معلومة

أ 2. الانتشار الميسر - علم الأحياء


ضع في اعتبارك الآلية التالية:

لنفترض أنه سيتم قياس التدفق الأولي لهذا النظام. نود اشتقاق المعادلات التي تُظهر (J ) كدالة (A_ {out} ) (بافتراض أن (A_ {in} ) لا يكاد يذكر على مدار الوقت لقياس التدفق الأولي. افترض أيضًا أن (J ) المُيسر أكبر بكثير من (J ) الخامل. على عكس الانتشار السلبي ، فإن JA لا يتناسب مع (A_ {out} ) بل بالأحرى ([A_ {ملزم}] ).

ضع في اعتبارك هذا المثال لمساعدتك على فهم هذا التناسب. افترض أن المستقبل عبارة عن شاحنة يمكنها حمل جسيم واحد عبر الغشاء في كل مرة (أي 1/1 قياس العناصر المتكافئة). افترض أيضًا أن الجسيم لا يمكن أن يمر دون أن تحمله الشاحنة. إذا لم تكن هناك شاحنات في الغشاء ، فلا يمكن نقل أي حمولة. إذا كانت هناك شاحنات في الغشاء ولكن لا تحتوي على جزيئات ، فلن يتم نقل أي حمولة. مع زيادة عدد الجسيمات المتاحة للتحميل في الشاحنة ، ستزداد فرصة تحميل الشاحنة (اعتمادًا بالطبع على تقارب الجسيمات في الشاحنة). إذا تضاعف عدد الشاحنات المحملة ، سيتضاعف عدد الجسيمات الملقاة على الجانب الآخر. لذلك ، عن طريق القياس ، (JA ) يتناسب مع ([RA] ):

[ start {align} JA & propto [RA] nonumber [5pt] & = k_3 [RA] nonumber end {align} label {1} ​​]

كيف نحسب (را ) عندما نعرف (أ ) و (ص )؟ لنفترض أن (A_ {total} ) ( (A_0 )) أكبر بكثير من (R_0 ) ، كما هي الحالة البيولوجية المحتملة ، و (A_ {in} = 0 ). يمكننا حساب (RA ) باستخدام المعادلات التالية ، ونفس الإجراء الذي استخدمناه لاشتقاق معادلة الربط:

[ML = dfrac {M_oL} {K_d + L} ]

التفكك ثابت:

[K_d = dfrac {[A] _ {eq} [R] _ {eq}} {[AR] _ {eq}} = dfrac {[A] [R]} {[RA]} label { 2} ]

(K_d ) له وحدات مولارية.

توازن الكتلة لـ R:

[R_o = R + RA التسمية {3A} ]

وبالتالي

[R = R_o -RA label {3} ]

نظرًا لأننا سنفترض أن (A_o ) أكبر بكثير من (R_0 ) ، فلن نحتاج إلى توازن الكتلة لـ (A ) (وهو (A_o = A + RA ))

معادلة بديلة ref {3} في ref {2}:

[(RA) K_d = (Ro) A - (RRA) A ]

[(RA) K_d + (RA) A = (Ro) A ]

[RA = (Ro) dfrac {A} {K_d + A} label {4} ]

استبدل ref {4} في المعادلة ref {1} للحصول على المعادلة النهائية ،

[JA = const [RA] = k_3 [RA] = k_3 (R_o) dfrac {A} {K_d + A}. التسمية {5} ]

يجب أن يتضح لك من هذه المعادلات أن:

  • قطعة من (JA ) مقابل (A ) قطعية
  • (JA = 0 ) عندما (A = 0 ).
  • (JA = J_ {max} ) عندما (A ) أكبر بكثير من (K_d )
  • (A = K_d ) عندما (JA = J_ {max} / 2 ).

Wolfram Mathematica CDF Player - Jo vs A (مطلوب مكون إضافي مجاني)

هذه هي نفس الشروط التي قمنا بتفصيلها لفهمنا للمعادلة الملزمة

[ML = dfrac {M_oL} {K_d + L} ]

افتراض التوازن السريع

يعتمد هذا الاشتقاق على افتراض أن التركيزات النسبية لـ (A ) و (R ) و (AR ) يمكن تحديدها بواسطة (K_d ) للتفاعلات وتركيزات كل نوع أثناء الجزء الأول من الانتشار (أي في ظل ظروف السعر الأولي). تذكر في ظل هذه الظروف أن (A_ {out} ) لا يتغير كثيرًا بمرور الوقت. هل هذا افتراض صحيح؟ افحص الآلية الموضحة في الشكل أعلاه. (A_ {out} ) يرتبط بـ (R ) بثابت معدل الترتيب الثاني (k_1 ). RA له مصيران. يمكن أن ينفصل مع ثابت معدل الترتيب الأول (k_2 ) إلى Aout + R (لإعطاء الأنواع الأصلية) ، أو ينفصل مع ثابت معدل الترتيب الأول k3 لإعطاء (A_ {in} ) + (R ) (عندما يتحرك A عبر الغشاء). إذا افترضنا أن (k_2 gg k_3 ) (أي أن المركب يتفكك بسرعة أكبر بكثير من حمل A) ، فإن النسب النسبية لـ (A ) و (R ) و (RA ) يمكن وصفه بـ (K_d ). بدلاً من ذلك ، يمكنك التفكير في الأمر بهذه الطريقة. إذا ارتبط (A ) بـ (R ) ، فإن معظم (A ) سوف ينفصل ، وسيتم نقل كمية صغيرة عبر الغشاء. إذا حدث هذا ، فسيكون (R ) الآن مجانيًا ، وسيرتبط بسرعة (A_ {out} ) ويعيد ضبط التوازن. يحدث هذا لأن المصير الأكثر احتمالًا للربط A هو الانفصال ، وليس حمله عبر الغشاء ، منذ (k_3 ll k_2 ).

انتشار الأيونات والجزيئات عبر الأغشية

كما رأينا سابقًا ، ترتبط معاملات نفاذية الأغشية الاصطناعية (الجسيمات الشحمية) بالمذابات بحجم وقطبية المذاب.

الشكل: معاملات النفاذية

تتمتع أيونات الشحنة الأصغر والأعلى كثافة (مثل ( ce {Na ^ {+}} )) بمعامل نفاذية أقل من الأيونات الأكبر والأقل كثافة الشحنة (مثل ( ce {K ^ {+}} ) ). ماذا عن الأغشية الطبيعية؟ ننظر إلى الرسم البياني أدناه.

الجدول 1: معامل النفاذية (سم / ث) للأغشية الطبيعية والاصطناعية إلى D-Glucose و D-mannitol عند 25 درجة مئوية.
تحضير الغشاءD- الجلوكوزD- مانيتول
طبقة ثنائية الدهون الاصطناعية (2.4 مرات 10 ^ {- 10} ) (4.4 مرات 10 ^ {- 11} )
الانتشار السلبي المحسوب (4 مرات 10 ^ {- 9} ) (3 مرات 10 ^ {- 9} )
كريات الدم الحمراء البشرية السليمة (خلايا الدم الحمراء) (2.0 مرات 10-4 ) (5 مرات 10 ^ {- 9} )

لماذا تختلف معاملات النفاذية لـ D-Glc و D-Mannitol عبر غشاء خلايا الدم الحمراء؟


تشارك مستقبلات الجلوكوكورتيكويد في تنظيم إفراز اليوريا النابض في الضفدع

كانت أهداف هذه الدراسة هي توصيف نمط إفراز اليوريا النابض في ضفدع الخليج في أعقاب تحميل الكورتيزول الخارجي وتحديد المستقبلات المشاركة في تنظيم هذه الآلية. تم تزويد أسماك الضفادع بقثاطير شريانية مستقرة وتم تسريبها مع كلوريد الصوديوم المتساوي لمدة 48 ساعة وبعد ذلك عولجت الأسماك بالكورتيزول وحده ، الكورتيزول + زيت الفول السوداني ، الكورتيزول + RU486 (مضاد لمستقبلات الجلوكوكورتيكويد) أو الكورتيزول + سبيرونولاكتون (مستقبل القشرانيات المعدنية). عند تحميل الكورتيزول ، تعرضت الأسماك المعالجة بالكورتيزول وحده أو الكورتيزول + الزيت أو الكورتيزول + سبيرونولاكتون إلى انخفاض بمقدار ضعفين إلى ثلاثة أضعاف في إفراز اليوريا النابض. كان هذا الانخفاض بسبب انخفاض حجم نبض اليوريا مع عدم وجود تأثير على تردد النبض مقارنة بالقيم التي تم قياسها خلال فترة ضخ كلوريد الصوديوم. بالإضافة إلى ذلك ، أظهرت هذه الأسماك زيادة في تركيز اليوريا في البلازما عند العلاج. تم إلغاء هذه التأثيرات الواضحة للعلاج بالكورتيزول في الأسماك المعالجة بالكورتيزول + RU486. في المقابل ، أظهرت هذه الأسماك زيادة في إفراز اليوريا النابض بوساطة زيادة مضاعفة في حجم النبض دون تغيير في التردد. وبالمثل ، أظهرت الأسماك المعالجة بالكورتيزول + RU486 انخفاضًا معنويًا في تراكيز اليوريا في البلازما على مدار التجربة. تشير نتائج هذه الدراسة إلى أن المستويات العالية من الكورتيزول تقلل من إفراز اليوريا النابض عن طريق تقليل حجم النبض. بالإضافة إلى ذلك ، يبدو أن مستقبلات الجلوكوكورتيكويد وليس مستقبلات القشرانيات المعدنية متورطة في تنظيم آلية إفراز اليوريا النابضة للسمك.

هذه معاينة لمحتوى الاشتراك ، والوصول عبر مؤسستك.


نقل الخلايا البكتيرية

تتطلب كل خلية حية من محيطها مواد خام للتخليق الحيوي وإنتاج الطاقة ويجب أن تطلق في بيئتها المنتجات الثانوية لعملية التمثيل الغذائي. يمكن لبعض المركبات غير القطبية أن تذوب في طبقة الدهون الثنائية وتعبر الغشاء بدون مساعدة ، ولكن بالنسبة للمركبات أو الأيونات القطبية أو المشحونة ، فإن البروتين الغشائي ضروري لحركة الغشاء. في بعض الحالات ، يسهِّل البروتين الغشائي ببساطة انتشار المذاب إلى أسفل تدرج تركيزه ، ولكن غالبًا ما يحدث النقل ضد تدرج التركيز أو الشحنة الكهربائية أو كليهما ، وفي هذه الحالة يجب "ضخ" المواد المذابة في عملية تتطلب طاقة . قد تتحرك الأيونات أيضًا عبر الأغشية عبر القنوات الأيونية التي تشكلها البروتينات ، أو قد يتم نقلها عبر الأيونوفور ، وهي جزيئات صغيرة تخفي شحنة الأيونات وتسمح لها بالانتشار عبر طبقة ثنائية الدهون. مع استثناءات قليلة جدًا ، يتم التوسط في حركة الجزيئات الصغيرة عبر غشاء البلازما بواسطة بروتينات مثل القنوات عبر الغشاء أو الناقلات أو المضخات.

أ) الانتشار السلبي

لا تتطلب حركة الجزيئات عبر الغشاء عن طريق النقل السلبي مدخلات من الطاقة الأيضية. ينتقل الجزيء من تركيز عالٍ إلى تركيز أقل. لا يتطلب النقل السلبي عن طريق الانتشار البسيط وجود بروتينات غشائية متكاملة. يتناسب معدل حركة الجزيء (مثل الماء والغازات واليوريا) عن طريق الانتشار البسيط بشكل مباشر مع تدرج تركيزه عبر الغشاء.

ب) الانتشار الميسر

يتطلب النقل السلبي عن طريق الانتشار الميسر وجود بروتينات غشائية محددة لتسهيل حركة الجزيء (مثل الجلوكوز والسكريات الأخرى والأحماض الأمينية ، إلخ) عبر الغشاء. بروتين النقل (على سبيل المثال ، ناقل الجلوكوز في كرات الدم الحمراء) خاص بجزيء معين ، وهو قابل للإشباع ، ويعرض حركيات الربط ، ويتأثر بدرجة الحرارة ، ودرجة الحموضة ، والمثبطات.

يعتمد الانتشار الميسر (أو الوسيط بالناقل) للجزيء عبر غشاء بيولوجي على بروتينات غشاء متكاملة محددة ، غالبًا ما تسمى الأحاديات. يرتبط الجزيء بالبروتين الموجود على جانب واحد من الغشاء ، ثم يخضع البروتين لتغيير تكوين ، وينقل الجزيء عبر الغشاء ، ثم يطلقه على الجانب الآخر. تشمل الجزيئات المنقولة عبر الأغشية الجزيئات المحبة للماء مثل الجلوكوز والسكريات الأخرى والأحماض الأمينية. تكون بروتينات النقل محددة لجزيء معين أو مجموعة جزيئات متشابهة هيكليًا. بروتينات النقل قادرة على التشبع وتتأثر بدرجة الحرارة ودرجة الحموضة وجزيئات المثبط.

ج) النقل النشط

يحدث النقل النشط مقابل تدرجات التركيز ويتوسطه البروتينات الحاملة. تستخدم الطاقة الأيضية لتحريك الأيونات أو الجزيئات ضد تدرج التركيز. ينتج عن النقل النشط تراكم المذاب على جانب واحد من الغشاء. النقل النشط هو نوعان من النقل الأساسي النشط والنقل النشط الثانوي.

النقل النشط الثانوي

يُعرف النقل النشط الثانوي أيضًا باسم النقل غير المباشر. إنه التحول بوساطة البروتين الحامل للجزيئات والأيونات. يحدث ذلك عندما يقترن النقل الداخلي (صعودًا) لمذاب واحد بالتدفق المفرط (هبوطًا) لمذاب مختلف تم ضخه في الأصل بواسطة النقل النشط الأولي. النقل النشط الثانوي هو إما symport أو مضاد ، اعتمادًا على ما إذا كان المذابان يتحركان في نفس الاتجاه أو الاتجاه المعاكس.

مفهوم المنفذ الموحد ، والرمز ، والمنفذ

هذه هي أنواع النقل النشط التي تحتاج إلى بروتين ناقل لجزيئات التحويل من جانب إلى جانب آخر من الغشاء.

الرمز & # 8211 عندما يتحرك الجزيء المنقول والأيون المنقولة المشتركة في نفس الاتجاه ، تسمى العملية symport.

أنتيبورت & # 8211 عندما يتحرك الجزيء المنقول والأيون المنقول المشترك في الاتجاه المعاكس ، تسمى العملية المنفذ المضاد.

Uniport & # 8211 يحمل الناقلون مادة واحدة فقط من جانب إلى الجانب الآخر من الغشاء المعروف باسم uniport.

ناقل الجلوكوز Na +: مثال على النقل النشط الثانوي

من الأمثلة الشائعة على النقل النشط الثانوي رمز Na والجلوكوز. يسمح ناقل البروتين عبر الغشاء Na-glucose المعروف أيضًا باسم الناقلات المشتركة Na -glucose أو الناقلات المتزامنة لـ Na والجلوكوز بدخول الخلية معًا. متنازلات Na -glucose هي عائلة من ناقلات الجلوكوز الموجودة على السطح القمي (الذي يواجه التجويف) لخلية ظهارة الأمعاء الدقيقة وتنقل جزيئات الجلوكوز بنشاط إلى الخلية من القناة الهضمية. تتدفق Na + إلى أسفل تدرج تركيزها بينما يتم نقل جزيئات الجلوكوز مقابل تدرج تركيزها إلى الخلية.

في وقت لاحق يتم ضخ Na + للخارج من الخلية بواسطة Na + -K + ATPase وبالتالي الحفاظ على التدرج الداخلي Na +. يسمح GLUT المحصور في الأسطح القاعدية (القاعدية والجانبية) للخلية لنفس الجزيء بمغادرة الخلية عن طريق الانتشار الميسر في السائل خارج الخلية على الجانب الآخر من الظهارة.

وبالمثل ، فإن نفاذية اللاكتوز (المعروفة أيضًا باسم نفاذية الجالاكتوزيد) الموجودة في غشاء البلازما للبكتيريا مثل الإشريكية القولونية ، تستخدم التدرج البروتوني عبر الغشاء لنقل البروتون واللاكتوز معًا (أعراض بروتون اللاكتوز).

د) انتقال المجموعة

النقل غير النشط ، تتحرك الجزيئات الذائبة عبر غشاء دون تعديل. العديد من بدائيات النوى تأخذ أيضًا الجزيئات عن طريق الانتقال الجماعي ، وهي عملية يتم فيها نقل الجزيء إلى الخلية أثناء تغييره كيميائيًا. على سبيل المثال ، Phosphoenolpyruvate: Sugar phosphotransferase system (PTS). ينقل مجموعة متنوعة من السكريات أثناء فسفرتها باستخدام phosphoenolpyruvate (PEP) كمانح للفوسفات.

PEP + سكر (خارجي) - & GT بيروفات + سكر- P (من الداخل)

في E. coli و Salmonella typhimurium ، يتكون من إنزيمين وبروتين منخفض الوزن الجزيئي مستقر للحرارة (HPr). HPr والإنزيم I (EI) هي السيتوبلازم. الإنزيم الثاني (EII) أكثر تنوعًا في الهيكل وغالبًا ما يتكون من ثلاث وحدات فرعية أو مجالات. EIIA هو السيتوبلازم وقابل للذوبان. EIIB أيضًا محب للماء ولكنه مرتبط كثيرًا بـ EIIC ، وهو بروتين مسعور مضمن في الغشاء. يتم نقل الفوسفات عالي الطاقة من PEP إلى الإنزيم II (EII) بمساعدة إنزيم I (EI) و HPr. ثم يتم فسفرة جزيء السكر حيث يتم حمله عبر الغشاء بواسطة الإنزيم II (EII). ينقل الإنزيم II (EII) سكريات محددة فقط ويختلف باختلاف PTS ، في حين أن الإنزيم I (EI) و HPr شائعان في جميع PTS & # 8217s.


فسيولوجيا وتطور نقل اليوريا في الأسماك

تلخص هذه المراجعة ما هو معروف حاليًا عن ناقلات اليوريا في الأسماك في سياق علم وظائف الأعضاء وتطورها داخل الفقاريات. تم التحقق من وجود ناقلات اليوريا في خلايا الدم الحمراء وخلايا الكبد للأسماك وكذلك في الخلايا الكلوية والخيشومية. لا يُعرف سوى القليل عن نقل اليوريا في خلايا الدم الحمراء وخلايا الكبد ، في الواقع ، لا يُعتقد أن ناقلات اليوريا موجودة في كريات الدم الحمراء في الخياشيم ولا في الأسماك البعيدة. ما هو القليل من الأدلة الفسيولوجية على نقل اليوريا عبر الخلايا الكبدية للأسماك لا تدعمه الأدلة الجزيئية ويمكن تفسيره بواسطة ناقلات أخرى. في المقابل ، كانت النتائج المبكرة على ناقلات اليوريا الكلوية elasmobranch هي الدافع للبحث في الكائنات الحية الأخرى. نقل اليوريا في كل من وظائف الكلى والخياشيم elasmobranch للاحتفاظ باليوريا داخل الحيوان مقابل تدرج تركيز هائل مع البيئة. المعلومات عن ناقلات اليوريا الخيشومية والكلوية في أسماك teleost حديثة بالمقارنة ولكن في teleosts يبدو أن ناقلات اليوريا تعمل للإفراز وليس الاحتفاظ كما هو الحال في elasmobranchs. إن وجود ناقلات اليوريا في الأسماك التي تنتج كمية وفيرة من اليوريا ، مثل elasmobranchs و teleosts ureotelic ، أمر معقول. ومع ذلك ، فإن وجود ناقلات اليوريا في الأسماك المنتجة للأمونيا أمر مثير للفضول ويمكن أن يكون بسبب قدرتها على تصنيع اليوريا في وقت مبكر من الحياة كوسيلة لتجنب سمية الأمونيا. من المعتقد أن عائلة الجينات الناقلة لليوريا المنتشرة (UT) قد خضعت لتغيرات تطورية كبيرة ، على الأرجح بالاقتران مع دور نقل اليوريا في تطور الأرض في الفقاريات.

هذه معاينة لمحتوى الاشتراك ، والوصول عبر مؤسستك.


المواد والأساليب

حيوانات تجريبية

ضفدع الخليج [Opsanus بيتا Goode and Bean 0.074 ± 0.003 كجم (ن= 50) ، 0.044 - 0.140 كجم] باستخدام شباك الجر بواسطة شباك الجر بواسطة الجمبري التجاري في خليج بيسكين بولاية فلوريدا في شتاء 2002-2003. تم احتجاز الضفادع في خزان خارجي في منشأة احتجاز الجمبري مع مياه البحر الجارية (الظروف الموسمية المحيطة) لمدة لا تزيد عن 24 ساعة بعد اصطيادها ، ثم نقلها إلى المختبر حيث تم احتجازها لمدة تصل إلى شهر واحد. عولجت الأسماك بجرعة من أخضر الملكيت (التركيز النهائي 0.05 مجم لتر -1) في الفورمالين (15 مجم لتر -1) (أكوافيت ، هايوارد ، كاليفورنيا ، الولايات المتحدة الأمريكية) في يوم نقلها إلى المختبر لمنع العدوى عن طريق الهدبية مهيجات الكريبتوكاريون (ستوسكوف ، 1993). في البداية ، تم الاحتفاظ بالأسماك في أحواض زجاجية سعة 50 لترًا مع تدفق مياه البحر الغازية. تم الحفاظ على الأسماك في هذه البيئة المزدحمة نسبيًا (& gt10 أسماك لكل خزان) من أجل بدء التحول إلى ureotelism (Walsh et al. ، 1994). كانت درجة حرارة الماء 24-26 درجة مئوية. تم تغذية الأسماك بالحبّار أسبوعياً حتى وقت الجراحة.

بروتوكول تجريبي

كما أوضح وود وآخرون (1997) وماكدونالد وآخرون (2000) ، تم إجراء قسطرة الشريان الذيلية على الأسماك التي تم تخديرها باستخدام MS-222 (0.5 جم -1 سيجما ألدريتش ، سانت لويس ، ميزوري ، الولايات المتحدة الأمريكية) وملفوفة باستخدام مناشف مبللة. تم إدخال القسطرة داخل الصفاق (Clay-Adams PE50) المملوءة بمحلول ملحي لضفدع السمك (Walsh ، 1987) من خلال شق بطني صغير وخيوطها حوالي 4 سم داخل تجويف الجسم. تمت معالجة الجرح بمسحوق أوكسي تتراسيكلين من أجل منع العدوى وتم خياطة القسطرة بإحكام باستخدام الحرير 3-0 في موقع الخروج. خيط إضافي يؤمن القسطرة فقط أمام شق القسطرة الشريانية واثنان آخران يؤمنانه على طول الكم 160 PE الشرياني. تُركت الأسماك لتتعافى دون إزعاج في غرف التدفق المحمية الفردية مع ملجأ من الأنابيب البلاستيكية لمدة 24 ساعة ، وفي ذلك الوقت تم تأكيد سالكية القسطرة الشريانية. الشرايين العاملة و i.p. ثم تُركت القسطرة خارج غرفة التدفق متصلة بحقنة ، حتى لا تزعج الأسماك مرة أخرى بالبحث عن القسطرة داخل الغرفة. تُركت الأسماك طوال الليل (لما مجموعه 36 ساعة من الانتعاش) ، وبعد ذلك الوقت توقف تدفق المياه إلى غرفة التدفق. بدون إزعاج الأسماك ، انخفض مستوى الماء بسرعة إلى علامة حجم دقيقة من 1.35 إلى 2.0 لتر من خلال ثقب صغير في غرفة التدفق ، وحافظت التهوية القوية على الخلط الشامل والضغط الجزئي للأكسجين (صا2) قريبة من تشبع الهواء. تم أخذ عينة ماء (5 مل) لقياس تركيز اليوريا والأمونيا الأولي و [3 H] PEG 4000 عدد. بعد ذلك ، تم أخذ عينات المياه كل ساعة حتى حقن العامل الدوائي الأول (انظر أدناه) ، وبعد ذلك تم أخذ عينات المياه كل 30 دقيقة تقريبًا (ما لم يذكر خلاف ذلك) لبقية التجربة.

التجارب الدوائية

تم إجراء التجارب الدوائية من أجل تحديد مستقبلات 5-HT المتضمنة في تشغيل آلية إفراز اليوريا النابضة لضفدع الخليج. تضمنت العوامل الدوائية المستخدمة في الدراسة الحالية 5-HT الانتقائي1 أ ناهض مستقبلات 8-OH-DPAT [8-hydroxy-2- (di-n-pro-pylamino) tetralin hydrobromide Sigma-Aldrich] ، 5-HT2 ناهض المستقبلات α-methyl-5-HT (Sigma-Aldrich) و 5-HT2 مضادات مستقبلات الكيتانسيرين (ملح طرطرات كيتانسيرين سيغما الدريتش). تم تنفيذ ثماني سلاسل تجريبية مختلفة. في السلسلتين 1 و 2 ، تم حقن الأسماك (1 ميكروليتر مل - 1 ملحي كجم -1 سمكة) مع 8-OH-DPAT (ن= 6) orα-methyl-5-HT (ن= 27) ، على التوالي ، عبر قسطرة الشرايين تليها 3 مل كجم -1 ضفدع سمك ملحي. تم حساب هذه الجرعة لإعطاء تركيزات متداولة من 3 × 10-6 مول لتر -1 ، وهي قريبة من مستويات السيروتونين المنتشرة المقاسة في سمكة الضفدع (10 - 7 - 10 - 6 مول لتر - 1) والمطابقة لجرعة السيروتونين المستخدمة على سمك الضفادع في دراسة حديثة (Wood et al.، 2003). في سلسلة تجريبية منفصلة (السلسلة 3) ، تم فحص إمكانية زيادة نفاذية الخيشوم غير المحددة استجابةً لحقن α-methyl-5-HT عن طريق حقن جرعة قدرها 50 ميكروغرامًا مكعبًا كجم -1 من كتلة الجسم [3 ساعات] PEG 4000 (بيركين إلمر ، ويليسلي ، ماساتشوستس ، الولايات المتحدة الأمريكية) عبر القسطرة الشريانية الذيلية تليها 3 مل كجم إضافية -1 من محلول ملحي (ن= 8). تُرك سمكة الطود بعد ذلك طوال الليل للسماح بموازنة [3 H] PEG 4000 في جميع أنحاء الفضاء خارج الخلية كما وصفه ماكدونالد وآخرون (2000). في السلسلة 4 ، تم قياس وقت α-methyl-5-HT لاستخراج نبض اليوريا (ن= 6). في هذه السلسلة ، بدأ الموقت فورًا بعد حقن أول سمكة العلجوم وأخذت عينات من الماء بدقة كل خمس دقائق على مدار الخمسين دقيقة التالية. في نفس الوقت ، تم حقن كل سمكة متبقية ولاحظ وقت الحقن. ثم تم تحديد الوقت الذي تستغرقه كل سمكة في النبض. في أربع سلاسل تجريبية منفصلة (السلسلة 5 ، ن= 4 سلسلة 6 ، ن= 5 سلسلة 7 ، ن= 5 سلسلة 8 ، ن= 7) ، أربع جرعات مختلفة من 5-HT2 تم حقن مضادات مستقبلات الكيتانسيرين (0.01 ، 0.1 ، 1 و 10 ميكرولتر مل -1 كجم -1) عبر i.p. قسطرة في 45٪ (وزن / حجم) HBC (2-هيدروكسي بروبيل- بيتا-سيكلودكسترين ، مادة مذابة غير سامة سيجما-ألدريتش) قبل ساعة واحدة من الحقن الشرياني لـ α-methyl-5-HT. نظرًا لضرورة وجود عامل مذيب ، فإن i.p. يعتبر حقن الكيتانسيرين طريقة علاج أكثر ملاءمة.

التقنيات والحسابات التحليلية

تم قياس تركيزات اليوريا في الدم والماء باستخدام طريقة ثنائي أسيتيل مونوكسيم لرحمة الله وبويد (1980) ، مع التعديلات المناسبة لقوة الكاشف لنطاقات تركيز اليوريا المختلفة في الماء وبلازما الدم. تم قياس تركيزات الأمونيا في الماء بطريقة الإندوفينول الأزرق (Ivancic and Degobbis ، 1984). تم قياس تركيزات الكورتيزول في البلازما باستخدام مجموعة مقايسة مناعية إشعاعية تجارية [125 I] (ICN Biomedicals Inc. ، كوستا ميسا ، كاليفورنيا ، الولايات المتحدة الأمريكية) مع معايير مخففة إلى نفس نطاق البروتين مثل بلازما الضفدع. لقياسات [3 H] PEG 4000 ، تمت إضافة عينات الماء (2 مل) إلى 10 مل من فلور Ecolume (ICN Biomedicals Inc.) وتم تحليلها عن طريق عد التلألؤ على عداد TM Analytic 6895 BetaTrac.

إحصائيات

يتم الإبلاغ عن البيانات كوسائل ± 1 ثانية. ه. م. (ن= عدد الأسماك). في حالة مقارنة وسيلتين فقط ، تم تقييم أهمية الفروق بين الوسائل باستخدام الطالب غير المزاوج ثنائي الطرف ر-اختبار(ص& lt0.05 Nemenyi et al. ، 1977). عند النظر إلى أهمية الاختلافات بين مجموعة العلاج بمرور الوقت ، تم استخدام تحليل مقاييس متكررة أحادي الاتجاه (ANOVA) مع مرور الوقت كعامل رئيسي متبوعًا بتصحيح Bonferroni لمقارنات متعددة. عند النظر إلى أهمية الاختلافات بين مجموعتي علاج بمرور الوقت ، تم استخدام مقاييس متكررة ثنائية الاتجاه ANOVA مع الوقت ومجموعة العلاج باعتبارها العوامل الرئيسية وتبعها اختبار هولم سيداك لمقارنات عينات متعددة.


تأثير التعبئة الدهنية على سلوك الطور متعدد الأشكال وخصائص الغشاء

تم النظر في التجميع الذاتي لجزيئات الفسفوليبيد في شكل طبقة ثنائية من حيث الأشكال الجزيئية المكافئة التي تمثل القوى بين الجزيئات. تم تقريب الحجم المكافئ لكل مجموعة رأس فوسفورية بواسطة الحجم الذري الصافي بالإضافة إلى حجم جزيئات الماء المرتبطة ، والتي تم اشتقاقها من تجارب تقسيم الماء / الهيدروكربون. تم اشتقاق الأطوال المكافئة لسلاسل الأسيل غير المشبعة من بيانات وقت الاستبقاء من القياسات الكروماتوجرافية. تم حساب الانحناء التلقائي لطبقات الفسفوليبيد الأحادية المختلفة من الأشكال الجزيئية المكافئة ، وتم حساب الطاقة المطلوبة لتسطيحها إلى مستوى الطبقة الثنائية ، باستخدام معامل الانحناء المعروف. مع زيادة طاقة الانحناء ، أظهرت المخاليط قابلية متزايدة للفوسفوليباز A2 ، ومعدل نقل الدهون الميسر عن طريق بروتينات تبادل الفسفوليبيد ، والنفاذية إلى الكربوكسي فلورسين ، ودمج بروتينات كرات الدم الحمراء البشرية ، ونقل الكالسيوم بواسطة Ca-ATPase من شبكية الساركوبلازم في الحويصلات المعاد تشكيلها. عندما تم تطبيق الحساب على التراكيب الدهنية المعروفة لتسعة أغشية خلوية ، وجد أن نسبة البروتين / الدهون ونسبة الفوسفوليبيد / الكوليسترول لها علاقة موجبة وسلبية ، على التوالي ، مع طاقة الانحناء الكامنة للفوسفوليبيدات. قد تكون نفقات الطاقة المتوافقة مع مرحلة ثنائية الطبقة معلمة فيزيائية مهمة فيما يتعلق بالنشاط والتكوين الحيوي للأغشية.


وظيفة نقل الكوليسترول في إستريز كوليسترول البنكرياس: توجيه امتصاص الستيرول والأسترة في الخلايا المعوية

مشاهدات المقالات هي مجموع تنزيلات النصوص الكاملة للمقالات المتوافقة مع COUNTER منذ نوفمبر 2008 (بتنسيق PDF و HTML) عبر جميع المؤسسات والأفراد. يتم تحديث هذه المقاييس بانتظام لتعكس الاستخدام حتى الأيام القليلة الماضية.

الاقتباسات هي عدد المقالات الأخرى المقتبسة من هذه المقالة ، ويتم حسابها بواسطة Crossref ويتم تحديثها يوميًا. اعثر على مزيد من المعلومات حول عدد الاقتباسات من Crossref.

درجة الانتباه Altmetric هي مقياس كمي للانتباه الذي تلقته مقالة بحثية عبر الإنترنت. سيؤدي النقر فوق أيقونة الكعك إلى تحميل صفحة على altmetric.com تحتوي على تفاصيل إضافية حول النتيجة ووجود وسائل التواصل الاجتماعي للمقالة المحددة. يمكنك العثور على مزيد من المعلومات حول "نقاط الانتباه البديلة" وكيفية احتساب النتيجة.

ملحوظة: بدلاً من الملخص ، هذه هي الصفحة الأولى للمقالة.


أ 2. الانتشار الميسر - علم الأحياء

قسم الصيدلة ، كلية تشونغشان للطب ، جامعة صن يات صن

قسم الصيدلة ، كلية تشونغشان للطب ، جامعة صن يات صن

قسم الصيدلة ، كلية تشونغشان للطب ، جامعة صن يات صن

قسم الصيدلة ، كلية تشونغشان للطب ، جامعة صن يات صن

قسم الصيدلة ، كلية تشونغشان للطب ، جامعة صن يات صن

أقسام الجراحة وعلم وظائف الأعضاء ، معهد العلوم الطبية ، كلية الطب ، جامعة تورنتو

قسم الصيدلة ، كلية تشونغشان للطب ، جامعة صن يات صن

أقسام الجراحة وعلم وظائف الأعضاء ، معهد العلوم الطبية ، كلية الطب ، جامعة تورنتو

قسم الصيدلة ، كلية تشونغشان للطب ، جامعة صن يات صن

قسم الصيدلة ، كلية تشونغشان للطب ، جامعة صن يات صن

2016 المجلد 80 العدد 11 الصفحات 2397-2406

  • تاريخ النشر: 25 أكتوبر 2016 تم الاستلام: 09 أغسطس 2016 تم الإصدار في J-STAGE: 25 أكتوبر 2016 تم القبول: 23 سبتمبر 2016 النشر المسبق عبر الإنترنت: 19 أكتوبر 2016 تمت المراجعة: 18 سبتمبر 2016

(متوافق مع EndNote و Reference Manager و ProCite و RefWorks)

(متوافق مع BibDesk و LaTeX)

خلفية: أظهرت الأبحاث السابقة أن ClC-3 مسؤول عن Cl المنظم بالحجم - التيار (أناCl.vol) في خلايا العضلات الملساء الوعائية (VSMCs). ومع ذلك ، لا يزال من غير الواضح ما إذا كان يتم نقل ClC-3 إلى أغشية الخلايا وكيف يتم نقله ، مما يؤدي إلى تغيير أناCl.vol.

الطرق والنتائج: تيار الكلوريد المنظم بالحجم (أناCl.vol) عن طريق تسجيل المشبك للخلية الكاملة ، وتم إجراء النشاف الغربي والترسيب المناعي المشترك لفحص التعبير البروتيني والتفاعل بين البروتين والبروتين. تم استخدام التصوير بالخلايا الحية لمراقبة نقل ClC-3. أظهرت النتائج أن الإفراط في التعبير عن إندوفيلين A2 يمكن أن يزيد أناCl.vol، بينما انخفض ضربة قاضية إندوفيلين A2 أناCl.vol. بالإضافة إلى ذلك ، توسط مجال SH3 للإندوفيلين A2 في تفاعله مع ClC-3 ويعزز نقل ClC-3 من السيتوبلازم إلى أغشية الخلايا. تم التحقق أيضًا من تنظيم نشاط قناة ClC-3 في خلايا العضلات الملساء الشريانية القاعدية (BASMCs) المعزولة من الفئران المعدلة وراثيًا من الإندوفيلين A2. علاوة على ذلك ، يزيد الإندوفيلين A2 من انتشار VSMCs الناجم عن endothelin-1 أو نقص الأسمولية.

الاستنتاجات: حددت الدراسة الحالية الإندوفيلين A2 كشريك قناة ClC-3 ، والذي يعمل بمثابة رؤية جديدة للاتجار ClC-3 في تنظيم أناCl.vol في VSMCs. توفر هذه الدراسة آلية جديدة ينظم من خلالها الإندوفيلين A2 نشاط قناة ClC-3 ، ويلقي الضوء على كيفية نقل ClC-3 إلى أغشية الخلايا لتلعب دورها الحاسم كقناة كلوريد في وظيفة VSMCs ، والتي قد تكون متورطة في أمراض القلب والأوعية الدموية. . (سيرك ج 2016 80: 2397–2406)

توازن حجم الخلية هو نشاط فسيولوجي أساسي في الخلايا حقيقية النواة. أثناء تنظيم حجم الخلية استجابة لتورم الخلية ، يترافق تدفق K + و Cl - مع زيادة في إطلاق الماء الملزم تناضحيًا من الخلية ، مما يؤدي بدوره إلى تقليل حجم الخلية. 1 تُعرف هذه العملية باسم تقليل الحجم التنظيمي (RVD) وقنوات الأنيون المنظمة للحجم (VRACs) ضرورية لتنظيم حجم الخلية بعد التورم في معظم أنواع الخلايا الفقارية. على الرغم من وصف الوظائف الفسيولوجية والمرضية لـ VRAC بالتفصيل ، إلا أن هويتها الجزيئية لا تزال مثيرة للجدل. في الآونة الأخيرة ، تم تحديد SWELL 1 (التكرارات الغنية بالليوسين التي تحتوي على 8A ، LRRC8A) على أنها مكون أساسي لقناة الأنيون التي يتم تنظيمها بالحجم ، والتي تكون قريبة من ، أو تشكل مسام ، قناة الكلوريد التي يتم تنظيمها بالحجم باستخدام شاشة RNAi على مستوى الجينوم في خلايا HEK293T. 2 ، 3 ومع ذلك ، فإن التركيب الجزيئي لـ VRAC لا يزال بعيدًا عن الحل. كما ورد مؤخرًا في خلايا الظهارة الصبغية لشبكية العين البشرية ، فإن bestrophin 1 لا غنى عنه لتنظيم الحجم. 4 في ضوء هذه الملاحظات ، أصبح من الواضح بشكل متزايد أن VRCC قد يكون معقد قناة أنيون ، يتكون من نوع خلية أو تركيبة خاصة بالأنسجة ، بدلاً من قناة واحدة منتشرة في كل مكان. 4

يعتبر ClC-3 ، وهو عضو في عائلة قنوات ClC Cl ذات الجهد الكهربائي ، أمرًا بالغ الأهمية لتنظيم حجم الخلايا ، والتكاثر ، والاستماتة ، والإشارات التي تتم بوساطة الأكسدة والاختزال ، 5-9 وبالتالي فهو متورط بشدة في أمراض إعادة تشكيل الأوعية الدموية الدماغية الناتجة عن ارتفاع ضغط الدم ، 10 - 12 تصلب الشرايين ، 13 والاستجابات الالتهابية الوعائية. 14 ، 15 كشفت دراساتنا السابقة أن محلولًا ناقص التوتر أثار حجمًا أصليًا منظمًا خارجيًا لتصحيح Cl - التيار (أناCl.vol) ، مع انخفاض في تركيز الكلور في السيتوبلازما ([-]أنا) في خلايا العضلات الملساء الوعائية (VSMCs). رد [Cl -]أنا و أناCl.vol يمكن تعزيز التحدي ناقص التوتر عن طريق الإفراط في التعبير عن ClC-3 ، وتثبيطه بمضاد ClC-3. التيارات في VSMC (أناCl.vol) وفي ClC-3-VSMC (أناCl.ClC-3) من خلال غسيل الكلى داخل الخلايا للجسم المضاد لـ ClC-3. بالإضافة إلى ذلك ، تشير الأدلة الحالية إلى ذلك أناCl.vol و أناCl.ClC-3 تشترك في نفس الخصائص الدوائية والآليات التنظيمية ، مثل تنظيم PKC و PTK للتيارات Cl. 16

لقد أظهرنا أن بروتين ClC-3 موزع على نطاق واسع في السيتوبلازم وغشاء الخلية لـ A10 VSMCs والثقافة الأولية لـ BASMCs. على الرغم من أن ClC-3 موضعي بشكل أساسي في السيتوبلازم لبعض أنواع الخلايا ، يمكن نقل بروتين ClC-3 مؤقتًا إلى غشاء الخلية أثناء الالتقام الخلوي بوساطة الكلاذرين ، مما يشير إلى وجود آلية ديناميكية تنظم التوزيع الخلوي لبروتين ClC-3 . يظهر تهريب أعضاء بروتين القناة الأيونية من الحجرة داخل الخلايا إلى غشاء الخلية عبر بروتين مكوك كعامل رئيسي يشارك في تنظيم القناة الأيونية. 18 ، 19

الإندوفيلينات هي عائلة من البروتينات المحفوظة تطوريًا ، والتي تم توثيقها جيدًا في مسار الالتقام الخلوي ، حيث يمكن للإندوفيلينات الارتباط بغشاء الخلية ، والحث على انحناء الغشاء لتشكيل سقالة جزيئية ، ومن ثم تعزيز الاتجار الفعال بالبروتين الداخلي. 20 من بين أفراد عائلة الإندوفيلين أ الأكثر دراسة على نطاق واسع ، يتم التعبير عن الإندوفيلين A2 في كل مكان في الخلايا حقيقية النواة. تحتوي جميع أشكال الإندوفيلنات على مجالين وظيفيين رئيسيين: مجال N-terminal Bin-amphiphysin-Rvs (BAR) ومجال C-terminal Src homology 3 (SH3). أثناء عملية إعادة تشكيل الغشاء ، تكون مجالات N-BAR عبارة عن مستشعرات لانحناء الغشاء وتوفر سقالة جزيئية تجمع بين أنشطة الانحناء وعمليات تفاعل بروتينية محددة ومجال SH3 هو منطقة الارتباط التي يمكن من خلالها التعرف على مجالات إندوفيلين الغنية بالبرولين ( PRDs) وتجنيد بروتينات تهريب الأغشية الأساسية. تدعم الأدلة المتراكمة أيضًا دورًا ناشئًا للإندوفيلنات في وظائف مستقبلات غشاء الخلية عبر آليات تهريب البروتين. 20-22 على سبيل المثال ، يلزم وجود تفاعل مباشر بين إندوفيلين A2 وقناة Ca 2+ المعتمدة على الجهد من أجل الالتقام الخلوي الحويصلي المشبكي ، ويعمل PRDs داخل إندوفيلين A2 على الإحساس بتركيز Ca 2+ داخل الخلايا وتنظيم تكوين الإندوفيلين -Ca 2+ مجمع القنوات. 23 To date, whether and how endophilin A2 is involved in regulating أناCl.vol, subcellular distribution of ClC-3 proteins, and VSMC proliferation remains unclear.

In the present study, we found endophilin A2 is expressed abundantly in BASMCs, we also demonstrated that endophilin A2 participates in the regulation of hypotonic-activated أناCl.vol in BASMCs. BASMCs isolated from endophilin A2 transgenic mice exhibited a high degree of ClC-3 protein accumulation on the cell surface of BASMCs, a marked enhancement of hypotonic-induced أناCl.vol, and elevated endothelin-1 or hypotonic-induced BASMC proliferation. By constructing three deletion mutants that failed to induce the function of the SH3, PRD or BAR domain in endophilin A2, the ClC-3 binding site in endophilin A2 was ascribed to the C-terminal SH3 domain. The SH3 deletion mutant of endophilin A2 completely abolished its association with ClC-3 and resulted in a significant decrease in cell membrane localization of ClC-3. Our findings suggest an endophilin A2-mediated protein trafficking mechanism, coupling intracellular ClC-3 to cell membrane أناCl.vol for VSMC functions.

The full-length endophilin A2 sequence was amplified from cultured rat BASMCs using TRIzol reagent (Invitrogen). Then the coding sequence of endophilin A2 was amplified using full-length cDNA as a template, and the primers were ATGTCGGTGGCGGGGCTGAAGAAG (forward) and TCACTGAGGCAGAGGCACCAG (reverse). The construction of the recombinant plasmid pCMV-endophilin A2-flag was performed by using an overlap extension poly-merasechainreaction (PCR) cloningmethod.

Endophilin A2 Transgenic Mice

The full-length murine endophilin A2 cDNA coding sequence was infused into an EX3d-CMV-IRES vector. After linearization and subsequent gel-purification, this vector was microinjected into the pronuclei of fertilized C57BL/6J mouse eggs. PCR was used for genotyping. The primers used for genotyping were: 5′-CCAAAATGTCGTAACAACTCCG-3′ (forward) and 5′-GGCCTTACTGGTGATATCCACT-3′ (reverse).

The siRNA (small interfering RNA) duplexes against the rat endophilin A2 gene (Gene ID: 81922) was designed and constructed by QIAGEN and transfected with Hyperfect Transfection Reagent, according to the manufacturer’s instructions (QIAGEN). The working concentration of endophilin A2 siRNA was 40 nmol/L. A negative siRNA (QIAGEN) was used as a negative control. The cells were then used for western blot and patch-clamp studies after 48 h.

BASMC Isolation and Culture

Basilar arterial smooth muscle cells were isolated and cultured, as previously described. 11 Freshly isolated BASMCs were stored at 4℃ and used for patch-clamp experiments within 10 h. The BASMC cells in passage 8 through 12 were used for cell proliferation assays.

Cell Culture and Plasmid Transfection

The A10 vascular smooth muscle cells (American Type Culture Collection) were cultured at 37℃ under 5% CO2 in DMEMF/12 supplemented with 10% fetal bovine serum (Sigma-Aldrich) and 1% penicillin-streptomycin, as previously described. 15 Plasmids were transfected into the cells at 80% confluence with Lipofectamine 2000, according to the manufacturer’s instruction (Invitrogen).

The whole-cell Cl – currents were recorded with an Axopatch 200B Amplifier (Axon Instruments, Foster City, CA, USA), as previously described. 16 Briefly, the currents were elicited with voltage steps from –100 mV to +120 mV in +20 mV increment for 400 ms, and with an interval of 5 s from a holding potential of –40 mV. Currents were sampled at 5 kHz using pCLAMP8.0 software (Axon Instruments) and filtered at 2 kHz. The hypotonic bath solution contained (mmol/L): N-methyl-D-glucamine chloride (NMDG-Cl) 107, MgCl2 1.5, MnCl2 0.5, CdCl2 0.5, GdCl3 0.05, glucose 10, and Hepes 10 pH 7.4 was adjusted with NMDG. The osmolarity of this solution, measured by a freezing-point depression osmometer (OSMOMAT030 Germany), was 230 mOsm/L. The isosmotic bath solution was the same as the hyposmotic bath solution, except that the osmolarity was adjusted by adding mannitol to 300 mOsm/L. An internal pipette solution (300 mOsm/L) contained (mmol/L): CsCl 95, TEA chloride 20, ATP-Mg 5, HEPES 5, EGTA 5, D-mannitol 80 pH 7.2 was adjusted with CsOH.

Immunoprecipitation and Western Blot Analysis

The A10 cells or cultured BASMCs were lysed in non-denaturing lysis buffer (50 mmol/L Tris, 150 mmol/L NaCl, 1 mmol/L EDTA, 1% TritonX-100) with 1% protease inhibitor. The immunoprecipitation assay was performed, as previously described. 24 Briefly, the supernatants were incubated with endophilin A2 (Santa Cruz, CA, USA), ClC-3 (Alomone Labs), or GFP antibodies (Santa Cruz) overnight at 4℃, then incubated with Protein A/G beads (Santa Cruz) for 4 h. Beads were washed three times with lysis buffer and the proteins were separated by Western Blotting.

Subcellular Fractionation Isolation

The membrane and cytosolic proteins were isolated by using a Qproteome Cell Compartment Kit (QIAGEN) according to the manufacturer’s instructions.

The A10 vascular smooth muscle cells were co-transfected with pEGFP-C1-ClC-3 plasmid and RFP-endophilin A2 full-length plasmid, or with the recombinant plasmid of endophilin A2 deletion mutants (RFP-endophilin A2-∆PRD, RFP-endophilin A2-∆SH3 plasmid or RFP-endophilin A2-∆BAR). Eight hours later, the fluorescence was monitored in a Live Cell Station (Olympus) for 10 h.

All data are expressed as mean±SEM. Statistical significance of differences between groups was determined with a Student’s 2-tailed unpaired t-test or a one-way ANOVA. Differences in current density-voltage relationships were analyzed by using a 2-way ANOVA. For western blot and cell proliferation experiments, “n” represents the number of independent experiments. For patch-clamp experiments, “n” represents the number of cells from at least 6 different batches of cells or 6 different rats. In all tests, P<0.05 was taken to be as statistically significant.

Endophilin A2 Is Expressed Abundantly in BASMCs

To determine the expression profiles of endophilin A in BASMCs, western blotting analysis was performed using cultured rat BASMCs. Endophilin A2 protein was found to be abundantly expressed in BASMCs, while antibodies against endophilin A3 detected very faint bands, and endophilin A1 was not found (Figure S1), indicating that endophilin A2 is the predominant isoform expressed in BASMCs, and may play a functional role in the vasculature.

Endophilin A2 Regulates ICl.vol and the ClC-3 Chloride Channel

Consistent with our previous findings, 16 , 25 whole-cell patch-clamp recording results showed a very small outward Cl – current in BASMCs in the resting state, and perfusion with a hypotonic solution (230 mosmol/kg H2 O) caused cell swelling and activated أناCl.vol (شكل 1). The amplitude and current density of أناCl.vol was further increased by the overexpression of endophilin A2 (Figure 1A). Conversely, the hypotonic-induced أناCl.vol was markedly decreased by endophilin A2 siRNA (20 nmol/L) (Figure 1B), which could knockdown the endogenous endophilin A2 expression (Figure S2). Neither endogenous endophilin A2 protein expression nor أناCl.vol was affected by the transfection of negative endophilin A2 siRNA. Moreover, intracellular dialysis of an anti-endophilin A2 antibody significantly decreased the activation of أناCl.vol after perfusion with a hypotonic solution, whereas pre-absorbed anti-endophilin A2 antibody failed to alter أناCl.vol under isotonic and hypotonic conditions (Figure S3). These results suggest that endogenous endophilin A2 may participate in the regulation of أناCl.vol in response to hypo-osmolarity.

Endophilin A2 regulated أناCl.vol in basilar arterial smooth muscle cells (BASMCs). (أ) Representative traces of أناCl.vol (أ), I-V curves (ب) and mean current densities measured at ±100 mV (ج) in the control (con), GFP vector (GFP) and GFP-endophilin A2 adenovirus transfecting (GFP-endo2) groups (n=10, **P<0.05 vs. control (iso) or GFP (iso) group, *P<0.05 vs. control (hypo) or GFP (hypo) group). (ب) Representative traces of ICl.vol (أ), I-V curves (ب) and mean current densities measured at ±100 mV (ج) in the control (con), negative and endophilin A2-siRNA (endo2-siRNA) groups (n=10, **P<0.05 vs. control (iso) or neg (iso) group *P<0.05 vs. control (hypo) or neg (hypo) group).

We have documented that ClC-3 is critical for regulation of أناCl.vol in VSMCs. 16 BASMCs express ClC-3 and endophilin A2 proteins endogenously, and both are involved in hypotonic-induced أناCl.vol. We then examined whether endophilin A2 is associated with ClC-3 in regulating أناCl.vol. Patch-clamp experiments were performed on A10 cells co-transfected with ClC-3 siRNA or GFP-tagged endophilin A2 plasmid. Overexpression of endophilin A2 resulted in a substantial increase in أناCl.vol under the hypotonic condition (Figure S4). At 100 mV, the current densities of أناCl.vol were increased from 42.6±8.7 pA/pF (control) to 87.6±10.1 pA/pF (GFP-endophilin A2 overexpression). Moreover, the increased hypotonic-induced أناCl.vol by endophilin A2 overexpression in VSMCs was inhibited by co-transfection with GFP-endophilin A2 and ClC-3 siRNA. ClC-3 siRNA also inhibited hypotonic-induced أناCl.vol, supporting our previous findings that endogenous ClC-3 is important for the activation of أناCl.vol in VSMCs. Together, these data suggest that ClC-3 may be associated with endophilin A2 in regulating أناCl.vol.

Endophilin A2 Regulates ClC-3 Protein Not Through Tyrosine Phosphorylation

We then examined whether endophilin A2 affected ClC-3 protein expression. كما هو موضح في Figures 2A و ب, under isotonic conditions, neither over-expression nor knockdown of endophilin A2 could change ClC-3 protein expression in BASMCs. We have recently reported that hypo-osmolarity activates أناCl.vol through phosphorylation of tyrosine residues in the ClC-3 protein rather than through increasing ClC-3 protein expression. 25 However, neither over-expression nor knockdown of endophilin A2 affected the hypotonic-induced enhancement in ClC-3 tyrosine phosphorylation (Figures 2C,D), suggesting that there might be another mechanism underlying the association of endophilin A2 and ClC-3 in regulating أناCl.vol beyond the well-known protein phosphorylation/dephosphorylation.

Endophilin A2 did not influence ClC-3 expression and ClC-3 tyrosine phosphorylation induced by hypo-osmolarity. (أ,ب) Representative western blot illustrating that neither endophilin A2 siRNA nor adnovirus-mediated endophilin A2 overexpression (Ad-endo2) affected total ClC-3 protein levels in A10 cells (n=6). (ج,د) Hypotonic-induced tyrosine phosphorylation of ClC-3 protein in A10 cells were not affected by endophilin A2 siRNA or adenovirus endophilin A2 expression. p-Y, phospho-tyrosine antibody (n=6).

Interaction of Endophilin A2 and ClC-3 Facilitates ClC-3 Trafficking to Cell Membrane

The co-immunoprecipitation assay in BASMCs demonstrated that there is an interaction between ClC-3 and endophilin A2 proteins (Figure 3A). Endophilins are best known for their functions in membrane curvature induction and/or stabilization during endocytosis. In the endocytic pathway, endophilin A2 can bind to signaling proteins and assemble and traffic these proteins between the cytoplasm and cell membrane. The ClC-3 protein is ubiquitously expressed in mammalian cells, but was reported to be located primarily in the cytoplasm of several cell types. 17 We therefore examine whether the interaction between ClC-3 and endophilin A2 may have a functional effect on the localization of ClC-3 protein in BASMCs. The Ad-mediated endophilin A2 overexpression caused ClC-3 protein expression levels to increase significantly in the cell membrane and decrease in the cytoplasm. Conversely, the knockdown of endophilin A2 caused an increase in ClC-3 protein accumulation in the cytoplasm (Figures 3B,C).

Endophilin A2 facilitated ClC-3 trafficking from the cytoplasm to the plasma membrane in basilar arterial smooth muscle cells (BASMCs). (أ) Co-immunoprecipitation analysis of endophilin A2 and ClC-3 protein interaction in cultured BASMCs. (ب,ج) Western blots analysis of the ClC3 protein in the membrane and cytoplasm from the control BASMCs (con), BASMCs transfecting vector and endophilin A2 adenovirus (Ad-endo2), or BASMCs transfecting negative and endophilin A2 siRNA (endo2siRNA) (n=6, *P<0.05 vs. corresponding controls).

To study if endophilin A2 regulates ClC-3 trafficking and hypotonic-activated أناCl.vol ex vivo, we generated transgenic mice that overexpress endophilin A2 (Figures S5A,ب). The results from endophilin A2 transgenic mice (endo2 Tg ) support the idea that endophilin A2 facilitates ClC-3 trafficking from the cytoplasm to the plasma membrane in BASMCs. Primary cultures of BASMCs from endo2 Tg showed a much higher level of ClC-3 protein expression at the site of the plasma membrane than in wild type (WT) mice by immunofluorescent staining (Figure 4A). Under the hypotonic condition, Endo2 Tg BASMCs also exhibit a larger أناCl.vol than those of age-matched WT mice. The mean current density of أناCl.vol was significantly higher in endo2 Tg BASMCs than in the WT group, as shown in Figure 4B (–6.1±1.2 pApF –1 in endo2 Tg vs. –2.7±0.3 pApF –1 in WT, at –100 mV and 19.7±2.7 pApF –1 in endo2 Tg vs. 8.4±1.9 pApF –1 in WT at +100 mV, n=6). There was no significant difference between basal currents in BASMCs from endo2 Tg and WT groups under the isotonic condition (P>0.05). لأن أناCl.vol and ClC-3 Cl – currents are critical for VSMC proliferation and cerebrovascular remodeling in hypertension, 6 we then tested whether endophilin A2 affects VSMC proliferation. Figure 4C shows that cultured BASMCs from endo2 Tg had significantly higher proliferation rates compared with those from WT mice in the presence of ET-1 or hypo-osmolarity. However, we did not find a significant difference in the bodyweight and systolic blood pressure between endo2 Tg and WT during the 20 weeks of observation (Figures S5C,د).

ClC-3 is localized at the cytomembrane. أناCl.vol and cellular proliferation is increased in basilar arterial smooth muscle cells (BASMCs) from endophilin A2 transgenic mice. (أ) Immunofluorescence of ClC-3 in rat BASMCs from endophilin A2 transgenic mice (endo2 Tg ) and their wild-type (WT) littermates. (ب) Representative traces of أناCl.vol (أ), I-V curves (ب) and mean current densities measured at ±100 mV (ج) in primary cultured BASMCs from wide-type (WT) and endophilin A2 transgenic mice (endo2 Tg ). (n=10, *P<0.05 vs. isotonic WT, # P<0.05 vs. hypotonic WT). (ج) CCK-8 cell viability analysis in BASMCs from WT endo2 Tg groups treated with 10 nmol/L ET-1 for 24 h (أ) or by hypo-osmolarity for 24 h (ب). (n=5, *P<0.05 vs. WT group, # P<0.05 vs. the ET-1-treated or hypotreated WT).

Taken together, it is clear that endophilin A2 may function to enhance ClC-3 protein trafficking from the cytoplasm to the cell membrane, which could be intimately tied to the enhancement of أناCl.vol and VSMC proliferation induced by ET-1 and hypo-osmolarity.

SH3 Domain Contributes to Endophilin A2-Mediated ClC-3 Trafficking

All endophilin proteins contain 2 well-documented functional domains: a BAR domain that mediates membrane remodeling, and a C-terminal SH3 domain that serves as protein-recognition modules. Because of the interaction between endophilin A2 and ClC-3 proteins, we hypothesized that some functional domains in endophilin A2 may bind to ClC-3 and mediate its trafficking from the cytoplasm to cell membrane. To test this hypothesis, we constructed 3 endophilin A2 deletion mutants, which failed to induce the function of the: (1) SH3 domain (Endophilin A2-∆SH3) (2) BAR domain (Endophilin A2-∆BAR) and (3) PRD domain (Endophilin A2-∆PRD). كما هو موضح في الشكل 5, co-immunoprecipitation analysis showed that endophilin A2-∆BAR and endophilin A2-∆PRD still had an interaction with ClC-3 however, endophilin A2-∆SH3 exhibited no association with ClC-3. These results indicate that endophilin A2 interacts with the ClC-3 protein through the C-terminal SH3 domain.

Endophilin A2 interacts with ClC-3 by its SH3 domain. A10 cells were co-transfected with pEGFP-C1-ClC-3 and full length Flag-endophilinA2 (أ), pEGFP-C1-ClC-3 and Flag-endophilin A2-∆PRD (ب), pEGFP-C1-ClC-3 and Flag-endophilin A2-∆SH3 (ج), pEGFP-C1-ClC-3 and Flag-endophilin A2-∆BAR (د). Cell lysates were then immunoprecipitated with anti-GFP and probed with anti-Flag and anti-GFP. The normal IgG was used as a control (n=6). (ه) Schematic overview of endophilin A2 protein deletion mutants.

To verify whether the SH3 domain of endophilin A2 affects the subcellular distribution of ClC-3 protein, we first isolated the membrane and cytoplasmic protein and found that the membrane ClC-3 expression in endophilin A2 full-length and other deletion mutants groups (Figures 6A,B). We then performed live long-term fluorescence imaging to observe ClC-3 distribution dynamically. When full-length ClC-3 and endophilin A2 cDNAs were co-transfected into A10 cells, ClC-3 protein was found to be gradually recruited into the cell membrane. The transfection of full-length ClC-3 cDNA alone caused the ClC-3 fluorescence to reside mainly in the cytoplasm within the same observation period. Among the endophilin A2 mutants, the ∆PRD and ∆BAR mutants exhibited a similar capability to recruit ClC-3 protein to the plasma membrane whereas the ∆SH3 mutant retained ClC-3 fluorescence in the cytoplasm (Figure S6). We confirmed our findings by detecting the ability of ClC-3 fluorescence recovery after photobleaching (FRAP). A zone near the cell membrane was randomly selected and bleached by a strong excitation beam, where we monitored the capability of FRAP. As we had predicted, endophilin A2 enhanced the fluorescence recovery capability whereas the ∆SH3 mutant abolished this effect (Figure 6C). These results indicate that the SH3 domain is the interacting site between endophilin and ClC-3, which is also essential for trafficking ClC-3 from the cytoplasm to the cell membrane.

The SH3 domain participated in ClC-3 trafficking from the cytoplasm to the cell surface in A10 cells. Western blot analysis of the ClC3 protein in the membrane (أ) and cytoplasm (ب) from the control basilar arterial smooth muscle cells (BASMCs) (con), BASMCs transfected with a vector, endophilin A2 full length or three deletion mutants (n=6, *P<0.05). (ج) Monitoring the fluorescence recovery after photobleaching in the vector and endophilin A2 mutant transfecting groups (n=8, *P<0.01 vs. vector or ∆SH3).

In the present study, we found that ClC-3 protein expression is abundant in the cytosol and the cell membrane of BASMCs, in comparison with previous reports showing that ClC-3 was primarily localized to the cytoplasm in some cell types. We further demonstrated that endophilin A2, an adaptor protein, interacted with ClC-3 through the SH3 domain, enhanced ClC-3 trafficking from the cytoplasm to the surface membrane. We presented several lines of evidence to support the idea that endophilin A2 functions as a new trafficking mechanism regulating ClC-3 and أناCl.vol based on the following findings: (1) in BASMCs overexpressing endophilin A2 or from endophilin A2 transgenic mice, we observed a significant increase in both the magnitude of أناCl.vol and ClC-3 distribution to the cytoplasmic membrane, which were accompanied by an enhanced ET-1 or hypotonic-induced cell proliferation in BASMCs from transgenic mice, while the أناCl.vol activation by hypo-osmolarity and membrane ClC-3 trafficking was inhibited by endophilin A2 siRNA (2) the intracellular dialysis of the anti-endophilin A2 antibody specifically inhibited hypotonic-induced أناCl.vol, and co-transfection with ClC-3 siRNA markedly inhibited the large أناCl.vol induced by endophilin A2 expression and (3) there is a molecular interaction between endophilin A2 and ClC-3 proteins. By employing 3 endophilin A2 deletion mutants, we found that the SH3 domain is necessary for the interaction between endophilin A2 and ClC-3, as well as for the ClC-3 trafficking between the cytoplasm and cell membrane (الشكل 7).

Schematic of endophilin A2 regulation of ClC-3-mediated أناCl.vol in vascular smooth muscle cells (VSMCs). ClC-3 is evenly distributed in the cytoplasm and plasma membrane in VSMCs, and intracellular ClC-3 is primarily localized in the endosome and vesicle. Endophilin A2 could bind to ClC-3 by its SH3 domain and modulate ClC-3 trafficking from the cytoplasm to the plasma membrane and stabilize ClC-3 expression on the cell surface, which eventually leads to activation of the ClC-3-mediated swelling-regulated Cl – channel under hypotonic stress.

Endophilins have shown their prominent roles in the processes that require remodeling of the membrane structure. 26 , 27 It is demonstrated that endophilins can sense membrane curvature, form and expose a scaffold and large membrane surface for recruiting specific downstream interacting proteins to the membrane, which are responsible for coupling distinct plasma membrane remodeling to specific biological processes. The endophilin A2-mediated protein trafficking is evoked during the process of cell membrane bending or remodeling. Membrane bending or curvature is commonly induced in VSMCs when exposed to cell shape or volume challenges. It is therefore not surprising here to observe the association between endophilin A2 and ClC-3 during the hypotonic-induced cell volume challenge.

In contrast, a large number of previous studies have documented that ClC-3 is critical for adaptive remodeling in many cell types 28 in response to physiological and pathophysiological stresses associated with osmotic stress or cell volume perturbations, such as vascular smooth muscle reactive oxygen species (ROS) generation 29 and inflammatory responses, 30 , 31 insulin secretion, 32 – 34 VSMC proliferation and hypertensive cerebrovascular remodeling, 6 , 12 and neutrophil infiltration. 9 , 35 , 36 In VSMCs, ClC-3 protein is abundantly expressed and has functionally been associated with أناCl.vol during the development of vascular remodeling. However, before the present study, the trafficking of intracellular ClC-3 to the surface membrane upon hypotonic-induced cell swelling or endophilin-A2 overexpression had never been described. An acute cell volume challenge activates أناCl.vol and results in the efflux of Cl – , which is essential for the development of hypertensive cerebrovascular remodeling and other pathophysiological processes. These morphological alterations of VSMC under diseased conditions definitely include membrane bending or curvature. By using multiple approaches, we demonstrated here that endophilin A2 interacts with ClC-3 protein to enhance the surface membrane ClC-3 accumulation and upregulate أناCl.vol. It is important to note that BASMCs overexpressing endophilin A2 or from endophilin A2 transgenic mice exhibited no change in outward Cl – current and cell viability under the resting state or under isotonic conditions, but have significantly enhanced the أناCl.vol and increased the proliferation rate in response to ET-1 or hypo-osmolarity. These results are in agreement with the phenotype of endophilin A2 transgenic mice where there was no abnormality in body weight and systolic blood pressure. That is, endophilin A2 may participate in the activation of أناCl.vol during the development of cardiovascular diseases. Our results from a 2-kidney, 2-clip (2k2c) renohypertensive rat model agree with this inference and demonstrated that endophilin A2 protein expression and the surface membrane ClC-3 accumulation in BASMCs from 2k2c hypertensive rats were increased within 4 weeks of operation (unpublished data), which was accompanied by the upregulation of the ClC-3 channel and أناCl.vol in vascular SMC proliferation and hypertensive cerebrovascular remodeling. Together, our data indicate that an endophilin A2-associated trafficking abnormality may occur during hypertension, which may contribute to the alteration of ClC-3 function and expressions during the VSMC proliferation and hypertensive vascular remodeling.

N-terminal BAR domain and SH3 domain of endophilins are 2 key players in the regulation of membrane remodeling and reorganization of the protein-protein interaction partners. 37 , 38 The SH3 domains of endophilin recognize and bind to the proline-rich domain (PRD), which is important for endophilin-dynamin interaction 39 and endophilin-ion channel interaction. Our results from mutant analysis demonstrated that it was the SH3 domain of endophilin A2 that interact with ClC-3 and influence subcellular ClC-3 localization to the cell membrane. Whereas the N-BAR domain and PRD were not necessary. There is no PRD in ClC-3, and the ∆PRD mutant showed no effects on the interaction between endophilin A2 and ClC-3 or on the ClC-3 membrane trafficking. It therefore suggests an unknown intermolecular mechanism underlying the SH3-dependent protein-protein interaction in ClC-3 trafficking that is not reliant on PRD-recognition.

In addition to the SH3 domain, several membrane-binding mechanisms have been ascribed to ClC-3 channels, such as Src, phospholipase C-Ins(3,4,5,6) and P4. 40 , 41 Several putative trafficking motifs within ClC-3 were also suggested for ClC-3 trafficking during diverse biological processes. For example, ClC-3 could interact with clathrin and regulate the endocytosis and surface expression of ClC-3. 17 Our recent work has demonstrated that tyrosine 284 phosphorylation targeted by Src is associated with ClC-3 channel activation upon hypotonic stress in VSMCs. 25 , 40 However, the tyrosine phosphorylation signaling appears not to be involved in the endophilin A2-mediated ClC-3 trafficking mechanism, which may be due to their different influences on the subcellular localization of ClC-3. In the basal state, exogenous endophilin A2 transfection could regulate ClC-3 subcellular localization, but it is not the case for tyrosine 284 phosphorylation.

One novel finding here is that we had recorded a larger hypotonic-activated outward Cl – current in BASMCs overexpressing endophilin A2 or from endophilin A2 transgenic mice. The properties of the overexpressed or transgenic endophilin A2 Cl – current were generally similar to those of VRACs. Given that we have a well-established association of ClC-3 with أناCl.vol in VSMCs, particularly during the development of hypertension, endophilin A2 may be reasonably interpreted as a new ClC-3 trafficking mechanism for membrane أناCl.vol regulation. The ability of ClC-3 siRNA to significantly reduce the endophilin A2-dependent, hypotonic-activated outward Cl – current strengthened this notion in VSMCs. Currently, accumulating evidence has demonstrated that ClC-3 serves as one molecular component involved in the activation or regulation of أناCl.vol in VSMCs and some other cell types. 16

As an essential component for outward Cl – current or [Cl – ]أنا in VSMCs, ClC-3 has been well established to play a critical role in vascular inflammatory and proliferative diseases. Our present findings in VSMCs thus provide a potential mechanism for ClC-3 to function as a cell membrane Cl – channel. Another important factor is that different cells exhibit different subcellular distributions of ClC-3, even in resting states, which may be one reasonable explanation for the existence of cell type-specific interdependence of ClC-3 and أناCl.vol. In addition, we previously demonstrated that inhibition of ClC-3 expression and أناCl.vol contributes to the beneficial effects of simvastatin, which is clinically used for the prevention of a secondary stroke, on BASMC proliferation and vascular remodeling during 2k2c hypertension. 11 Based on the observation that endophilin A2 expression and the surface membrane ClC-3 accumulation in BASMCs were gradually upregulated during the development of hypertension, the present findings suggest that endophilin A2-mediated ClC-3 trafficking may represent an attractive target for pharmacological or therapeutic interventions in vascular remodeling induced by hypertension.

In conclusion, the present study identified the SH3 domain of endophilin A2 as a ClC-3 channel partner, which serves as a new ClC-3 trafficking mechanism regulating أناCl.vol in VSMCs. Endophilin A2 may be therefore involved in the development of cardiovascular diseases related to altered ClC-3 signaling (ie, hypertensive cerebrovascular remodeling). In addition, our data provides insight for new investigations of endophilin A2 in physiological and pathological functions of the vascular system.

Y.-Y.G. conceived the study, G.-L.W. wrote the paper, C.-Z.L. designed, performed and analyzed the experimental data. E.-W.H. contributed to the plasmids construction, X.-Y.L., R.-H.D., and M.G. performed live cell imaging. H.-S.S. modified the manuscript. M.-M.M. and F-.Y.L. provided technical assistance. All authors reviewed the results and approved the final version of the manuscript.

This work was supported by the National Natural Science Foundation of China (Key grants No.81230082 and No.81302771, 81302771, 81370897) and the CHINA-CANADA Joint Health Research Initiative Proposal (No. 81361128011).

The authors wish to thank Dr Robert M.K.W. Lee from McMaster University, Canada, for his kind assistance with improving the manuscript.

الشكل S1. Expression profile of the endophilin A subfamily in rat basilar arterial smooth muscle cells (BASMCs) and brain tissue.

الشكل S2. Efficiency of endophilin A2 siRNA knockdown and adenovirus (Ad)-mediated endophilin A2 overexpression.

الشكل S3. Inhibition of a native hypotonic-activated Cl – current in basilar arterial smooth muscle cells (BASMCs) by anti-endophilin A2 antibody intracellular dialysis.

الشكل S4. Large hypotonic-activated Cl – current induced by adenovirus-mediated endophilin A2 overexpression is ClC-3 dependent.

الشكل S5. Endophilin A2 in transgenic mice had no effect on body weight and systolic blood pressure compare to its littermate control.

الشكل S6. The SH3 domain participated in ClC-3 trafficking from the cytoplasm to the cell surface in A10 cells.


A2. Facilitated Diffusion - Biology

الملخص

Small molecule drugs target many core metabolic enzymes in humans and pathogens, often mimicking endogenous ligands. The effects may be therapeutic or toxic, but are frequently unexpected. A large-scale mapping of the intersection between drugs and metabolism is needed to better guide drug discovery. To map the intersection between drugs and metabolism, we have grouped drugs and metabolites by their associated targets and enzymes using ligand-based set signatures created to quantify their degree of similarity in chemical space. The results reveal the chemical space that has been explored for metabolic targets, where successful drugs have been found, and what novel territory remains. To aid other researchers in their drug discovery efforts, we have created an online resource of interactive maps linking drugs to metabolism. These maps predict the “effect space” comprising likely target enzymes for each of the 246 MDDR drug classes in humans. The online resource also provides species-specific interactive drug-metabolism maps for each of the 385 model organisms and pathogens in the BioCyc database collection. Chemical similarity links between drugs and metabolites predict potential toxicity, suggest routes of metabolism, and reveal drug polypharmacology. The metabolic maps enable interactive navigation of the vast biological data on potential metabolic drug targets and the drug chemistry currently available to prosecute those targets. Thus, this work provides a large-scale approach to ligand-based prediction of drug action in small molecule metabolism

To submit an update or takedown request for this paper, please submit an Update/Correction/Removal Request.


Hydrolysis of Micellar Phosphatidylcholine Accelerates Cholesterol Absorption in Rats and Caco-2 Cells

Lymphatic recovery of cholesterol infused into the duodenum as bile salt micelles containing phosphatidylcholine (PC) was accelerated by the co-administration of phospholipase A2 in bile and pancreatic juice diverted rats. Previously we observed that cholesterol esterase, which has the ability to hydrolyze PC, caused the same effect under a similar experimental condition (Ikeda et al., Biochim. Biophys. Acta, 1571, 34–44 (2002)). Accelerated cholesterol absorption was also observed when a part of micellar PC was replaced by lysophosphatidylcholine (LysoPC) and oleic acid. Phospholipase A2 facilitated the incorporation of micellar cholesterol into Caco-2 cells in a dose-dependent manner. There was a highly negative correlation between the incorporation of cholesterol into Caco-2 cells and the content of micellar PC remaining in the culture medium. The release of cholesterol as a monomer from bile salt micelles was enhanced when a part of micellar PC was replaced with LysoPC and oleic acid. These results strongly suggest that the release of monomer cholesterol from bile salt micelles is accelerated by hydrolysis of PC in bile salt micelles and hence that cholesterol absorption is enhanced.


شاهد الفيديو: آلية حدوث الانتشار الميسر - علم البيولوجيا و الخلية (كانون الثاني 2022).