدي مواقع الربط الموجودة في القالب. التسلسل المباشر لمنتجات PCR حيث يوجد أكثر من نطاق واحد.

  1. تجنب المشابك التكميلية على الطرف 3 'من البادئات الخاصة بك ، على سبيل المثال GC أو GCGC ، إلخ.
  2. قم بقياس وضبط تركيزات التمهيدي والقالب إلى القيم الموصى بها.
  3. استخدم PCR (التدرج الحراري) لإخراج التخمين من درجات حرارة التلدين.
  4. استخدام بوليميرات الحمض النووي عالية الدقة ، على سبيل المثال Pfu.

ومن ثم كيف أتخلص من البرايمر؟

  1. زيادة درجة حرارة التلدين.
  2. زيادة درجة حرارة وقت تمسخ القالب.
  3. تقليل تركيز الاشعال (10 pmol سيكون على ما يرام)
  4. استخدام محسن PCR مثل DMSO.
  5. تحقق من القالب الخاص بك. (
  6. استخدام علامة عالية الجودة.

مارك كي تشي. كلية مارتن ميثوديست. مرحبا ديبثي ، دبابيس الشعر شكل عندما الخاص بك التمهيدي قادر على تكوين عدد من الأزواج الأساسية بين منطقتين منفصلتين على طول طوله بعد أن يطوي مرة أخرى على نفسه.


آلية بديلة لتشكيلات ديمر التمهيدي

هناك بعض الملاحظات الإضافية التي توفر أدلة لآلية بديلة لثنائي التمهيدي.

  1. بشكل عام ، نادرًا ما يتم ملاحظة المتجانسات (أي الثنائيات التي تنطوي على نفس الخيط).
  2. عادةً ما تحدث القطع الأثرية لمبتدئ التمهيدي عند رقم دورة عتبة كبير (عادةً & gt 35 دورة) ، وهو أعلى من رقم دورة العتبة لـ amplicon المطلوب.
  3. تزداد ثنائيات التمهيدي بشكل ملحوظ عند إضافة الحمض النووي الجيني غير المتجانسة.
  4. غالبًا ما يتم ملاحظة ثنائيات التمهيدي عندما يرتبط أحد البادئات أو كلاهما بشكل غير فعال بالحمض النووي المستهدف (على سبيل المثال ، بسبب البنية الثانوية للهدف أو الديناميكا الحرارية الضعيفة).
  5. عندما يتم تسلسل ثنائيات التمهيدي ، غالبًا ما يكون هناك عدد قليل من النيوكليوتيدات الإضافية ذات الأصل الغامض في وسط الأمبليكون الثنائى.

تشير الملاحظات 1 و 2 إلى أن بوليميراز الحمض النووي لا يرتبط بكفاءة أو يمتد على الوجهين التمهيدي بنهايات 3′ التكميلية. يمكن أيضًا تفسير الملاحظة 2 على أنها تعني أن تركيز التمهيدي على الوجهين منخفض جدًا مقارنةً بالطباعة المزدوجة المستهدفة العادية. ومع ذلك ، في المراحل المبكرة من تفاعل البوليميراز المتسلسل ، تشير الملاحظات 3 و 5 إلى أن الحمض النووي الجيني في الخلفية قد يلعب دورًا في آلية تكوين البادئة البادئة. تشير الملاحظة 4 إلى أنه يجب أن يحدث ثنائي أكسيد التمهيدي في الجولات المبكرة من تفاعل البوليميراز المتسلسل لمنع الأمبليكون المطلوب من الاستيلاء على التفاعلات في أنبوب الاختبار. يوضح الشكل 9 آلية تتضمن الحمض النووي الجيني في الدورات المبكرة من تفاعل البوليميراز المتسلسل ويوفر تفسيرًا لجميع الملاحظات الخمس.

يمكن أيضًا التحقق من الآلية المعروضة في الشكل 9 بواسطة الكمبيوتر ، ولكن البحث عن مثل هذا الموقع في جينوم كبير يمكن أن يكون صعبًا للغاية من الناحية الحسابية. يمكن لخوارزمية ThermoBLAST التي طورتها شركة DNA Software، Inc. مواجهة هذا التحدي (انظر الأسطورة 5).


التصميم التمهيدي باستخدام البرنامج

يتوفر عدد من أدوات التصميم التمهيدي التي يمكن أن تساعد في تصميم PCR التمهيدي للمستخدمين الجدد وذوي الخبرة على حد سواء. قد تقلل هذه الأدوات من التكلفة والوقت اللذين ينطوي عليهما التجريب عن طريق تقليل فرص فشل التجارب.

يتبع Primer Premier جميع الإرشادات المحددة للتصميم التمهيدي PCR. يمكن استخدام Primer Premier لتصميم مواد أولية للقوالب الفردية ، والمحاذاة ، وتصميم التمهيدي المنحل ، وتحليل إنزيم التقييد. تحليل كونتيج وتصميم بادئات التسلسل.

تختلف المبادئ التوجيهية لتصميم qPCR التمهيدي قليلاً. يمكن لبرامج مثل AlleleID و Beacon Designer تصميم البادئات وتحقيقات قليل النوكليوتيد لفحوصات الكشف المعقدة مثل المقايسات المتعددة ، وتصميم التمهيدي للأنواع المتقاطعة ، وتصميم التمهيدي الخاص بالأنواع وتصميم التمهيدي لتقليل تكلفة التجربة.

PrimerPlex هو برنامج يمكنه تصميم مواد تمهيدية ASPE (ملحق تمهيدي محدد من Allele) والتقاط مجسات للتنميط الجيني متعدد الأشكال SNP باستخدام أنظمة صفيف التعليق مثل Luminex xMAP & # 174 و BioRad Bioplex.


كيفية التخلص من ديمر التمهيدي PCR - (مارس / 17/2003)

بالنسبة لمعايرة Mg2 + ، ما التركيزات الأفضل لاختيارها؟ أعني ، بالضبط ما هي القيم التي يجب أن أجربها؟

يجب تجربة Mg2 + بتركيز نهائي 1.5 و 2.0 و 2.5 و 3.0 ملي مولار.

أحاول أن أجعل RT-PCR أكثر كفاءة لأنه ، على الرغم من أن لدي منتج PCR المطلوب ، إلا أنني أرغب في الحصول على رد فعل أفضل. أعتقد أن المشكلة تكمن في أن البرايمر يدخل في ثنائيات. لقد سمعت عن استخدام المنظفات أو DMSO في خليط التفاعل ولكني لست متأكدًا من ذلك. لا أحد يعرف طريقة للقيام بذلك دون تغيير TM؟

تميل القاتمات إلى التكون عندما يكون تركيز القالب منخفضًا. إذا استطعت ، فحاول المعايرة في جزء أكبر من القالب.

يمكن أن تؤدي إضافة حامل الحمض الريبي النووي النقال الخميرة إلى تقليل كمية القالب التي تلتصق بجدران الأنبوب ، مما يجعل المزيد منها متاحًا للتضخيم.

عند تصميم البرايمر الخاص بك ، تحقق من تشكيل homo-dimer و hetero-dimer باستخدام برنامج Oligo Analyzer على موقع IDT الإلكتروني www.idtdna.com.

يمكن استخدام dmso بنسبة تتراوح بين 2-10٪ ، ولكن كلما زادت النسبة كلما قل نشاط البوليميراز ، لذا قد لا تحصل على نفس كمية الأسطوانات. يمكنك المحاولة في 2 و 5٪ لتكون بأمان.

يبدو 100bp كبيرًا جدًا بالنسبة إلى dimer primer - يجب أن تكون oligos الخاصة بك & gt50 قاعدة لكل منها للحصول على ذلك - تبدو وكأنها منتج pcr مناسب. قد تساعد معايرة MgCl2 ، بالإضافة إلى تجربة Tms المختلفة.

1) جرب DMSO حتى 5٪. بعض البوليمرات لا بأس بها مع DMSO والبعض الآخر ليس # 39t. أنت لا تعرف أبدا حتى تحاول.

2) جرب PCR من خطوتين. هناك ورقة في Biotechniques حول رد فعل PCR من خطوتين ولكن ليس لدي المرجع منذ أن & # 39m في المنزل و # 39s في المختبر. يستحق البحث عنه. لقد حصلت بشكل أساسي على قالب بالإضافة إلى التمهيدي الأمامي في أنبوب واحد وقالب بالإضافة إلى التمهيدي العكسي في أنبوب آخر ثم قم بإجراء ما بين 1-15 جولة من PCR. ثم اجمع محتويات الأنبوبين وقم بإجراء 25 جولة من تفاعل البوليميراز المتسلسل. في بعض الأحيان ، يسمح ذلك للبرايمر بالالتزام بالقالب بشكل فعال ويسمح لك بالحصول على بعض النصوص الأولية التي ستربط بعد ذلك ببعضها البعض عند دمج محتويات الأنبوبين.

3) إذا كنت لا تستخدم البوليميراز لمحتوى عالٍ من GC ، فاحصل على واحدة. سيوفر لك الكثير من المتاعب. لن يحل مشكلتك ولكنه سيساعدك على تضييق نطاق الأمور عند استكشاف الأخطاء وإصلاحها. إن بوليميراز KOD XL (نوفاجين) ليس حساسًا لـ DMSO بنسبة تصل إلى 5٪ وقد ساعدني ذلك في الحصول على جميع المسوخات الخاصة بي ولكن ليس بدون الكثير من المحاولات لمجرد أن محتوى GC في التمهيدي والقالب كان أكثر من 60٪. يحب بعض الأشخاص مجموعة أدوات تغيير quik بواسطة stratagene ولكني لم أجعلها تعمل أبدًا ، وهي مكلفة حقًا عندما تكون & # 036600 مجموعة لـ 30 rxn أو شيء من هذا القبيل. كل لوحده.

4) لن أذهب إلى أقل من 55 درجة لدرجة حرارة التلدين. 50 قد يكون جيدًا ولكن أقل من ذلك أنك تدفع حظك بمحاولة الحصول على درجة حرارة عالية بما يكفي لحل أي هياكل دبوس شعر شائعة في الاشعال الغني بالـ GC ، ناهيك عن احتمال تقليل خصوصية مطابقة التمهيدي والقالب.

حظًا سعيدًا & # 33 يتطلب الأمر الكثير من استكشاف الأخطاء وإصلاحها ومن الصعب الحصول على نتائج متسقة.

قد يكون الأمر بسيطًا مثل استخدام بوليميراز البدء الساخن. أعتقد أن Vent مخصصة لدقة أعلى ، في حين أن البدء الساخن يساعد على إزالة أي شوائب أو روابط غير محددة ، وثنائيات ، إلخ. .


Ahn Y و Park J و Lee C-G و Kim J-W و Jung S-Y (2010) تم تطبيق خوارزمية الذاكرة الجديدة باستخدام GA (الخوارزمية الجينية) و MADS (شبكة البحث المباشر التكيفية) من أجل التصميم الأمثل للنظام الكهرومغناطيسي. IEEE Trans Magn 46 (6): 1982-1985

Andreson R، Mols T، Remm M (2008) توقع معدل فشل تفاعل البوليميراز المتسلسل في الجينومات الكبيرة. الأحماض النووية الدقة 36 (11): e66

Boehnke M، Arnheim N، Li H، Collins FS (1989) رسم الخرائط الجينية للبنية الدقيقة للكروموسومات البشرية باستخدام تفاعل البوليميراز المتسلسل على حيوان منوي واحد: اعتبارات التصميم التجريبية. Am J Hum Genet 45 (1): 21

Boutros R، Stokes N، Bekaert M، Teeling EC (2009) UniPrime2: خدمة ويب توفر تصميمًا أوليًا عالميًا أسهل. الأحماض النووية الدقة 37 (إصدار خادم الويب): 209-213

Boyle B ، Dallaire N ، MacKay J (2009) تقييم تأثير تعدد أشكال النوكليوتيدات المفردة وعدم تطابق البادئة على تفاعل البوليميراز المتسلسل الكمي. BMC Biotechnol 9:75

Bryksin AV ، Matsumura I (2010) امتداد التداخل استنساخ PCR: طريقة بسيطة وموثوقة لإنشاء البلازميدات المؤتلفة. التقنيات الحيوية 48 (6): 463-465

Chang HW ، Yang CH ، Chang PL ، Cheng YH ، Chuang LY (2006) SNP-RFLPing: تعدين إنزيم التقييد لـ SNPs في الجينوم. علم الجينوم BMC 7:30

Chang HW، Chuang LY، Cheng YH، Hung YC، Wen CH، Gu DL، Yang CH (2009) Prim-SNPing: مصمم أولي للتنميط الجيني SNP الفعال من حيث التكلفة. التقنيات الحيوية 46 (6): 421-431

Chang HW ، Cheng YH ، Chuang LY ، Yang CH (2010) SNP-RFLPing 2: أداة قاعدة بيانات PCR-RFLP محدثة ومتكاملة للتنميط الجيني SNP. المعلوماتية الحيوية BMC 11:17

Chuang LY، Cheng YH، Yang CH (2012) URPD: أداة تصميم تمهيدي لمنتج محدد. ملاحظات BMC Res 5 (1): 306

Ciornei I، Kyriakides E (2012) الخوارزمية الجينية لمستعمرة النمل الهجين (GAAPI) من أجل التحسين المستمر العالمي. IEEE Trans Syst Man Cybern B Cybern 99: 1-12

Croning MD ، Fricker DG ، Komiyama NH ، Grant SG (2010) التصميم الآلي لمجسات اللطخة الجنوبية الجينية. علم الجينوم BMC 11:74

دوكينز آر (2006) الجين الأناني. مطبعة جامعة أكسفورد ، كامبريدج

Duitama J ، Kumar DM ، Hemphill E ، Khan M ، Mandoiu II ، Nelson CE (2009) PrimerHunter: أداة تصميم أولية للتعرف على النوع الفرعي للفيروس المستند إلى PCR. الأحماض النووية الدقة 37 (8): 2483-2492

Elnifro EM ، Ashshi AM ، Cooper RJ ، Klapper PE (2000) Multiplex PCR: التحسين والتطبيق في علم الفيروسات التشخيصي. كلين ميكروبيول القس 13 (4): 559-570

Haas S ، Vingron M ، Poustka A ، Wiemann S (1998) تصميم تمهيدي للتسلسل على نطاق واسع. الأحماض النووية الدقة 26 (12): 3006-3012

Heidari-Bateni G، McGillem CD، Lcc A (1994) نظام اتصالات فوضوي ذو تسلسل مباشر واسع الانتشار. IEEE Trans Commun 42 (234 الجزء 3): 1524-1527

Holland J (1992) التكيف في الطبيعة والأنظمة الاصطناعية. مطبعة معهد ماساتشوستس للتكنولوجيا ، كامبريدج

Housley DJE ، Zalewski ZA ، Beckett SE ، Venta PJ (2006) عوامل التصميم التي تؤثر على نجاح تضخيم تفاعل البوليميراز المتسلسل (PCR) للأشعال عبر الأنواع بين 1147 زوجًا من الثدييات التمهيدي. الجينوم BMC 7 (1): 253

Hsieh MH، Hsu WC، Chiu SK، Tzeng CM (2003) خوارزمية فعالة لتحديد الحد الأدنى من مجموعة التمهيدي. المعلوماتية الحيوية 19 (2): 285-286

Kellert SH (1993) في أعقاب الفوضى: ترتيب لا يمكن التنبؤ به في الأنظمة الديناميكية. مطبعة جامعة شيكاغو ، شيكاغو

Kennedy J، Eberhart R (1995) تحسين سرب الجسيمات. IEEE Int Conf Neural Netw 4: 1942–1948

Kwok S، Mack DH، Mullis KB، Poiesz B، Ehrlich G، Blair D، Friedman-Kien A، Sninsky JJ (1987) تحديد تسلسل فيروسات نقص المناعة البشرية باستخدام التضخيم الأنزيمي في المختبر واكتشاف انقسام قليل القسيمات. J Virol 61 (5): 1690–1694

Mallona I ، Weiss J ، Egea-Cortines M (2011) كفاءة الكمبيوتر: أداة ويب لتوقع كفاءة تضخيم تفاعل البوليميراز المتسلسل (PCR). المعلوماتية الحيوية BMC 12:40

McPherson MJ و Hames BD و Taylor GR (1995) PCR 2: نهج عملي. مطبعة جامعة أكسفورد ، نيويورك

Mei Y ، Tang K ، Yao X (2011) خوارزمية الذاكرة القائمة على التحلل لمشكلة توجيه القوس المكثف متعدد الأغراض. IEEE Trans Evol Comput 15 (2): 151–165

Merz P ، Freisleben B (1997) نهج بحث جيني محلي لمشكلة التخصيص التربيعي. ورقة مقدمة في المؤتمر الدولي السابع للخوارزميات الجينية

Modiri A، Kiasaleh K (2011) تصميم فعال لهوائيات microstrip لتطبيقات SDR باستخدام خوارزمية PSO المعدلة. IEEE Trans Magn 47 (5): 1278-1281

Monoyios D ، Vlachos K (2011) خوارزميات جينية متعددة الأهداف لحل مشكلة التوجيه المدرك للضعف وتخصيص الطول الموجي. IEEE / OSA J Opt Commun Netw 3 (1): 40-47

Moscato P (1989) في التطور والبحث والتحسين والخوارزميات الجينية وفنون الدفاع عن النفس: نحو خوارزميات الذاكرة. تقنية. ممثل Caltech Concurrent Composition Program، Rep. 826، California Inst. Technol. ، باسادينا

Oggioni MR، Meacci F، Carattoli A، Ciervo A، Orru G، Cassone A، Pozzi G (2002) بروتوكول للتعرف في الوقت الحقيقي على PCR لجراثيم الجمرة الخبيثة من مسحات الأنف بعد تخصيب المرق. J Clin Microbiol 40 (11): 3956-3963

Pessoa AM، Pereira S، Teixeira J (2010) PrimerIdent: أداة قائمة على الويب لتصميم التمهيدي المحفوظ. المعلومات الحيوية 5 (2): 52-54

Piriyapongsa J، Ngamphiw C، Assawamakin A، Wangkumhang P، Suwannasri P، Ruangrit U، Agavatpanitch G، Tongsima S (2009) RExPrimer: أداة تصميم تمهيدي متكاملة تزيد من فعالية PCR عن طريق تجنب 3 SNP-in-primer and mis-priming من الاختلاف الهيكلي. BMC Genomics 10 (ملحق 3): S4

Quill E (2008) مطابقة الدم تصبح وراثية. العلوم 319 (5869): 1478–1479

Rozen S، Skaletsky H (2000) Primer3 على WWW للمستخدمين العامين وللمبرمجين البيولوجيين. طرق Mol Biol 132 (3): 365-386

Saiki RK ، Sharf SJ ، Faloona F ، Mullis KB ، Horn GT ، Erlich HA ، Arnheim N (1985) التضخيم الأنزيمي للتسلسل الجيني B-globulin وتحليل موقع التقييد لتشخيص فقر الدم المنجلي. علم 230 (4732): 1350–1354

Sambrook J ، Russell DW (2001) الاستنساخ الجزيئي: دليل معمل. CSHL Press Cold Spring Harbour ، نيويورك

Sambrook J ، Fritsch EF ، Maniatis T (1989) الاستنساخ الجزيئي. مطبعة مختبر كولد سبرينغ هاربور ، كولد سبرينغ هاربور ، نيويورك

شي Y ، Eberhart RC ، Team E ، Kokomo IN (2001) تحسين سرب الجسيمات التكيفية الضبابي. Proc IEEE Int Conf Evol Comput 1: 101-106

Untergasser A، Nijveen H، Rao X، Bisseling T، Geurts R، Leunissen JA (2007) Primer3Plus ، واجهة ويب محسنة لـ Primer3. الأحماض النووية الدقة 35 (إصدار خادم الويب): 71-74

Vallone PM، Butler JM (2004) AutoDimer: أداة فحص لهياكل التمهيدي-dimer وهياكل دبوس الشعر. التقنيات الحيوية 37 (2): 226-231

Várallyay E ، Burgya′n J ، Havelda Z (2007) الكشف عن الرنا الميكروي بواسطة تحليلات اللطخة الشمالية باستخدام تحقيقات LNA. الطرق ٤٣: ١٤٠ - ١٤٥

Wallace RB، Shaffer J، Murphy RF، Bonner J، Hirose T، Itakura K (1979) تهجين oligodeoxyribonucleotides الاصطناعية إلى phi chi 174 DNA: تأثير عدم تطابق زوج القاعدة الفردي. الأحماض النووية الدقة 6 (11): 3543–3557

Wang J ، Li KB ، Sung WK ​​(2004) G-PRIMER: خوارزمية جشعة لاختيار الحد الأدنى من مجموعة التمهيدي. المعلوماتية الحيوية .20 (15): 2473-2475

Wu JS، Lee C، Wu CC، Shiue YL (2004) تصميم تمهيدي باستخدام الخوارزمية الجينية. المعلوماتية الحيوية 20 (11): 1710-1717

Yang CH ، Cheng YH ، Chang HW ، Chuang LY (2009a) تحسين سرب الجسيمات التكيفية الضبابي لمشكلة تصميم تمهيدي محددة. في: مؤتمر IEEE الدولي حول الأنظمة الضبابية ، الصفحات 1021-1026

Yang CH ، Cheng YH ، Chuang LY ، Chang HW (2009b) تصميم تمهيدي لمنتج PCR باستخدام خوارزمية memetic. Biotechnol Prog 25 (3): 745-753

Yang CH ، Cheng YH ، Chang HW ، Chuang LY (2010a) تصميم تمهيدي مع منتج PCR محدد باستخدام تحسين سرب الجسيمات. Int J Chem Biomol Eng 3 (1): 18-23

Yang CH ، Cheng YH ، Chuang LY (2010b) تحسين سرب الجسيمات بوزن القصور الذاتي الفوضوي الجديد لتصميم PCR التمهيدي ، المؤتمر الدولي لعام 2010 حول تقنيات وتطبيقات الذكاء الاصطناعي (TAAI) ، ص 373-378

Yang CH ، Cheng YH ، Chuang LY ، Chang HW (2010c) تصميم تمهيدي ثنائي الزوج من أجل التنميط الجيني SNP الخالي من الإنزيم استنادًا إلى خوارزمية جينية. المعلوماتية الحيوية BMC 11:509

Yang CH ، Cheng YH ، Yang CH ، Chuang LY (2012) تصميم تمهيدي مطور من أجل عدم تطابق التنميط الجيني PCR-RFLP SNP باستخدام خوارزمية جينية. IEEE / ACM Trans Comput Biol Bioinform 9 (3): 837-845

Ye J، Coulouris G، Zaretskaya I، Cutcutache I، Rozen S، Madden T (2012) Primer-BLAST: أداة لتصميم مواد أولية محددة الهدف لتفاعل البوليميراز المتسلسل. المعلوماتية الحيوية BMC 13 (1): 134

أنت FM ، Huo N ، Gu YQ ، Luo MC ، Ma Y ، Hane D ، Lazo GR ، Dvorak J ، Anderson OD (2008) BatchPrimer3: تطبيق ويب عالي الإنتاجية لـ PCR وتصميم التمهيدي التسلسلي. المعلوماتية الحيوية BMC 9: 253

Yuryev A ، Huang J ، Pohl M ، Patch R ، Watson F ، Bell P ، Donaldson M ، Phillips MS ، Boyce-Jacino MT (2002) توقع نجاح اختبارات التنميط الجيني التمهيدي باستخدام النمذجة الإحصائية. الأحماض النووية Res 30 (23): e131


شاهد الفيديو: Primer design. What is the primer-dimer? (كانون الثاني 2022).