معلومة

التنظيم في النباتات التي تحمل أزهار كليستوجاموس وزهور تشاسموج


في معظم النباتات التي تحمل أزهارًا من cleistogamous ، تتحمل النباتات أيضًا أزهار التشاسموج. على سبيل المثال ، تحتوي فيولا وأوكساليس وكوميلينا على هذين النوعين من الزهور.

تساعد أزهار Cleistogamous في التكاثر بأقل قدر من الطاقة والموارد. كما أنه يزيد من فرص التكاثر ، وهو عامل مهم حيث تندر عوامل التلقيح. من ناحية أخرى ، توفر أزهار Chasmogamous التنوع والحيوية الهجينة وتنتج أنماطًا وراثية أفضل من خلال إعادة التركيب. كلتا الاستراتيجيتين مفيدتان في بيئة مختلفة. في الحالات المعاكسة (أقل الملقحات ، إجهاد الطاقة) سيكون الزواج الجماعي مواتياً ، وفي الحالات الأخرى التي لا يسود فيها إجهاد الطاقة ، يكون الزواج الزيجاني مفيدًا.

سؤالي هو، كيف يمكن للنباتات ، إذا استطاعت ، تنظيم الإستراتيجية المدعومة؟ هل نسبة أزهار كليستوجاموس إلى أزهار تشاسموجاميوس ثابتة بغض النظر عن البيئة ، أم أن البيئة السائدة لها رأي في تحديد أي من هذين النوعين من الزهور سيتم تفضيله على الآخر؟ إذا كان الأمر كذلك ، فما هي الآلية التنظيمية الكامنة وراء هذه السيطرة على الشركات الناشئة المزدهرة؟

أحد الأسئلة الأخرى ذات الصلة هو هل هناك أنواع لا تحمل سوى أزهار كليستوجاميوس؟ قد يبدو هذا غير موات للغاية للتطور للعمل على أساسه.


هذا سؤال جيد للغاية ، لكنني أعتقد أن سبب عدم الإجابة عليه هو أنه بمعنى واسع جدًا: تحافظ المجموعات النباتية المختلفة على توازنات من أزهار تزاوج وزهور متباعدة ، وتقوم بتعديل هذا التوازن من خلال آليات مختلفة. العديد من هذه الآليات (الجينات المعنية ، الإشارات البيئية ، المسارات التنموية) قد لا تكون مفهومة بالكامل.

يصنف Culley and Klooster (2007) cleistogamy اعتمادًا على درجة "البيئة السائدة لها رأي":

  • في ثنائي الشكل تختلف زهرة CL و CH في وقت أو مكان الإنتاج ، حيث يتم إنتاج أزهار CL في ظروف (تحت الأرض ، مستويات إضاءة منخفضة ، في وقت مبكر من الموسم) والتي من المحتمل أن تكون غير مواتية للتهجين.
  • في المستحث cleistogamy يحتمل أن تكون أزهار CH التي تعاني من ظروف مثل الجفاف أو درجات الحرارة المنخفضة تفشل في الفتح والتلقيح الذاتي ، لتصبح في الواقع أزهار CL.

يجب عليك التحقق من Culley و Klooster (متاحان عبر الإنترنت إذا قمت بتسجيل الدخول إلى jstor) - يناقشان كليستوجامي الذي يعالج سؤالك الأخير. قاموا بالإبلاغ عن العديد من أنواع CL بالكامل في جدولهم 1 ، وقدموا مراجع.

بشكل عام ، تحافظ العديد من المجموعات النباتية المختلفة على توازنات التلقيح الذاتي والتهجين (أي "الجنس الحقيقي") ، من خلال مجموعة أكثر تنوعًا من الآليات.

بشكل أكثر عمومية ، تحافظ العديد من النباتات وبعض الحيوانات على توازنات التكاثر الجنسي والتكاثر النسيلي ، من خلال التساوي أكثر مجموعة متنوعة من الآليات. على سبيل المثال ، التكاثر الخضري (على سبيل المثال ، الفراولة الجارية) شائع جدًا في العديد من مجموعات النباتات ؛ يحدث التوالد العذري الاختياري والإلزامي في الحيوانات أيضًا.


كولي ، تيريزا إم وماثيو آر كلوستر (2007). نظام تربية كليستوجاموس: مراجعة لتواترها وتطورها وبيئتها في كاسيات البذور. مراجعة نباتية. المجلد. 73 ، رقم 1 ، ص 1-30


يوفر جينوم Cleistogenes Songorica مخططًا للتشريح الوظيفي لتمايز الأزهار ثنائية الشكل والقدرة على التكيف مع الجفاف

Cleistogenes Songorica (2n = 4x = 40) هو عشب صحراوي بآلية ازدهار ثنائية الشكل فريدة وقدرة على النجاة من الجفاف الشديد. لا يُعرف سوى القليل عن العوامل الوراثية الكامنة وراء تحمل الجفاف وقدرته على التكيف الإنجابي. هنا ، قمنا بترتيب وتجميع جينوم سونجوريكا عالي الجودة على مستوى الكروموسوم (contig N50 = 21.28 ميجا بايت). تم اشتقاق مجموعات كاملة من التيلوميرات وعشرة كروموسومات. سونجوريكا خضع مؤخرا ل tetraploidization (

قبل 19 مليون سنة) وأربع عمليات إعادة ترتيب رئيسية للكروموسومات. تم إثراء الجينات الموسعة بشكل كبير في استطالة الأحماض الدهنية ، والتخليق الحيوي للفينيل بروبانويد ، وأيض النشا والسكروز ، ومسارات إيقاع الساعة البيولوجية. من خلال التحليل النسبي المقارن وجدنا أن الجينات المحفوظة ذات الصلة بتحمل الجفاف قد تم توسيعها. ارتبط نسخ جينات CsMYB بالتطور التفاضلي لأزهار تشاسموجاموس وزهور كليستوجاموس ، فضلاً عن تحمل الجفاف. علاوة على ذلك ، وجدنا أن وحدات التنظيم التي تشمل ميرنا وعوامل النسخ والجينات المستهدفة متورطة في تطور الأزهار ثنائية الشكل ، والتي تم التحقق من صحتها من خلال الإفراط في التعبير عن CsAP2_9 و miR172 المستهدف في الأرز. تتيح النتائج التي توصلنا إليها مزيدًا من الفهم لآليات تحمل الجفاف والازدهار في C.

الكلمات الدالة: Cleistogenes Songorica allotetraploid cleistogamy ثنائي الشكل زهرة تحمل الجفاف تجميع الجينوم.

© 2020 المؤلفون. مجلة التكنولوجيا الحيوية النباتية الصادرة عن جمعية البيولوجيا التجريبية وجمعية علماء الأحياء التطبيقية وشركة John Wiley & Sons Ltd.


تحليل الجينوم على نطاق واسع لدور عائلة NAC في نمو الزهور واستجابات الإجهاد اللاأحيائي في كليستوجين سونجوريكا

NAC الخاصة بالنبات (NAM, ATAF, CUC) تلعب عائلة عامل النسخ (TF) أدوارًا مهمة في العمليات البيولوجية مثل نمو النبات والاستجابة للإجهاد. ومع ذلك ، لا توجد معلومات معروفة عن NAC TFs في كليستوجين سونجوريكا، عشب صحراوي جاف بارز في شمال غرب الصين. في هذه الدراسة ، 162 NAC تم العثور على الجينات من كليستوجين سونجوريكا الجينوم ، من بينها 156 C. SongoricaNAC (CsNAC) تم تعيين الجينات (96.3٪) على 20 كروموسوم. يمكن فصل شجرة النشوء والتطور التي أنشأتها CsNAC والأرز NAC TFs إلى 14 عائلة فرعية. أظهرت تحليلات Syntenic و Ka / Ks ذلك CsNACs تم توسيعها في المقام الأول من خلال أحداث النسخ المتماثل على مستوى الجينوم ، وكان اختيار التنقية هو القوة الأساسية الدافعة لتطور CsNAC جينات الأسرة. ال CsNAC أظهرت ملامح التعبير الجيني أن 36 CsNAC أظهرت الجينات تعبيرًا تفاضليًا بين أزهار cleistogamous (CL) وزهور chasmogamous (CH). مئة و إثنين CsNAC أظهرت الجينات تعبيرًا تفاضليًا تحت العلاج بالحرارة والبرودة والجفاف والملح و ABA. ثلاث و عشرون CsNAC تم التعبير عن الجينات بشكل تفاضلي بشكل عام في ظل استجابات الإجهاد وأثناء تطور الزهيرات ثنائية الشكل. كشفت التعليقات التوضيحية في علم الجينات (GO) وشبكة التعايش واختبارات qRT-PCR أن هذه الاختبارات CsNAC قد تنظم الجينات في نفس الوقت تطور الأزهار ثنائية الشكل والاستجابة للإجهاد. قد تساعد نتائجنا في توصيف عوامل نسخ NAC في C. Songorica وتقديم رؤى جديدة حول البحث والتطبيق الوظيفي لعائلة NAC في تحسين المحاصيل ، لا سيما في نباتات الأزهار ثنائية الشكل.

الكلمات الدالة: Cleistogenes Songorica NAC الإجهاد اللاأحيائي cleistogamous الجينوم على نطاق واسع.

بيان تضارب المصالح

الكتاب تعلن أي تضارب في المصالح.

الأرقام

شجرة النشوء والتطور لنسخ NAC ...

شجرة النشوء والتطور لعوامل النسخ NAC (TFs) في C. Songorica والأرز. ال…

تمثيلات تخطيطية للعلاقات التركيبية ...

تمثيلات تخطيطية للعلاقات التركيبية لـ NAC بين الأعضاء C. Songorica والأرز ...

توزيعات قيمة Ks و Ka / Ks ...

توزيعات قيمة Ks و Ka / Ks لأعضاء NAC في C. Songorica و ...

العلاقات النشوء والتطور والبنية الجينية و ...

العلاقات التطورية ، بنية الجينات وتوزيعات المجال المحفوظة المفترضة لعائلة CsNAC. ...

توزيع NAC مكرر ...

توزيع NAC الجينات المكررة في C. Songorica. الخطوط الملونة داخل ...

موقع الكروموسومات سونجوريكا ...

موقع الكروموسومات C. Songorica NAC الجينات. عدد الكروموسوم فوق كل ...

ملفات تعريف التعبير وشبكة التعابير ...

ملفات تعريف التعبير وشبكة coexpression من CsNAC TFs أثناء تطوير الأزهار ثنائية الشكل. (...

ملفات تعريف التعبير وشبكة التعابير ...

ملفات تعريف التعبير وتحليل شبكة التعايش للإجهاد اللاأحيائي المرتبط CsNAC الجينات. ( أ…

تعبير المختار CsNAC ...

التعبير المختار CsNAC الجينات تحت الضغط اللاأحيائي في البراعم بواسطة qRT-PCR ...


مقدمة

الجنس فيولا (البنفسج) موزعة في كل من المناطق المعتدلة الشمالية والجنوبية وكذلك المناطق المدارية وتمتلك تنوعًا عاليًا مع 580 & # x2013620 نوعًا ، وتعدد الصبغيات الشامل ، وتاريخ تطوري خلوي متميز (Ballard et al. ، 1998 Marcussen et al. ، 2012 ، 2015 Wahlert et al.، 2014). فيولا هي أكبر جنس في Violaceae ، وهي عائلة تتمتع بعلاقات وثيقة إلى حد ما مع عائلة زهرة الآلام (Passifloraceae) وعائلات الصفصاف (Salicaceae) في ترتيب Malpighiales (Savolainen et al. ، 2000 Tokuoka and Hiroshi ، 2006). اعضاء في فيولا تُظهر التهجين المتكرر وأشكال النمو المتنوعة والتلقيح المتنوع واستراتيجيات تشتت البذور وأنظمة التربية المتنوعة (Beattie، 1969، 1971 Beattie and Lyons، 1975 Ballard et al.، 2011، 2014). كانت البنفسج هي رابع أكثر مجموعات نباتات الفراش شيوعًا (الزهريات) ، من خلال المبيعات ، في الولايات المتحدة وخارجها (Altland et al. ، 2003) وتظهر إمكانية المعالجة الحيوية (Hermann et al. ، 2013) وتطوير مركبات جديدة لـ الاستخدام البشري (Craik et al. ، 1999). فيولا pubescens (الشكل 1) معمر فيولا عشب شائع في الجزء السفلي من الغابات ميسيك في شرق أمريكا الشمالية. عظم فيولا الأنواع ، بما في ذلك V. pubescens، تمتلك نظام تربية مختلطًا ناجحًا من الناحية التطورية ولكنه غير معهود وراثيًا لكل من أزهار Chasmogamous و cleistogamous. في حين أن أزهار cleistogamous تشبه البراعم في المظهر (الشكل 1 أ) ومختومة ميكانيكيًا طوال دورة حياتها بالكامل ، مما يؤدي إلى الزواج الذاتي القسري ، تفتح أزهار التشاسموجاموس عند النضج ، وتكشف أجزاء الأزهار الداخلية (الشكل 1 ب). تتميز أزهار تشاسموجاموس الملقحة عبر التلقيح بميزة التكاثر الجنسي بين أبوين مختلفين يقدمان ذرية متنوعة وراثيًا ، ويقلل من اكتئاب الأقارب ، ويزيل الأليلات الضارة من السكان (بالارد وآخرون ، 2011). ومع ذلك ، فإن إخصاب أزهار الفاسقة يتوقف على توافر عوامل التلقيح ، ويتطلب رحيقها وأعضائها الزهرية المبهرجة كميات كبيرة من الطاقة والموارد. إن الأعضاء الزهرية الدقيقة ونقص الرحيق في أزهار cleistogamous تجعل إنتاجها أقل تكلفة ولديها المزيد من الموارد لإنتاج البذور بما في ذلك الزيادات في عدد البذور الإجمالي و / أو البذور الأكبر ذات الجدوى العالية (Culley and Klooster ، 2007). أجرى Culley and Klooster (2007) مسحًا للتحقيق في حدوث نظام التكاثر المختلط Chasmogamous / cleistogamous ، حيث أبلغا عن إجمالي 536 نوعًا تشمل 41 عائلة نباتية متنوعة ، حيث تم الإبلاغ عن معظم الحالات في Poaceae (الأعشاب) ، Fabaceae (البقوليات) ، Violaceae (البنفسج) ، والأوركيدا (الأوركيد). بالارد وآخرون. قدم (2011) مراجعة شاملة للأدبيات حول نظام التربية المختلط هذا وسلط الضوء على نقص المعلومات حول الأساس الجيني للنظام. ومع ذلك ، فإن التوزيع الواسع لنظام التكاثر المختلط Chasmogamous / cleistogamous بين عائلات monocot و dicot بالإضافة إلى نطاقه الجغرافي الواسع ، يشير إلى أن نظام التكاثر قد تطور عدة مرات من خلال كاسيات البذور (Ballard et al. ، 2011). يشير هذا التوزيع الواسع أيضًا إلى أن نظام التربية المختلطة ليس استراتيجية تزاوج تحدث بشكل عشوائي ويمكن اختياره بنشاط.

شكل 1. فيولا pubescens فار. تحمل الجرب (أ) cleistogamous و (ب) أزهار تشاسموجاموس. تم التقاط الصور الفوتوغرافية للسكان الأصليين الموجودين في سيلز بارك ، مقاطعة أثينا ، أوهايو ، 45701 (39 & # x00B020 & # x203240.6 & # x2032 & # x2032N 82 & # x00B004 & # x203231.9 & # x2032 & # x2032W).

بالإضافة إلى وجود أنظمة تربية مختلطة مفيدة من الناحية التطورية ، فإن أعضاء Violaceae ينتجون أيضًا السيكلوتيدات. تمثل السيكلوتيدات أكبر عائلة بروتينية دائرية وقد تم تصنيفها كبروتينات دفاعية للنبات بناءً على خصائص مبيدات الحشرات (جينينغز وآخرون ، 2001) ومضادات الميكروبات (تام وآخرون ، 1999) ولكن لها أيضًا خصائص تم تحديدها على أنها مضادة لفيروس نقص المناعة البشرية (جوستافسون وآخرون. ، 1994) ، مضاد للسرطان (Guzm & # x00E1n-Rodr & # x00EDguez et al. ، 2015) ، الانحلالي (Tam et al. ، 1999) ، سام للخلايا (Lindholm et al. ، 2002 Herrmann et al. ، 2008) ، مثبطات التربسين (Trabi and Craik ، 2002) ومقوي توتر الرحم (Gran ، 1973) من بين أمور أخرى (Zhang et al. ، 2009). تتميز السيكلوتيدات بعقد عقدة السيستين الحلقية (CCK) المكونة من ستة مخلفات خزينة محفوظة تشكل شبكة ضيقة من روابط ثاني كبريتيد. هذا الهيكل المستقر يجعل السيكلوتيدات مقاومة لتحلل البروتينات والمرشحات القوية لسقالات تصميم الأدوية وتطبيقات الكيماويات الزراعية (Craik et al. ، 1999 Gruber et al. ، 2008). مع زيادة توافر البيانات الجينومية ، في السيليكو سهلت الطرق اكتشاف العديد من متواليات السيكلوتيد الجديدة. توجد غالبية السيكلوتيدات التي تم اكتشافها مؤخرًا في Violaceae ، والتي يُعتقد أنها تحتوي على ما يزيد عن 30000 سيكلوتيد فريد (Zhang et al. ، 2015). في حين أن نسبة صغيرة فقط من الأنواع في العائلات المنتجة للسيكلوتيد كانت إيجابية لوجود السيكلوتيد ، يبدو أن تعبير السيكلوتيد موجود في كل مكان في Violaceae ، وقد تم تحديد السيكلوتيدات في جميع الأنواع التي تم فحصها (Burman et al.، 2015 G & # x00F6ransson et al. ، 2015 Ravipati et al. ، 2017). بينما تسعة فيولا تم تسلسل النسخ حتى الآن (الجدول التكميلي S1) ، لا فيولا تم تجميع الجينوم (ماتاسكي وآخرون ، 2014). المسودة V. pubescens يملأ الجينوم هذه الفجوة في البيانات الجينومية ويوفر موردًا فريدًا للتسلسل وبيانات التعبير الجيني. هنا نقدم من جديد التجميع والتعليق التوضيحي لـ V. pubescens مشروع الجينوم واستخدامه للتحقيق في التعبير الجيني الخاص بالأنسجة وتنوع السيكلوتيد في V. pubescens. توفر هذه التحليلات نظرة ثاقبة للتباينات الجينية بين أزهار تشاسموجاموس وزهور كليستوجاموس وحددت 81 تسلسل سيكلوتيد.


أساليب

المواد النباتية

Cardamine kokaiensis Yahara (Brassicaceae) هو عشب سنوي ينمو بالقرب من نهر كوكاي ، محافظة إيباراكي ، اليابان (36 ° 1′58 ″ شمالًا ، 140 ° 0′27 شرقًا). تم اكتشاف هذا النبات من قبل T. Yahara (جامعة كيوشو ، اليابان) وسيتم وصفه تحت اسم هذا النوع في مكان آخر (Yahara ، اتصال شخصي). يزداد منسوب مياه نهر كوكاي من الخريف إلى أوائل الشتاء وينخفض ​​من منتصف الشتاء إلى الربيع. وهكذا ، تنقع البذور في الماء وتبدأ في الإنبات عندما ينخفض ​​مستوى الماء. الأفراد الذين ينبتون مبكرًا (أي في يناير وفبراير) لديهم فترات نقع قصيرة وفترات نمو طويلة ، ويصبحون نباتات أكبر ، وينتجون أزهار CL و CH. الأفراد الذين ينبتون في وقت لاحق (أي في مارس وأبريل) لديهم فترات نقع طويلة وفترات نمو قصيرة ، ويصبحون نباتات أصغر ، وينتجون أزهار CL فقط. من المحتمل أن يتم فصل البذور عن طريق النقع. تحتوي أزهار CH على أربع كؤوس ، وأربع بتلات ، واثنين من الأسدية الجانبية ، وأربعة أسدية وسطية ، ومدقة واحدة (الشكل S1 في المواد التكميلية). الأسدية الجانبية أقصر من الأسدية الإنسي. هذه الزهور التي تشبه من الناحية الشكلية A. thaliana الزهور ، لديها القدرة على التلقيح الذاتي والتلقيح الخارجي. في المقابل ، تفتقر أزهار CL إلى البتلات والأسدية الجانبية (الشكل التكميلي S1) وهي إلزامية ذاتية التلقيح.

في أبريل 2003 ، C. kokaiensis تم جمع النباتات من نهر كوكاي. بعد أن تم التلقيح الذاتي للنباتات وزراعتها لمدة أربعة أجيال ، تم استخدام البذور المنحدرة في التجارب. كانت البذور ذاتية التلقيح من أزهار CH و CL خصبة (Morinaga وآخرون. unpubl. البيانات).

تجارب تقشعر لها الأبدان

نظرًا لأن cleistogamy غالبًا ما يرتبط بحجم النبات ، فقد ركزنا على الظروف البيئية التي تؤثر على التغيرات في حجم النبات. فليكسوسا الكارامين هو نوع وثيق الصلة بـ C. kokaiensis. حجم C. فليكسوسا تتأثر النباتات بمعاملات التبريد المختلفة ، والتي فُسرت على أنها تأثير التبديد (Kudoh وآخرون. 1995 , 1996 ).

لذلك ، أجرينا علاجات تقشعر لها الأبدان لفحص الاستجابات المظهرية لصفات الأزهار وحجم النبات C. kokaiensis تحت سبع ظروف للنمو: علاجات التبريد بعد الإنبات لمدة 14 أو 28 أو 56 يومًا (0–14 و0–28 و0–56 علاجًا ، على التوالي) ، وعلاجات التبريد قبل الإنبات لمدة 14 أو 28 أو 56 يومًا (14– 0 ، 28-0 ، و 56-0 ، على التوالي) ، ولا تقشعر لها الأبدان (0-0 تحكم).

تمت زراعة النباتات في غرفة نمو عند 22 درجة مئوية تحت ضوء 16 ساعة و 8 ساعات ظلام. تم إجراء التبريد عند 4 درجات مئوية تحت ظلام دامس 24 ساعة. تم استخدام خمسة نباتات نبتت من بذور أحادية التلقيح ذاتيًا لمدة أربعة أجيال لكل تجربة. زرعت البذور في وسط يحتوي على 0.46٪ من خليط ملح نبات موراشيج وسكووج (واكو بيور للصناعات الكيماوية ، أوساكا ، اليابان) ، 0.1٪ محلول فيتامين جامبورج 1000 × (سيجما الدريتش ، سانت لويس ، ميسوري ، الولايات المتحدة الأمريكية) ، 1٪ سكروز ، و 0.8٪ أجار. تم زرع كل شتلة في وعاء سعة 125 مل يحتوي على خليط 2: 1 من الفيرميكيولايت والبيرلايت. تم ري النباتات وتخصيبها (HYPONeX، Hyponex، Marysville، OH، USA) كل 3-4 أيام.

تم أخذ عينات من الزهرة الأولى والخامسة عشرة من أول نورة مزهرة لكل نبات. تم جمع عينة واحدة من السداة ، البتلة ، السداة الجانبية ، السداة الإنسي ، والمدقة بشكل عشوائي من كل زهرة ، وتم قياس طولها إلى أقرب 0.1 مم تحت مجهر مجسم. تم تسجيل عدد أيام التزهير بدون معاملة التبريد. تم قياس الوزن الجاف لكل نبات إلى أقرب 1 مجم بعد التجفيف في فرن عند 60 درجة مئوية لمدة 72 ساعة عندما فتحت الزهرة الخامسة عشرة. قمنا بفحص الاختلافات في طول الأعضاء الزهرية ، وأيام الإزهار ، والكتلة الجافة للنبات بين العلاجات باستخدام تحليل التباين أحادي الاتجاه (anova) و آخر مخصص اختبار Tukey. أجريت هذه التحليلات الإحصائية باستخدام عرض الإحصاء 5.0 (SAS Institute Inc. ، كاري ، نورث كارولاينا ، الولايات المتحدة الأمريكية).

تهجين الحمض النووي الجيني واختيار المسبار

استخدمنا استراتيجية اختيار مسبار تستند إلى الحمض النووي الجيني (gDNA) (Hammond وآخرون. 2005) للتحقق من جودة المصفوفة الدقيقة عبر الأنواع. Cardamine kokaiensis تم تهجين gDNA إلى GeneChip A. thaliana مجموعة ATH1 (Affymetrix ، سانتا كلارا ، كاليفورنيا ، الولايات المتحدة الأمريكية) ، حيث تم فحص 22810 مجموعة مسبار وتم تخصيص ما لا يقل عن 11 زوجًا من المسبار (أي تحقيقات المطابقة الكاملة وعدم التطابق) لكل مجموعة مسبار. تم اختيار أزواج المسبار لتحليل التعبير الجيني بناءً على C. kokaiensis تتراوح عتبات شدة تهجين gDNA من 0 (بدون اختيار مسبار) إلى 300 وفقًا لهاموند وآخرون. (2005) (الملحق التكميلي S1). في استراتيجية الاختيار الأمثل الناتجة لتحليل التعبير الجيني C. kokaiensis، استخدمنا عتبات شدة تهجين gDNA البالغة 50 و 75 و 100 (الملحق التكميلي S1).

عبر تجارب ميكروأري الأنواع

لقد درسنا أنماط التعبير الجيني بين أزهار CH ، والمتوسطة (INT) ، و CL. تم إجراء ثلاث معالجات تبريد عند 4 درجات مئوية في الظلام: قبل الإنبات لمدة 14 يومًا أو بعد الإنبات لمدة 14 أو 28 يومًا (14 - 0 ، 0 - 14 ، و0 - 28 معاملة ، على التوالي). أنتجت الأزهار الأولى من 14–0 ، 0–14 ، و0–28 نباتًا ، أزهار CH و INT و CL على التوالي. أجرينا مكررين بيولوجيين لكل علاج. تم تكرار المضاعفات البيولوجية تقنيًا مرة واحدة لكل علاج. لكل تكرار ، تم استخراج الحمض النووي الريبي من 160 نباتًا نبتت من بذور سليلة واحدة تم تلقيحها ذاتيًا لمدة أربعة أجيال. تم جمع أول نورة بزهرة برايم من كل نبات عندما كان أول برعم زهرة مرئيًا. وضعنا 160 زهرة من 160 نبتة في نفس الأنبوب الدقيق. تم استخراج إجمالي الحمض النووي الريبي من ست عينات (أي مكررين بيولوجيين لثلاثة معالجات) باستخدام Isogen (Nippon Gene ، طوكيو ، اليابان). تم فحص جودة وكمية إجمالي RNA باستخدام RNA Nano Labchip و 2100 Bioanalyzer (Agilent Technologies ، Palo Alto ، CA ، USA).

تم إجراء تخليق cDNA مزدوج الشريط ، وتوليف الحمض النووي الريبي ، ووضع العلامات ، والتهجين ، والمسح الضوئي لمصفوفات Affymetrix ATH1 وفقًا لتعليمات الشركة الصانعة وعلى الرابط التالي: //www.affymetrix.com/support/technical/manual/expression_manual.affx>. تم إنشاء ملفات CEL (CL1 و CL2 و INT1 و INT2 و CH1 و CH2.cel ، رقم الانضمام GSE9799 في GEO) باستخدام مجموعة تحليل ميكروأري. تم إجراء هذه التجربة في يومين مختلفين: تم إنشاء CL1 و CH1.cel في 26 نوفمبر 2004 وتم إنشاء الآخرين في 22 مارس 2005. تم تحميل ملفات CEL في حزمة برمجيات تحليل GeneSpring (Agilent Technologies ، الولايات المتحدة الأمريكية) باستخدام حزمة قوية متعددة الرقائق متوسط ​​خوارزمية ما قبل التطبيع (RMA) (Irizarry وآخرون. 2003). أثناء تحميل ملف CEL ، وحساب شدة كل مجموعة مسبار ، والتطبيع المسبق ، تم تفسير ملفات CEL باستخدام ملفات البيانات التي تم إنشاؤها من عتبات كثافة تهجين gDNA البالغة 50 و 75 و 100 والتي كانت تعتبر نطاقًا مثاليًا لاختيار المسبار لـ تحليل التعبير الجيني على أساس تجربة تهجين جدنا (الملحق S1). لقد أجرينا تطبيعًا لكل شريحة ، أي أن شدة كل مجموعة مسبار تم تقسيمها على متوسط ​​كثافة جميع الجينات في المصفوفة. تم تحليل الجينات ذات شدة الإشارة المختلفة بين أزهار CL و CH باستخدام anova أحادي الاتجاه وتغيير الطي باستخدام GeneSpring. علاوة على ذلك ، عند اختيار القيم العالية والمنخفضة للجينات المعبر عنها تفاضليًا في أزهار CL و CH ، استخدمنا تغيير الطيات الصارم للنظر في تأثيرات يوم التجربة (26 نوفمبر 2004 و 22 مارس 2005) في شدة الإشارة. تم اعتبار تغيير الطية الصارم أقل قيمة لأي من النسبة التي تم الحصول عليها من كلا اليومين.

تفاعل البوليميراز المتسلسل للنسخ العكسي شبه الكمي (RT-PCR)

تم أيضًا استخدام (كدنا) مزدوج الشريطة الذي تم إجراؤه في تجارب ميكروأري عبر الأنواع من أجل RT-PCR شبه الكمي للتحقق من صحة نتائج ميكروأري. تم تصميم الاشعال لـ RT-PCR لـ 13 جينًا بشكل تفاضلي وليس معبرًا تفاضليًا بناءً على مناطق exon التي تم حفظها جيدًا بين A. thaliana وغيرها من الكائنات الحية التي تستخدم Primer 3 & lth تم تأكيد هويات منتجات PCR المضخمة لسبعة جينات عن طريق التسلسل باستخدام متسلسل ABI Prism 3130xl (Applied Biosystems ، Foster City ، CA ، USA). Cardamine kokaiensis أخصائيو تقويم العظام A. thaliana DRM1, مستوى ضغط الصوت 5, AT4G29190 ، HSP81-4, NMT1, RD21، و الأكتين 2 تم تضخيم الجينات بواسطة مجموعات التمهيدي (الجدول 1). تم تنفيذ كل RT-PCR شبه كمي باستخدام نظام GeneAmp PCR 9700 (النظم البيولوجية التطبيقية) و EX طق HS (TaKaRa ، Shiga ، اليابان) بحجم إجمالي 25 ميكرولتر يحتوي على 40 نانوغرام من مزدوج حبلا (كدنا). يتألف برنامج PCR من دورة واحدة عند 94 درجة مئوية لمدة 5 دقائق تليها 27 (الأكتين 2 جين تقويم العظام) أو 29 (جينات أخرى) دورة 94 درجة مئوية لمدة 30 ثانية ، و 55 درجة مئوية لمدة 30 ثانية ، و 72 درجة مئوية لمدة 30 ثانية. لم تكن منتجات PCR مشبعة في ظل هذه الظروف. تم فصل منتجات تفاعل البوليميراز المتسلسل بالكهرباء في هلام الاغاروز بنسبة 1٪ واكتشافها بواسطة تلطيخ بروميد الإيثيديوم. تم إجراء تحليلات لشدة التعبير باستخدام Gel Analyzer في ImageJ & lthttp: //rsb.info.nih.gov/ij/>. تم حساب التعبير الجيني النسبي على النحو التالي:

الجينات المتعامدة التمهيدي إلى الأمام عكس التمهيدي
DRM1 أكجاكتككاجاتكجتجا CCGAACAGTAGAATTATTATTACAAGA
مستوى ضغط الصوت 5 CACAATGAAAGGAGGAGGAAG كاتاجتكتتتاكاتتجكجاتا
AT4G29190 جكجتتكاجكتكتكجاتتك ججتاكججتكجاتتات
HSP81-4 كتججتتجتكاجتا ككتككتتجتجكاجاجاك
NMT1 كاتجتكاتكجكاتكاتجت كتكككجتكاكجاتكتجتت
RD21 أجكاتككجكتجاتكتجاكت تجغاتاجااكججتكا
الأكتين 2 تجتجتاجكاجاكاكاتك GGCATGAGGAAGAGAAACC

التعبير الجيني النسبي (٪) = (التعبير الجيني الموضوعي) / (الأكتين 2 التعبير الجيني لتقويم العظام). تم أيضًا حساب التعبير الجيني النسبي في المصفوفة الدقيقة عبر الأنواع على أساس عتبة كثافة تهجين gDNA البالغة 100.


التنظيم في النباتات التي تحمل أزهار كليستوجاموس وزهور تشاسموجاميوس - علم الأحياء

لقد طلبت ترجمة آلية لمحتوى محدد من قواعد البيانات الخاصة بنا. يتم توفير هذه الوظيفة لراحتك فقط ولا يُقصد بها بأي حال من الأحوال أن تحل محل الترجمة البشرية. لا تقدم BioOne ولا مالكو وناشر المحتوى ، وهم يتنصلون صراحةً من مسؤوليتهم ، أي تعهدات أو ضمانات صريحة أو ضمنية من أي نوع ، بما في ذلك ، على سبيل المثال لا الحصر ، الإقرارات والضمانات فيما يتعلق بوظيفة ميزة الترجمة أو دقة أو اكتمال الترجمات.

لا يتم الاحتفاظ بالترجمات في نظامنا. يخضع استخدامك لهذه الميزة والترجمات لجميع قيود الاستخدام الواردة في شروط وأحكام استخدام موقع BioOne.

الدور المحتمل لاثنين من أخصائيي تقويم العظام LEAFY في نظام التكاثر المختلط Chasmogamous / cleistogamous فيولا pubescens (Violaceae) 1

يونجينج وانج 1 هارفي إي بالارد 1 آن إل ستيرنبيرجر 1

1 قسم بيولوجيا البيئة والنبات ، 315 بورتر هول ، جامعة أوهايو ، أثينا ، أوهايو 45701

يتضمن PDF و HTML ، عند توفره

هذه المقالة متاحة فقط لـ مشتركين.
انها ليست متاحة للبيع الفردي.

العديد من النباتات ، بما في ذلك معظم الأنواع في فيولا، وتنتج أزهارًا مفتوحة ، متقاطعة ، متقاطعة ومغلقة ، ذاتية التلقيح. يعتبر نظام التكاثر المختلط Chasmogamous / cleistogamous استراتيجية إنجابية ناجحة تطوريًا ، لكن الأساس الجزيئي الأساسي لا يزال غير معروف إلى حد كبير. ال ورق (LFY) الجين في أرابيدوبسيس هي المسؤولة عن بدء الزهرة الزهرية وتنظيم نمو الزهرة ، لذلك سعينا للتعرف عليها LFY تقويم العظام في فيولا pubescens Aiton بهدف فهم الاختلافات المحتملة في الجينات التنظيمية لتطور الزهرة وعلم الوراثة الجزيئي الكامن وراء أنظمة التكاثر المختلطة المتزاوجة / cleistogamous. مكتبة الجينوم من V. pubescens شيد لتحديد LFY تم استخدام أخصائيو تقويم العظام ، والنسخ العكسي لتفاعل البوليميراز المتسلسل لدراسة التعبير الجيني في كلا نوعي الزهور. بالإضافة إلى ذلك ، أجريت دراسات الإفراط في التعبير لأخصائيي تقويم العظام في أرابيدوبسيس لاستكشاف دورها في نظام تربية فيولا. اثنين LFY أطباء تقويم العظام ، VpLFY1 و VpLFY2 ، من مكتبة الجينوم V. pubescens . تم التعبير عن كلا الجينين في كلا نوعي الزهور ، خاصة في البراعم الزهرية الشابة. ومع ذلك ، فإن الإفراط في التعبير عن VpLFY2 ، لكن لا VpLFY1 ، تسبب في ازدهار مبكر في أرابيدوبسيس، مما يشير إلى دور فريد محتمل لكل طبيب تقويم. النتائج تشير إلى ذلك VpLFY1 و VpLFY2 وظيفة معا في تنمية الزهور V. pubescens . الآثار المختلفة الناجمة عن VpLFY1 و VpLFY2 بوصة أرابيدوبسيس يشير إلى أن أخصائيي التقويم قد يكون لهما خصائص فريدة خاصة بالجينات والتي قد تساهم في نوع الزهرة في البنفسج.


أساليب

المواد النباتية

تم جمع مواد دراسة تسلسل النسخ من مجموعة طبيعية من جبل لاو ، الواقعة بالقرب من بحر الصين الشرقي على الساحل الجنوبي الشرقي لشبه جزيرة شاندونغ في الصين (120 ° 36′10 ″ شرقًا ، 36 ° 06′27 شمالاً. ). تم جمع براعم الزهور CH في 8 أبريل 2014 (متوسط ​​درجة الحرارة الدنيا 8 درجات مئوية ، ومتوسط ​​درجة الحرارة القصوى 15 درجة مئوية ومتوسط ​​هطول الأمطار 36 ملم في أبريل http://qingdao.tianqi.com/laoshan/). تم جمع براعم أزهار CL في 26 مايو 2014 (متوسط ​​درجة الحرارة الدنيا 13 درجة مئوية ، ومتوسط ​​درجة الحرارة القصوى 20 درجة مئوية ومتوسط ​​هطول الأمطار 54 ملم في مايو http://qingdao.tianqi.com/laoshan/). تم جمع كل من النورات ثنائية التفرع كاملة CH و CL حوالي الساعة 9:00 صباحًا -10: 00 صباحًا ، مع كل إزهار يشتمل على 3-5 براعم زهور في مراحل نمو مختلفة. تم تطوير أول برعم زهرة لإزهار ثنائي التفرع (الأقدم) جيدًا مع جميع أعضاء الأزهار التي يبلغ حجمها حوالي 5 مم في برعم زهرة CH و 3 مم في برعم زهرة CL. برعم الزهرة الثاني أصغر من الأول ، أما برعم الزهرة الثالث فهو الأصغر على الإطلاق. في معظم الحالات ، هناك 1-2 براعم زهور بالكاد مرئية تقع في الجزء السفلي من bract. تم جمع براعم الزهور CH و CL طازجة ، وتم تجميدها على الفور في نيتروجين سائل ثم تم نقلها في ثلج جاف إلى ثلاجة حيث تم تخزينها عند -80 درجة مئوية.

التسلسل

تم إنشاء مكتبات أزهار CH و CL من براعم الزهور ، وتتكون كل عينة برعم زهرة من خليط من براعم الزهور من مراحل نمو مختلفة تم الحصول عليها من 50 فردًا من نفس النوع. P. heterophylla تعداد السكان. لكل نوع من الزهور ، تم عزل الحمض النووي الريبي الكلي من براعم الزهور باستخدام كاشف Trizol (Invitrogen) ومعالجته بـ DNaseI (Promega) لإزالة الحمض النووي الملوث المتبقي. تم تحديد جودة وسلامة RNA باستخدام Agilent 2100 Bioanalyzer (Agilent). تم تحضير مكتبتين من مكتبات RNA-seq (مثل أزهار CH وزهور CL) باستخدام Illumina TruSeqRNA Sample Preparation Kit (Illumina) باتباع تعليمات الشركة المصنعة. تم إنشاء مكتبتين (كدنا) (أزهار CH ، أزهار CL) وتسلسلهما باستخدام منصة Illumina HiSeq (Shanghai Personal Biotechnology Co. Ltd ، الصين) لتوليد 100 زوج من القراءات الأولية.

التجميع والشروح الوظيفية

تم الحصول على قراءات نظيفة عن طريق إزالة تسلسل المحول ، والقراءات منخفضة الجودة ، والقراءات الأقصر (أقصر من 50 نقطة أساس). تم استخدام Trinity (http://trinityrnaseq.github.io) لتجميع قراءات الجودة في contigs و transcripts [71]. تم استخدام أداة البحث عن المحاذاة المحلية الأساسية (BLAST) للبحث عن محاذاة التسلسل (القيمة E & lt1.00E-5) بين التسلسلات الفريدة و NCBI غير الزائدة (//www.ncbi.nlm.nih.gov/) و قواعد بيانات Swiss-Prot (http://www.expasy.ch/sprot). تم اختيار النصوص الأكثر نجاحًا على أنها unigenes. تم شرح unigenes مع الفئات الوظيفية بواسطة قاعدة بيانات Gene Ontology (GO ، http://www.geneontology.org) [72] ، قاعدة بيانات المجموعات التقويمية غير الخاضعة للإشراف (eggNOG) (http://eggnog.embl.de/) [73] ، وقاعدة بيانات موسوعة كيوتو للجينات والجينوم (KEGG ، (http://www.genome.jp/kegg/) [74].

تحديد النصوص المعبر عنها تفاضليًا

تم استخدام قراءات لكل كيلو قاعدة من exon لكل مليون قراءة تم تعيينها (RPKM) [75] لتطبيع وفرة النصوص على أساس القضاء على تأثير أطوال الجينات المختلفة وتباينات التسلسل. تم تحديد النصوص المعبر عنها بشكل تفاضلي بين مكتبات الزهور CH و CL باستخدام DEseq [76]. مطلوب DETs بين مكتبتين أن يكون لها قيمة مطلقة للسجل2foldchange (سجلّ2FC) و GT 2 في التعبير ، أ ص- قيمة & lt0.001 و FDR & lt0.05 [77 ، 78].

خضعت DETs لتحليل إثراء GO و KEGG Orthology (KO) على أساس اختبار فرط هندسي (القطع: FDR & lt0.05). تم استخدام قاعدة بيانات KEGG أيضًا للتنبؤ بالمسارات التي شاركت فيها DETs ، وتم تحديد شرح المسار بواسطة مخطط KEGG (http://www.genome.jp/kegg/tool/map_pathway2.html).

تحديد الجينات المشاركة في عمليات الإزهار

ما مجموعه 599أرابيدوبسيس تم الحصول على الجينات المرتبطة بشبكات تنظيم الجينات التي تتحكم في عمليات الإزهار من شروط GO (GO: 0009908 تنمية الزهور ، GO: 0009909 تنظيم تنمية الزهور ، GO: 0048439 مورفوجنيشن الزهرة ، GO: 0048438 تطوير زهرة الزهرة GO: 0048440 تنمية carpel ، GO: 0010093 مواصفات هوية العضو الزهري ، GO: 0048497 صيانة هوية العضو الزهري ، وما إلى ذلك ، http://amigo.geneontology.org/) وكذلك من Srikanth & amp Schmid [22] و Alvarez-Buylla et al. [24]. تم تنزيل تسلسل هذه الجينات من مصدر معلومات Arabidopsis (TAIR ، http://Arabidopsis.org/). استخدمنا ملف أرابيدوبسيس الجينات المشاركة في عمليات الإزهار كتسلسل استعلام للبحث عن جينات متماثلة محتملة بين تسلسل نسخ P. heterophylla بواسطة BLAST المستقل (إصدار 2.2.30+ ، ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/) مع قيمة E & lt1.00E-10. تم اعتبار جميع الزيارات ذات الهويات أعلى من 60٪ جينات متجانسة في P. heterophylla.

التحقق من صحة الجينات الزهرية عن طريق PCR في الوقت الحقيقي الكمي

تم التحقق من صحة 24 نسخة متعلقة بشبكات تنظيم الجينات لعمليات الإزهار المحددة في تحليل تسلسل النسخ وقياسها باستخدام PCR الكمي في الوقت الحقيقي (qRT-PCR). تم تصميم الاشعال باستخدام Primer Premier 5 وفقًا لبيانات تسلسل النسخ (ملف إضافي 4). تم الحصول على إجمالي الحمض النووي الريبي من التكرارات البيولوجية لتلك العينات المستخدمة في تسلسل الحمض النووي الريبي. تم تصنيع (كدنا) العكسي باستخدام PrimeScript Reagent Kit مع ممحاة gDNA (Takara) ، وتم إجراء RT-PCR باستخدام دورة Eppendorf Master. P. heterophylla β-actin تم استخدامه كعنصر تحكم داخلي لتطبيع مستوى التعبير ، وأجريت جميع التجارب بثلاثة تكرارات. تم إجراء التفاعل بحجم إجمالي قدره 10 ميكرولتر يحتوي على 5 ميكرولتر SYBR Green Master Mix (Takara) ، 1 ميكرولتر من مزيج cDNA المخفف ، 0.5 ميكرولتر لكل مادة أولية (10 ملم) ، و 3 ميكرولتر من الماء الخالي من RNase. تم إجراء التفاعلات في نظام PCR في الوقت الفعلي LightCycler480 (Roche) عند 95 درجة مئوية لمدة 30 ثانية ، تليها 45 دورة من 95 درجة مئوية لمدة 5 ثوانٍ و 60 درجة مئوية لمدة 30 ثانية. تم تأكيد تضخيم وكشف منتج PCR واحد فقط من خلال إجراء تحليل منحنى الذوبان لمنتجات التضخيم في نهاية كل PCR. بعد برنامج PCR ، تم تحليل مستوى التعبير عن الجينات المختلفة باستخدام طريقة CT المقارنة (طريقة 2 - △ △ CT) [79].

توافر البيانات الداعمة

تتوفر مجموعات بيانات التسلسل التي تدعم نتائج هذه المقالة من قاعدة بيانات أرشيف القراءة القصيرة (SRA) في NCBI ضمن الانضمام SRP052597.


2nd PUC Biology الاستنساخ الجنسي في النباتات المزهرة أسئلة وأجوبة نص الكتاب NCERT

السؤال رقم 1.
قم بتسمية أجزاء زهرة كاسيات البذور التي يحدث فيها تطور الطور المشيجي الذكري والأنثوي.
إجابة:
يحدث تطور الطور المشيجي الذكري من المسام الدقيقة أو حبوب اللقاح التي تتطور داخل كيس حبوب اللقاح أو كيس حبوب اللقاح في العضو الآخر.
يحدث تطور الطور المشيجي الأنثوي في نواة البويضة.

السؤال 2.
التفريق بين التكوُّن المجهري والتكوُّن الضخم. أي نوع من انقسام الخلايا يحدث خلال هذه الأحداث؟ قم بتسمية الهيكل الذي تم تشكيله في نهاية هذين الحدثين.
إجابة:
يسمى تطور microspore من الخلية الأم الدقيقة microsporogenesis. يُطلق على تطور الحجم الضخم من الخلية الأم الضخمة اسم التكوُّن الضخم. في كلا هذين التطورين ، تخضع الخلية الأم لانقسام انتصافي أو انقسام اختزال لإنتاج الأبواغ. في نهاية هذه التقسيمات ، يتم إنتاج المجهرية أو حبوب اللقاح داخل كيس حبوب اللقاح ، ويتم إنتاج المساحات الضخمة داخل المبيض.

السؤال 3.
رتب المصطلحات التالية في التسلسل التنموي الصحيح. حبوب اللقاح ، الأنسجة البوغية ، رباعي المسام الدقيقة ، الخلية الأم لحبوب اللقاح ، الأمشاج الذكرية.
إجابة:
الأنسجة البوغية & # 8211 الخلية الأم لحبوب اللقاح & # 8211 ميكروسبور رباعي & # 8211 حبوب اللقاح & # 8211 الأمشاج الذكور.

السؤال 4.
وصف أجزاء بويضة كاسيات البذور النموذجية باستخدام رسم تخطيطي أنيق.
إجابة:
البويضة هي أنثى ضخمة حيث يتم تكوين الشركات العملاقة.


الأجزاء المختلفة من البويضة هي:

  • ساق صغير أو قطعة أرض صغيرة تظل بها البويضة ملتصقة بمشيمة المبيض.
  • Hilum هي النقطة التي يتم عندها توصيلها بالبويضة. في البويضة المقلوبة ، تندمج الحشرة المعلقة مع الجسم الرئيسي للبويضة وتسمى بالرافعة.
  • البويضة محاطة من جميع الجوانب بعاملين متكاملين ولكن ليس في القمة حيث توجد فتحة تسمى micropyle. تسمى نهاية البويضة هذه بـ micropylar ، بينما تسمى نهاية البويضة المقابلة لها نهاية الشلال.
  • يقع كيس الجنين داخل النواة.
  • نحو نهاية micropyle للجنين ، تم العثور على بيضة واحدة أو بويضات واثنين من المتآزرين ، وباتجاه نهاية كلازة الجنين ، تم العثور على ثلاث خلايا مضادة. تم العثور على نوى ثانوية في المركز.

السؤال 5.
ما المقصود بالتطور أحادي البوغ للأنثى المشيجية؟
إجابة:
في العديد من النباتات المزهرة ، يتضخم واحد فقط من أصل أربعة ميجاسورات ويتطور إلى أنثى مشيجية أو كيس جنيني. أما الشركات الثلاثة الكبرى الأخرى فتتحلل. يسمى هذا النوع من تكوين كيس الجنين نوعًا أحادي البوغ من التطور.

السؤال 6.
مع رسم تخطيطي أنيق ، اشرح الطبيعة المكونة من 7 خلايا و 8 أنوية للنبات المشيجي الأنثوي.
إجابة:

كيس الجنين هو هيكل متعدد الخلايا بيضاوي. إنه مغطى بغشاء رقيق مشتق من الجدار الرئيسي الضخم. يحتوي النوع النموذجي أو نوع بوليغونوم من كيس الجنين على 8 نوى ولكن 7 خلايا & # 8211 3 ميكروبيلار ، 3 شلازال وواحد مركزي. تُعرف الخلايا المكروية الثلاث مجتمعة باسم جهاز البيض.خلية واحدة أكبر وتسمى البيضة أو الغلاف الجوي. إنه يحمل فجوة مركزية أو ميكروبيلار ونواة باتجاه نهاية الشلال. تسمى الخليتان المتبقيتان التآزرات أو خلايا المساعدة.

كل واحد منهم يحمل جهازًا خيطيًا في منطقة ميكروبيلار ، وخطافًا جانبيًا ، وفجوة شالازال ونواة مركزية. تمثل البيضة أو الغلاف المحيط الأمشاج الأنثوي الوحيد في كيس الجنين. تساعد التآزرات في الحصول على التغذية من الخلايا النووية الخارجية ، وتوجيه مسار أنبوب حبوب اللقاح عن طريق إفرازها وتعمل كممتص للصدمات أثناء اختراق أنبوب حبوب اللقاح في كيس الجنين.

تسمى الخلايا الثلاثية في كيس الجنين بالخلايا المضادة للأجسام. إنها الخلايا النباتية في كيس الجنين والتي قد تتحلل قريبًا أو تشارك في امتصاص الغذاء من الخلايا النووية المحيطة. داخليا ، ترتبط بالخلية المركزية عن طريق plasmodesmata.

الخلية المركزية هي أكبر خلية في كيس الجنين. يحتوي على سيتوبلازم مفرغ للغاية وغني بالطعام الاحتياطي وأجسام جولجي. في الوسط ، تحتوي الخلية على نواتين قطبيتين غالبًا ما تندمج لتشكيل نواة ثانوية ثنائية الصبغيات. وبالتالي ، فإن جميع خلايا كيس الجنين أحادية العدد باستثناء الخلية المركزية التي تصبح ثنائية الصبغة بسبب اندماج النوى القطبية.

السؤال 7.
ما هي أزهار تشاسموجاموس؟ هل يمكن أن يحدث التلقيح المتبادل في أزهار كليستوجاموس؟ أعط سببا لإجابتك.
إجابة:
أزهار Chasmogamous هي النوع الطبيعي للزهور ، والتي تشبه أزهار الأنواع الأخرى ذات الأنثرات المكشوفة والوصمة ، والتي توجد عادة في Commelina. بطبيعة الحال ، لا يمكن أن يحدث التلقيح المتبادل في أزهار cleistogamous لأنها تظهر عادة تحت سطح التربة.

السؤال 8.
اذكر استراتيجيتين تم تطويرهما لمنع التلقيح الذاتي في الأزهار.
إجابة:
يؤدي استمرار التلقيح الذاتي إلى اكتئاب زواج الأقارب. لذلك طورت النباتات المزهرة الأجهزة التالية لتثبيط التلقيح الذاتي وتشجيع التلقيح المتبادل:

  1. Dicliny (ثنائية الجنس): الأزهار أحادية الجنس بحيث لا يكون التلقيح الذاتي ممكنًا. قد تكون النباتات أحادية المسكن (تحمل أزهارًا من الذكور والإناث ، على سبيل المثال ، الذرة) أو ثنائية المسكن (تحمل أزهارًا من الذكور والإناث على نباتات مختلفة ، مثل التوت والبابايا).
  2. Dichogamy: ينضج الأنثر والوصمات في أوقات مختلفة في زهرة ثنائية الجنس وذلك لمنع التلقيح الذاتي.
  • تنضج Protandry & # 8211 Anthers في وقت أبكر من وصمة العار من نفس الزهرة. تصبح حبوب اللقاح الخاصة بهم متاحة لوصمات الأزهار القديمة ،
    على سبيل المثال ، عباد الشمس ، سالفيا.
  • تنضج Protogyny & # 8211 Stigmas في وقت مبكر بحيث يتم تلقيحها قبل أن تقوم أنثرات نفس الزهرة بتطوير حبوب اللقاح ، على سبيل المثال ، Mirabilis jalapa (أربعة o & # 8217clock) ، Gloriosa ، Plantago.

السؤال 9.
ما هو عدم التوافق الذاتي؟ لماذا لا يؤدي التلقيح الذاتي إلى تكوين البذور في الأنواع غير المتوافقة مع الذات؟
إجابة:
في بعض الأزهار ، لا تنبت حبوب اللقاح على مدقة الزهرة نفسها. وهذا ما يسمى عدم التوافق الذاتي. في مثل هذه الحالات ، لا تنبت حبوب اللقاح وتنتج أمشاج ذكورية ، وبالتالي لا يحدث الإخصاب. لذلك لا يتم إنتاج البذور في أزهار غير متوافقة مع ذاتها.

السؤال 10.
ما هي تقنيات التعبئة؟ كيف تكون مفيدة في برنامج تربية النباتات.
إجابة:
إذا كان الوالد يحمل أزهارًا ثنائية الجنس ، فمن الضروري إزالة الأنثرات من برعم الزهرة قبل أن يتفوق العضو الآخر باستخدام زوج من الملقط. يشار إلى هذه الخطوة باسم الإخصاء. يجب تغطية الأزهار المخصبة بكيس من الحجم المناسب ، يتكون بشكل عام من ورق الزبدة ، لمنع تلوث وصمة العار بحبوب اللقاح غير المرغوب فيها. هذه العملية تسمى التعبئة. عندما تصل وصمة الزهرة المعبأة إلى قابلية القبول ، يتم غبار حبوب اللقاح الناضجة التي تم جمعها من أنثر الوالد الذكر على وصمة العار ، ويتم إعادة ترقيم الأزهار ، ويسمح للثمار بالنمو. تسمح هذه العملية لمربي النباتات باستخدام الأنواع المرغوبة من حبوب اللقاح للحصول على البذور المرغوبة.

السؤال 11.
ما هو الانصهار الثلاثي؟ أين وكيف يتم ذلك؟ اسم النوى المشاركة في الاندماج الثلاثي.
إجابة:
يندمج أحد الأمشاج الذكرية مع النواة الثانوية يسمى الاندماج الثلاثي. يحدث في كيس الجنين. بعد الإخصاب الطبيعي ، أي التحام ، (اندماج الأمشاج الذكري مع البويضة) ، تندمج الأمشاج الذكرية الأخرى مع النواة الثانوية أو نواة السويداء. النوى المشاركة في الاندماج الثلاثي هي النواة الثانوية أو نواة السويداء. هم ثنائي الصيغة الصبغية

السؤال 12.
لماذا تعتقد أن البيضة الملقحة نائمة لبعض الوقت في البويضة الملقحة؟
إجابة:
تُعرف البويضة المخصبة باسم البيضة الملقحة التي تؤدي إلى تكوين الجنين. قبل التطور ، تمر البيضة الملقحة بفترة راحة. وذلك لأن البيضة الملقحة تنتظر تكوين كمية معينة من السويداء لتغذية الجنين. هذا تكيف لتوفير تغذية مضمونة للجنين النامي.

السؤال 13.
التفريق بين
(أ) Hypocotyl و epicotyl
(ب) Coleoptile و coleorhiza
(ج) الضمانة و testa
(د) Perisperm و pericarp
إجابة:
(أ) Hypocotyl و epicotyl

هيبوكوتيل إبيكوتيل
1. يُعرف جزء المحور الجنيني الذي يقع أسفل النبتة في جنين الديكوت باسم hypocotyl.
2. وينتهي مع الجذر.
1. يُعرف جزء المحور الجنيني الذي يقع فوق الفلقة في جنين الديكوت باسم epicotyl.
2. وينتهي مع بلومول.

(ب) Coleoptile و coleorhiza

غمد كوليورهيزا
إنه غلاف واقي مخروطي الشكل يحيط بالريش في بذرة أحادية. إنه غمد غير متمايز يحيط بالجذر وغطاء الجذر في بذرة أحادية.

غلاف تيستا
إنه الغطاء الخارجي للبويضة. يوفر لها الحماية. إنه الغطاء الخارجي للبذرة.

بيريسبيرم بريكارب
إن النواة المتبقية هي التي تستمر. إنه موجود في بعض البذور مثل البنجر. إنه جدار الفاكهة الناضج الذي ينمو من جدار المبيض.

السؤال 14.
لماذا يسمى التفاح فاكهة مزيفة؟ أي جزء (أجزاء) من الزهرة تشكل الفاكهة؟
إجابة:
تتطور معظم الثمار من المبيض فقط وتسمى الثمار الحقيقية. عندما تتطور الفاكهة من أجزاء الأزهار الأخرى غير المبيض ، يطلق عليها اسم الفاكهة الزائفة. التفاح فاكهة كاذبة حيث يساهم المهاد في تكوين الفاكهة.

السؤال 15.
ما هو الإخصاء؟ متى ولماذا يستخدم مربي النباتات هذه التقنية؟
إجابة:
إنه إزالة الأنثرات قبل التخليق من زهرة المخنثين التي تستخدم كأم أنثى. أثناء التهجين ، يستخدم مربي النبات هذه التقنية لمنع التلقيح الذاتي.

السؤال 16.
إذا كان بإمكان المرء أن يحرض على البارثينوكاربي من خلال تطبيق مواد النمو ، فما هي الثمار التي ستختارها للحث على التوالد العذري ولماذا؟
إجابة:
الثمار البارثينوكاربية هي ثمار تنمو بدون إخصاب وبالتالي فهي بدون بذور. يمكن تحفيز بارثينوكاربي من خلال تطبيق هرمونات النمو. الفاكهة المهمة مثل الموز ، والبابايا ، والبرتقال ، والعنب ، والجوافة ، والبطيخ ، إلخ ، يمكن أن تكون خالية من البذور من خلال استخدام مواد النمو لأنها فواكه مهمة اقتصاديًا ، وإذا تم تصنيعها بدون بذور فستكون أكثر قيمة.

السؤال 17.
اشرح دور تابيتوم في تكوين جدران حبوب اللقاح.
إجابة:
Tapetum هي الطبقة الأعمق من microsporangium. يوفر الغذاء لحبوب اللقاح النامية. خلال عملية التكوُّن المجهري ، تنتج خلايا التابيتوم إنزيمات مختلفة ، وهرمونات ، وأحماض أمينية ، ومواد مغذية أخرى مطلوبة لتطوير حبوب اللقاح. كما أنها تنتج الطبقة الخارجية من حبوب اللقاح ، والتي تتكون من سبوروبولين.

السؤال 18.
ما هو Apomixis وما هي أهميته؟
إجابة:
يسمى النوع الطبيعي للتكاثر الجنسي الذي له ميزتان عاديتان ، أي الانقسام الاختزالي والتخصيب ، amphimixis. ولكن في بعض النباتات ، يتم استبدال هذا التكاثر الجنسي الطبيعي بنوع غير طبيعي من التكاثر الجنسي يسمى apomixis.

تم إعطاء مصطلح apomixis لأول مرة بواسطة Winkler (1908). يمكن تعريف Apomixis على أنه نوع غير طبيعي من التكاثر الجنسي حيث تتطور البويضة أو الخلايا الأخرى المرتبطة بالبويضة (التآزرات ، ومضادات الأرجل ، وما إلى ذلك) إلى جنين بدون إخصاب ومع أو بدون انقسام الاختزالي. يتم زراعة أنواع هجينة من العديد من المحاصيل الغذائية والخضروات على نطاق واسع. أدت زراعة الهجينة إلى زيادة الإنتاجية بشكل كبير.

واحدة من مشاكل الهجينة هي أنه يجب إنتاج البذور المهجنة كل عام. إذا تم زرع البذور التي تم جمعها من الهجينة ، فإن النباتات في السلالة ستفصل ولن تحتفظ بأحرف هجينة. يعتبر إنتاج البذور المهجنة مكلفًا وبالتالي تصبح تكلفة البذور المهجنة باهظة الثمن بالنسبة للمزارعين. إذا تم تحويل هذه الهجينة إلى أبومكتس ، فلا يوجد فصل بين الشخصيات في السلالة الهجينة. بعد ذلك ، يمكن للمزارعين الاستمرار في استخدام البذور المهجنة لزراعة محاصيل جديدة عامًا بعد عام ولا يتعين عليهم شراء بذور هجينة كل عام. عادة ما تكون الأجنة المتكونة من خلال apomixis خالية من العدوى.

2nd PUC Biology التكاثر الجنسي في النباتات المزهرة أسئلة وأجوبة إضافية

2nd PUC Biology التكاثر الجنسي في النباتات المزهرة أسئلة علامة واحدة

السؤال رقم 1.
استخرج الغريب
ب. Endothecium ، Tapetum ، الطبقات الوسطى ، النواة
ج. إكسين ، نواة الأنبوب ، التآزر ، الخلية التوليدية
د. البيض ، الأمعاء ، المضادات ، النواة الثانوية
إجابة:
ب. نواة
ج. التآزر
د. Intine

السؤال 2.
قم بتسمية بعض الأطباق الملقحة بالماء.
إجابة:

السؤال 3.
يتم تعديل بعض الزهور بشكل كبير لتلقيح الحشرات. لديهم العديد من الميزات التي تساعد هذا النوع من التلقيح.
أ. ماذا تسمى هذه الزهور؟
ب. اشرح الشخصيات التي تجعلها مناسبة لهذا النوع من التلقيح.
إجابة:
أ. الزهور المتعفنة
ب. حبوب اللقاح ذات الألوان الزاهية ، عطرة ، رحيقية ، لزجة.

السؤال 4.
ما هي الفاكهة المزيفة؟ اعط مثالا.
إجابة:
تتكون الثمرة من أي أجزاء نباتية من الزهرة غير المبيض ، على سبيل المثال. التفاح ، الكمثرى ، الكاجو ، إلخ. [CBSE & # 8211 95]

السؤال 5.
تنتج كاسيات البذور هياكل تناسلية ذكورية وأنثوية يتم فيها إنتاج مشيجات وأمشاج من الذكور والإناث.
أ. اسم البنية التناسلية للذكور والإناث.
ب. اسم الطور المشيجي الذكر والأنثى.
إجابة:
أ. الهيكل التناسلي الذكري هو آخر والبنية التناسلية الأنثوية هي المدقة.
ب. الطور المشيجي الذكر هو حبة حبوب اللقاح الناضجة ، والنمط المشيجي الأنثوي هو الجنين.

السؤال 6.
أي نوى تندمج لتعطي السويداء؟
إجابة:
النوى القطبية.

السؤال 7.
قم بتسمية مرحلة حدوث أكثر من جنين في البذرة.
إجابة:
تعدد الأجنة.

السؤال 8.
مصطلح المراحل المبكرة من تطور الجنين.
إجابة:
الجنين

السؤال 9.
يسمى تكوين نواة السويداء الأولية بالاندماج الثلاثي. لماذا سميت بذلك؟
إجابة:
تتكون نواة السويداء الأولية من اندماج نواة ثانوية ومشيج ذكر وتتكون النواة الثانوية من اندماج نواتين قطبيتين أحادي العدد. نظرًا لحدوث ثلاثة اندماجات في تكوين نواة السويداء الأولية ، يُطلق عليها الانصهار الثلاثي.

السؤال 10.
تعريف parthenocarpy.
إجابة:
هذه ثمار بدون بذور تتشكل بدون تلقيح أو إخصاب.

السؤال 11.
ما هو الاخصاب؟
إجابة:
إنه اندماج مشيج ذكر واحد مع خلية البويضة ومشيج آخر مع نوى قطبية في كاسيات البذور. [CBSE & # 8211 99]

السؤال 12.
اذكر الفرق بين السويداء في عاريات البذور وكاسيات البذور.
إجابة:
السويداء من عاريات البذور هو نبات مشيجي أحادي الصيغة الصبغية ولكن في كاسيات البذور ، يكون ثلاثي الصبغيات لأنه يتكون بعد الإخصاب المزدوج.

السؤال 13.
ما هو epicotyl؟
إجابة:
جزء من المحور الجنيني بين اللويحة والنبتة.

السؤال 14.
حدد مصطلح geitonogamy.
إجابة:
حالة تترسب فيها حبوب اللقاح من زهرة واحدة على وصمة زهرة أخرى محمولة على نفس النبات.

السؤال 15.
ما مصير النواة الثانوية بعد الإخصاب؟
إجابة:
يشكل السويداء.

السؤال 16.
ما هو اللوجامي؟
إجابة:
إنه نقل حبوب اللقاح من زهرة إلى وصمة العار لزهرة أخرى على نبات منفصل من نفس النوع.

السؤال 17.
ما الذي يتطور إلى خلية أم دقيقة في الزهرة؟
إجابة:
الخلايا البوغية.

السؤال 18.
ما هو القولون؟ [CBSE & # 8211 97]
إجابة:
إنه الغطاء الواقي فوق جذر الذرة.

السؤال 19.
ما هو داء جلدي؟
إجابة:
إنه نبتة واحدة من الذرة.

السؤال 20.
ما هو فونيكولوس؟
إجابة:
ساق البويضة الذي تعلق به على المشيمة.

2nd PUC Biology التكاثر الجنسي في النباتات المزهرة سؤالان يتعلقان بعلامات

السؤال رقم 1.
التفريق بين التوالد العذري والتوالد العذري.
إجابة:
Parthenocarpy هو تكوين الفاكهة بدون إخصاب بينما التوالد العذري هو تكوين جنين من بويضة غير مخصبة.

السؤال 2.
ارسم مخططًا مُسمى لحبوب حبوب اللقاح الناضجة. [CBSE & # 8211 90]
إجابة:

السؤال 3.
ما هو سبات البذور؟ أعط أي ميزتين. [CBSE & # 8211 94]
إجابة:
سكون البذور هو حالة البذرة عندما تفشل في الإنبات على الرغم من أن الظروف البيئية مواتية للنمو النشط.
ميزتان من السكون:

  • يساعد البذور على الانتشار في الزمان والمكان من أجل تحقيق أقصى قدر من البيئة التعاونية لبقاء الأنواع.
  • لضمان إنبات البذور بنجاح في ظل أفضل الظروف.

السؤال 4.
ما هي الثمار الكاذبة؟ اعط مثال.
إجابة:
تسمى الثمار التي تتطور من أجزاء أخرى غير المبيض الناضج ثمار مزيفة.
على سبيل المثال: تتطور ثمار التفاح والكمثرى من المهاد السمين. [CBSE & # 8211 95]

السؤال 5.
اكتب أهمية الإخصاب المزدوج.
إجابة:
يؤدي الإخصاب المزدوج إلى تطوير السويداء ثلاثي الصبغيات الذي يوفر الغذاء للبذور السليمة النامية ويعوض السويداء ثلاثي الصبغيات عن التقليل الشديد للنبات المشيجي الأنثوي في كاسيات البذور.

السؤال 6.
رتب المصطلحات التالية في تسلسل تنموي صحيح.
حبوب اللقاح ، والأنسجة البوغية ، ورباعية المسام الدقيقة ، والخلية الأم لحبوب اللقاح ، والأمشاج الذكرية.
إجابة:
تسلسل التطور الصحيح للمصطلحات المذكورة أعلاه هو الأنسجة البوغية ، ورباعية المسام الدقيقة ، وخلية حبوب اللقاح الأم ، وحبوب حبوب اللقاح ، والأمشاج الذكرية.

السؤال 7.
اكتب الفرق بين القرمزي و coleorhiza.
إجابة:

  • في بذرة أحادية الفلقة ، منطقة المحور الجنيني أسفل النبتة هي الجذور المغطاة بغلاف واقي هي coleorhiza.
  • فوق نقطة التعلق بالنبتة ، يصبح المحور الجنيني هو اللولب المحاط بغطاء يشبه الورقة يسمى coleoptile.

2nd PUC Biology التكاثر الجنسي في النباتات المزهرة خمسة أسئلة علامات

السؤال رقم 1.
وصف عملية تطور جنين ثنائي الفلقة.
إجابة:
تسمى عملية تطوير الجنين الناضج من الزيجوت ثنائي الصبغة بالتكوين الجنيني. بعد الإخصاب ، تنقسم البيضة الملقحة بشكل عرضي إلى خليتين & # 8211 خلية قمي صغيرة وخلية قاعدية كبيرة. تنقسم الخلية القاعدية الواقعة نحو الميكروبيلي في اتجاه واحد إلى صف من الخلايا يسمى المعلق. يدفع الجنين النامي إلى السويداء لامتصاص العناصر الغذائية.

تخضع الخلية القمية الواقعة باتجاه الطرف المضاد للزايجوت إلى قسمين عموديين وانقسام عرضي واحد لتشكيل الكتلة الجنينية. تنقسم خلايا الكتلة الجنينية بشكل متكرر وتتشكل الأجزاء المختلفة من الجنين. تشكل الخلايا الأمامية للكتلة الجنينية بلومًا ونبتتين. يتكون الجزء الرئيسي من الجذر و hypocotyl من خلايا الكتلة الجنينية الخلفية.

السؤال 2.
تتبع الأحداث التي ستحدث في الزهرة من وقت سقوط حبوب اللقاح من نفس النوع على وصمة العار حتى اكتمال الإخصاب.
إجابة:

تتطور حبوب اللقاح على وصمة العار التي يحفزها إفراز وصمة العار. تنمو الأمعاء على شكل نتوء من خلال أحد المسام الجرثومية. يستمر هذا النمو في النمو كأنبوب حبوب اللقاح. تتحرك نواة الخلية النباتية إلى داخلها متبوعة بالخلية المنتجة. تنقسم الخلية المولدة إلى مشيجين من الذكور وتنتقل إلى طرف أنبوب حبوب اللقاح.

يفرز أنبوب حبوب اللقاح الإنزيمات لهضم أنسجة النمط ويدخل البويضة من خلال الطرف الصغير ويطلق الأمشاج الذكورية في أحد تآزر كيس الجنين. يندمج أحد الأمشاج الذكرية مع البويضة لتشكيل الزيجوت. هذه العملية تسمى syngamy. يندمج المشيج الذكري الآخر مع النواة الثانوية لتشكيل نواة السويداء الأولية.

هذه العملية تسمى الانصهار الثلاثي. نظرًا لوجود نوعين من الاندماج (التحام اللحمي والاندماج الثلاثي) داخل البويضة أثناء الإخصاب ، يُعرف باسم الإخصاب المزدوج.

السؤال 3.
ارسم مخططًا معنونًا لـ T.S من العضو الذكري المنزوع.
إجابة:

السؤال 4.
يشار إلى زهرة brinjal باسم chasmogamous بينما يُشار إلى زهرة الفاصوليا بأنها cleistogamous. كيف هم مختلفون عن بعضهم البعض؟
إجابة:

  • أزهار Chasmogamous: تشبه أزهار Chasmogamous أزهار الأنواع الأخرى ذات الأنثرات المكشوفة والوصمة.
  • أزهار كليستوجاموس: لا تفتح أزهار كليستوجاموس أبدًا لضمان التلقيح الذاتي. تظل مغلقة حتى لا يحدث التلقيح المتبادل.

يتم تجميع ثلاث خلايا في نهاية clealazal تسمى مضادات الأرجل. الخلية الكبيرة في وسط كيس الجنين هي الخلية المركزية. في وقت لاحق اندمجت نواتان قطبية في الخلية المركزية لتشكيل نواة ثانوية غير صلبة أو نواة السويداء. وبالتالي فإن كيس جنين النباتات المزهرة هو 8 أنوية 7 خلايا عند النضج. يسمى هذا النوع من كيس الأجنة أحادي الأبواغ لأنه يتكون من واحد فقط من 4 ميجاسورات.


مشاكل نموذجية NCERT الفئة 12 علم الأحياء الفصل 2 التكاثر الجنسي في النباتات المزهرة

أسئلة متعددة الخيارات
نوع إجابة واحدة صحيحة
السؤال رقم 1. من بين المصطلحات المدرجة أدناه ، تلك التي ليست من الأسماء الصحيحة تقنيًا لعقار الأزهار
أنا. Androecium الثاني. خباء
ثالثا. كورولا الرابع. سيبال
(أ) الأول والرابع (ب) الثالث والرابع
(ج) 2 و 4 (د) 1 و 2
إجابة. (ج)
• هناك 4 أزهار زهرية ، كاليس ، كورولا ، أندريسيوم وجينيسيوم. كاليكس وكورولا هي أعضاء ملحقة أو دوامة غير أساسية ، في حين أن الأندريسيوم والجينيسيوم من الأعضاء التناسلية.
• الكأس هو الزهرة الخارجية للزهرة وتسمى الأعضاء الكأس.
• Gynoecium هو الجزء التناسلي الأنثوي من الزهرة ويتكون من واحد أو أكثر من الكاربيل.

السؤال 2. كيس الجنين هو البويضة كما هو الحال بالنسبة للآخر.
(أ) السداة (ب) الشعيرة
(ج) حبوب اللقاح (د) Androecium
إجابة. (ج)
• كيس الجنين (الطور المشيجي الأنثوي) • البويضة (megasporangium)
• حبوب اللقاح (الطور المشيجي الذكري) • الأنثر (microsporangium)

السؤال 3. في زهرة نموذجية كاملة ومزدوجة الميول الجنسية وحيوية ، فإن ترتيب الزهرات الزهرية على المهاد من الخارج إلى الداخل هو
(أ) كاليكس ، كورولا ، أندروسيوم وجينيسيوم
(ب) كاليكس ، كورولا ، جينيسيوم وأندروسيوم
(ج) جينيسيوم ، أندريسيوم ، كورولا وكاليكس
(د) Androecium و gynoecium و corolla و calyx
إجابة. (أ) ترتيب الزهرات الزهرية على المهاد من الخارج إلى الداخل هو الكأس والكورولا والأندروسيوم والجينيسيوم.

السؤال 4. نبات ثنائي الفلقة يحمل أزهارًا ولكنه لا ينتج ثمارًا وبذورًا. السبب الأكثر احتمالا للوضع أعلاه هو
(أ) النبات ثنائي المسكن ولا يحمل سوى أزهار مكدسة
(ب) النبات ثنائي المسكن ويتحمل أزهارًا متقشرة ومكسوة
(ج) النبات أحادي المسكن
(د) النبات ثنائي المسكن ولا يحمل سوى أزهار سائلة.
إجابة. (د) يحمل النبات ثنائي الفلقة أزهارًا ولكنه لا ينتج أبدًا ثمارًا وبذورًا لأن النبات ثنائي المسن ولا يحمل سوى الأزهار السداة.

السؤال 5. طبقات الجدار الخارجية والأعمق من microsporangium في العضو الآخر هي على التوالي
(أ) Endothecium و tapetum (ب) البشرة و الجلد الباطن
(ج) البشرة والطبقة الوسطى (د) البشرة والتابيتوم
إجابة. (د) طبقات الجدار من microsporangium في العضو الآخر هي:

السؤال 6. خلال عملية التكوُّن المجهري ، يحدث الانقسام الاختزالي في
(أ) Endothecium (ب) الخلايا الأم Microspore
(ج) رباعي المسام الدقيقة (د) حبوب اللقاح
إجابة. (ب) أثناء التكوّن المجهري ، يحدث الانقسام الاختزالي في الخلايا الأم الدقيقة.

السؤال 7. من بين مجموعات المصطلحات الواردة أدناه ، حدد المصطلحات المرتبطة بـ gynoecium.
(أ) وصمة العار ، البويضة ، كيس الجنين ، المشيمة
(ب) الثالاموس ، المدقة ، النمط ، البويضة
(ج) البويضة ، المبيض ، كيس الجنين ، تابيتوم
(د) البويضة ، السداة ، المبيض ، كيس qpibryo
إجابة. (أ) ترتبط وصمة العار والبويضة وكيس الجنين والمشيمة بالجنس.

السؤال 8. بدءًا من الجزء الأعمق ، يكون التسلسل الصحيح للأجزاء في البويضة
(أ) بيضة ، نواة ، كيس جنيني ، غلاف.
(ب) البيض ، كيس الجنين ، النواة ، التكامل.
(ج) كيس الجنين ، نواة ، غلاف ، بيضة
(د) البيض ، والتكامل ، وكيس الجنين ، والنواة
إجابة. (ب) التسلسل الصحيح للأجزاء في البويضة

السؤال 9. من العبارات الواردة أدناه ، اختر الخيار الصحيح لنبات مشيجي نموذجي لنبات مزهر.
أنا. إنه ذو 8 نواة و 7 خلايا عند النضج
ثانيا. إنها خالية من الأسلحة النووية أثناء التطوير
ثالثا. يقع داخل الغلاف ولكن خارج النواة
رابعا. لديها جهاز بيض يقع في نهاية الشلال
(أ) الأول والرابع (ب) الثاني والثالث
(ج) الأول والثاني (د) الثاني والرابع
إجابة. (ج) الطور المشيجي الأنثوي النموذجي للنبات المزهر هو 8 نواة و 7 خلايا عند النضج ونووي حر أثناء التطور.

السؤال 10. يمكن أن يحدث الزواج الذاتي في زهرة تشاسموجاميوس إذا
(أ) ينضج حبوب اللقاح قبل نضج البويضة
(ب) تنضج البويضات قبل نضج حبوب اللقاح
(ج) ينضج كل من حبوب اللقاح والبويضات في وقت واحد
(د) كل من العضو الذكري ووصمة العار متساويان في الطول
إجابة. (ج) في الزهرة العادية التي تفتح وتكشف الأنثرات ووصمة العار ، يكون الزواج الذاتي الكامل نادرًا إلى حد ما. يتطلب الزواج الذاتي في مثل هذه الأزهار تزامنًا في إطلاق حبوب اللقاح وتقبل وصمة العار وأيضًا ، يجب أن تكون الأنثرات ووصمة العار قريبة من بعضها البعض بحيث يمكن أن يحدث التلقيح الذاتي.

السؤال 11. اختر البيان الصحيح مما يلي:
(أ) تظهر أزهار كليستوجاموس دائمًا زواجًا ذاتيًا
(ب) تظهر أزهار Chasmogamous’flower دائمًا الزواج الجغرافي
(ج) تظهر أزهار كليستوجاموس كلا من الزواج الذاتي والزواج الجغرافي
(د) لا تظهر أزهار Chasmogamous أبدًا زواجًا ذاتيًا
إجابة. (أ) تكون أزهار كليستوجاموس دائمًا ذاتية الزواج حيث لا توجد فرصة لتواجد حبوب اللقاح المتقاطعة على وصمة العار. تنتج أزهار كليستوجاموس مجموعة بذور مضمونة حتى في حالة عدم وجود الملقحات.
على سبيل المثال من أزهار cleistogamous هي فيولا (وطي شائع) ، Oxalis ، Commelina ، Arachis hypogea و Oryza sativa.

السؤال 12. ينتج نوع معين من النباتات حبوب اللقاح الخفيفة غير اللاصقة بأعداد كبيرة وتكون وصماتها طويلة وريشية. هذه التعديلات تسهل التلقيح بواسطة
(أ) الحشرات (ب) المياه (ج) الرياح (د) الحيوانات
إجابة. (ج) يسمى التلقيح بواسطة الرياح بفقدان الدم. الأزهار غير المحببة صغيرة ، غير معطرة بشكل واضح بدون ألوان زاهية ورحيق ورائحة. يتطلب التلقيح بالرياح أيضًا أن تكون حبوب اللقاح خفيفة وغير لزجة وهي بأعداد كبيرة ووصماتها طويلة وريشية.

السؤال 13. من بين المواقف الواردة أدناه ، اختر الموقف الذي يمنع كلا من الزواج الذاتي والزواج الجغرافي.
(أ) نبات أحادي النوع يحمل أزهارًا ثنائية الجنس
(ب) نبات ثنائي المسكن يحمل أزهارًا من الذكور أو الإناث فقط
(ج) نبات أحادي مع أزهار ثنائية الجنس
(د) نبات ثنائي المسكن مع أزهار ثنائية الجنس
إجابة. (ب)
• Autogamy (نفس الزهرة) geitonogamy (أزهار مختلفة من نفس النباتات xenogamy (زهرة نبات مختلفة)
• النباتات ثنائية المسكن التي تحمل أزهارًا ذكورية أو أنثوية فقط تمنع الزواج الذاتي والزواج الجغرافي.

السؤال 14. في كيس الجنين المخصب ، تكون الهياكل أحادية الصيغة الصبغية وثنائية الصبغية وثلاثية الصيغة الصبغية
(أ) التآزر ، الزيجوت ونواة السويداء الأولية
(ب) النوى التآزرية والمتضادة والقطبية
(ج) نواة السويداء الأولية والمتآزرة والمتناقضة
(د) التآزر والنوى القطبية والزيجوت
إجابة. (أ) في كيس الجنين المخصب ، تكون الهياكل الفردية ، ثنائية الصبغيات ، وثلاثية الصيغة الصبغية هي نواة متآزرة ، ولاقحة ، ونواة السويداء الأولية ، على التوالي.

السؤال 15. في كيس الجنين ، تكون الخلايا التي تتحلل بعد الإخصاب
(أ) التآزر وخلية السويداء الأولية
(ب) التآزر ومضادات الأرجل
(ج) مضادات الأرجل وخلية السويداء الأولية
(د) البيض ومضادات الأرجل
إجابة. (ب) في كيس الجنين ، تتدهور المؤازرات ومضادات الأرجل بعد الإخصاب.

السؤال 16. أثناء التخطيط لبرنامج تهجين اصطناعي يتضمن نباتات ثنائية المسكن ، أي من الخطوات التالية لن تكون ذات صلة؟
(أ) تعبئة الزهرة الأنثوية
(ب) نفض حبوب اللقاح على وصمة العار
(ج) الإخصاء
(د) جمع حبوب اللقاح
إجابة. (ج)
• التهجين الاصطناعي هو أحد الأساليب الرئيسية لبرنامج تحسين المحاصيل. في مثل هذه التجارب المتقاطعة ، من المهم التأكد من استخدام حبوب اللقاح المرغوبة فقط للتلقيح وحماية وصمة العار من التلوث (من حبوب اللقاح غير المرغوب فيها). يتم تحقيق ذلك من خلال تقنيات الإخصاء والتعبئة.
• الإخصاء له علاقة بالنباتات أحادية المسكن.

السؤال 17. في أجنة ديكوت نموذجي وعشب ، توجد هياكل متجانسة حقيقية
(أ) Coleorhiza و coleoptile
(ب) Coleoptile و scutellum
(ج) النبتات والنباتات
(د) Hypocotyl والجذر
إجابة. (ج) الفلقات من جنين الديكوت النموذجي هي هياكل بسيطة بشكل عام سميكة ومنتفخة بسبب تخزين احتياطيات الغذاء (كما هو الحال في البقوليات) ويتكون جنين أحادي الفلقة من نبتة واحدة كبيرة وذات شكل درع تُعرف باسم scutellum تقع باتجاه جانب واحد (جانبي) من المحور الجنيني. على سبيل المثال: عائلة العشب ، الذرة الرفيعة.

السؤال 18. تسمى الظاهرة التي لوحظت في بعض النباتات حيث تستخدم أجزاء من الجهاز الجنسي لتشكيل أجنة بدون إخصاب
(أ) Parthenocarpy (ب) Apomixis
(ج) التكاثر الخضري (د) التكاثر الجنسي
إجابة. (ب)
• Apomixis هي آلية خاصة لإنتاج البذور بدون إخصاب. لوحظ في عدد قليل من النباتات المزهرة مثل بعض أنواع asteraceae والأعشاب.
• Apomixis هو شكل من أشكال التكاثر اللاجنسي الذي يحاكي التكاثر الجنسي. إذا تم تشكيل الفاكهة دون إخصاب المبيض ، فإنها تسمى فاكهة بارثينوكاربك ، مثل الموز والعنب.

السؤال 19. في الزهرة ، إذا كانت الخلية الأم الضخمة تشكل شظايا عملاقة دون أن تمر بالانقسام الاختزالي وإذا تطور أحد الكتل الضخمة إلى كيس جنيني ، فإن نواتها ستكون
(أ) هابلويد
(ب) ديبلويد
(ج) عدد قليل من الصيغة العددية وعدد قليل ثنائي الصيغة الصبغية
(د) مع تباين متفاوت
إجابة. (ب) في الزهرة ، إذا كانت الخلية الأم الضخمة تشكل شظايا ضخمة دون أن تخضع للانقسام الاختزالي وإذا تطورت إحدى المجموعات العملاقة إلى كيس جنيني ، فإن نواتها ستكون ثنائية الصبغة.

السؤال 20. تسمى الظاهرة التي يتطور فيها المبيض إلى ثمرة بدون إخصاب
(أ) بارثينوكاربي
(ب) Apomixis
(ج) التكاثر اللاجنسي
(د) التكاثر الجنسي
إجابة. (أ) إذا تم تشكيل الفاكهة دون إخصاب البيض ، فإنها تسمى فاكهة بارثينوكاربية ، مثل الموز والعنب.

أسئلة نوع الإجابة قصيرة جدًا
السؤال رقم 1. قم بتسمية الخلايا المكونة لـ "جهاز البيض" في كيس الجنين.
إجابة. يحتوي جهاز البيض على ثلاث خلايا - خلية بويضة واحدة واثنتان متآزرتان.

السؤال 2. قم بتسمية جزء من gynoecium الذي يحدد الطبيعة المتوافقة لحبوب اللقاح.
إجابة. يتم تحديد الطبيعة المتوافقة لحبوب حبوب اللقاح من خلال وصمة عار الكاربيل / المدقة.

السؤال 3. قم بتسمية الوظيفة المشتركة التي تؤديها الفلقات والنواة.
إجابة. توفر كل من الفلقات والنواة الغذاء.

السؤال 4 - أكمل المخطط الانسيابي التالي:

إجابة.

السؤال 5 - أشر إلى المراحل التي يحدث فيها الانقسام الاختزالي والانقسام الفتيلي (1 أو 2 أو 3) في التدفق؟

إجابة.

السؤال 6. في الرسم البياني أدناه ، أظهر مسار أنبوب حبوب اللقاح من حبوب اللقاح على وصمة العار إلى كيس الجنين. قم بتسمية مكونات جهاز البيض.

إجابة. مكونات جهاز البيض: خلية بويضة واحدة واثنان من المتآزرات.

السؤال 7. قم بتسمية أجزاء المدقة التي تتطور إلى ثمار وبذور.
إجابة. يتطور Ovaiy of pistil إلى ثمار بينما تتطور البويضات إلى بذور.

السؤال 8 - في حالة تعدد الأجنة ، إذا نشأ جنين من التآزر وآخر من النواة أيهما أحادي الصبغيات وأيهما ثنائي الصيغة الصبغية؟
إجابة.الجنين المتناغم هو أحادي الصبغة والجنين النووي ثنائي الصبغة.

السؤال 9: هل يمكن أن يؤدي كيس الجنين غير المخصب غير المخصب إلى تكوين جنين ثنائي الصبغة؟ إذا كانت الإجابة بنعم ، فكيف؟
إجابة.نعم ، إذا تطور الجنين من خلايا نواة أو تكامل ، فسيكون ثنائي الصبغة.

السؤال 10: ما هي الخلايا الثلاث الموجودة في حبوب اللقاح عندما يتم إلقاءها في المرحلة ثلاثية الخلايا؟
إجابة.خلية نباتية واحدة واثنين من الأمشاج الذكور.

السؤال 11 - ما هو عدم التوافق الذاتي؟
إجابة.الجهاز الذي يمنع زواج الأقارب هو عدم التوافق الذاتي أو التعقيم الذاتي. هذه آلية وراثية وتمنع حبوب اللقاح الذاتية (من نفس الزهرة أو زهور أخرى من نفس النبات) من تخصيب البويضات عن طريق تثبيط إنبات حبوب اللقاح أو نمو أنبوب حبوب اللقاح في المدقة.

السؤال 12- قم بتسمية نوع التلقيح في النباتات غير المتوافقة مع ذاتها.
إجابة.Xenogamy

السؤال 133: ارسم مخططًا لكيس الجنين الناضج وأظهر طبيعته المكونة من 8 نواة و 7 خلايا. اعرض الأجزاء التالية: مضادات الأرجل ، التآزر ، البيض ، الخلية المركزية ، النوى القطبية.
إجابة.

السؤال 14. ما هو النسيج ثلاثي الصبغيات في البويضة الملقحة؟ كيف يتم تحقيق الشرط ثلاثي الصيغة الصبغية؟
إجابة. النسيج ثلاثي الصبغيات في البويضة هو السويداء. حالتها ثلاثية الصيغة الصبغية هي. تم تحقيقه نتيجة اندماج نواتين قطبيتين ونواة واحدة من مشيج ذكر (يشار إليه أيضًا بالاندماج الثلاثي).

السؤال 15. هل التلقيح والإخصاب ضروريان في Apotnixis؟ اعط اسبابا.
إجابة. لا ، ليست ضرورية. Apomixis هو في الواقع بديل للجنس
التكاثر على الرغم من استخدام الجهاز الجنسي الأنثوي في هذه العملية. في Apomicts ، يمكن أن تتطور الأجنة مباشرة من النواة أو التآزر أو البويضة. لذلك ، ليست هناك حاجة للتلقيح أو الإخصاب.

السؤال 16- حدد نوع الكارب بمساعدة المخططات الموضحة أدناه:

إجابة.

السؤال 17. كيف يتم التلقيح في محطات المياه؟
إجابة. التلقيح بواسطة الماء يسمى ماء. بعض الأمثلة على النباتات الملقحة بالماء هي Vallisneria و Hydrilla (كلاهما نباتات مائية كاسيات النطاف) التي تنمو في المياه العذبة والعديد من الأعشاب البحرية البحرية مثل Zostera. لا تستخدم كل النباتات المائية الماء للتلقيح. في غالبية النباتات المائية مثل صفير الماء وزنبق الماء ، تظهر الأزهار فوق مستوى الماء وتلقيحها بواسطة الحشرات أو الرياح كما هو الحال في معظم النباتات البرية.

السؤال 18. ما وظيفة الأمشاج الذكوريين اللذين تنتجهما كل حبة حبوب لقاح في كاسيات البذور؟
إجابة. بعد إدخال أحد التآزرات ، يطلق أنبوب حبوب اللقاح الأمشاج الذكوريين في سيتوبلازم التآزر. يتحرك أحد الأمشاج الذكرية نحو خلية البويضة أو الغلاف المحيط ويندمج مع نواتها ، وبذلك يكمل التزاوج. ينتج عن هذا تكوين خلية ثنائية الصبغيات ، الزيجوت. يتحرك المشيج الذكري الآخر نحو النوى القطبية الموجودة في الخلية المركزية ويندمج معهما لإنتاج نواة سويداء أولية ثلاثية الصبغيات (PEN).

أسئلة نوع الإجابة المختصرة
السؤال رقم 1. ضع قائمة بثلاث استراتيجيات يمكن أن تطورها زهرة تشاسموجاموس ثنائية الجنس لمنع التلقيح الذاتي (الزواج الذاتي).
إجابة. طورت النباتات المزهرة العديد من الأجهزة لتثبيط التلقيح الذاتي وتشجيع التلقيح المتبادل.
• الجهاز الأول: في بعض الأنواع ، لا يكون إطلاق حبوب اللقاح وقابلية وصمة العار متزامنين. إما أن يتم إطلاق حبوب اللقاح قبل أن تصبح الوصمة متقبلة أو تصبح الوصمة متقبلة قبل إطلاق حبوب اللقاح بكثير. تسمى هذه الحالة ثنائية الزواج حيث تنضج وصمة العار والآخر في أوقات مختلفة.
• الجهاز الثاني: في بعض الأنواع ، يتم وضع العضو الذكري ووصمة العار في مواقع مختلفة بحيث لا يمكن لحبوب اللقاح أن تتلامس مع وصمة الزهرة نفسها. تسمى هذه الحالة غير المتجانسة.
• Herkogamy: عدم انتقال حبوب اللقاح من العضو الآخر إلى وصمة العار من نفس الزهرة بسبب حاجز ميكانيكي موجود بين العضو الآخر ووصمة العار. على سبيل المثال: Calotropis (Asclepiadaceae) ، Aristolochia ، Gloriosa superba.
الجهاز الثالث لمنع زواج الأقارب هو عدم التوافق الذاتي أو العقم الذاتي. هذه آلية وراثية وتمنع حبوب اللقاح الذاتية (من نفس الزهرة أو زهور أخرى من نفس النبات) من تخصيب البويضات عن طريق تثبيط إنبات حبوب اللقاح أو نمو أنبوب حبوب اللقاح في المدقة.

السؤال 2. فيما يلي الأحداث التي لوحظت في برنامج التهجين الاصطناعي. رتبهم بالترتيب التسلسلي الصحيح الذي يتم اتباعهم به في برنامج التهجين.
(أ) إعادة التعبئة ، (ب) اختيار الوالدين ، (ج) التعبئة ، (د) نفض حبوب اللقاح على وصمة العار ، (هـ) الإخصاء ، (و) جمع حبوب اللقاح من الوالد الذكر.
إجابة. (ب) اختيار الوالدين - & gt (e) الإخصاء - & gt (c) التعبئة - & gt (f) جمع حبوب اللقاح من الوالد الذكر - & gt (d) نثر حبوب اللقاح على وصمة العار - & gt (e) إعادة الترقيم.

السؤال 3. يحد Vivipary تلقائيًا من عدد النسل في القمامة. كيف؟
إجابة. في الحيوانات الولودة (غالبية الثدييات بما في ذلك البشر) ، فإن
يتطور الزيجوت إلى صغير داخل جسم الأنثى. بعد بلوغ مرحلة معينة من النمو ، يتم إخراج الصغار من جسم الأنثى. يحد Vivipary تلقائيًا من عدد النسل في القمامة لأن مساحة الأنثى محدودة لتطور الجنين.

السؤال 4. هل يفرض عدم التوافق الذاتي أي قيود على الزواج الذاتي؟ اذكر الأسباب واقترح طريقة التلقيح في مثل هذه النباتات.
إجابة. يفرض عدم التوافق الذاتي قيودًا على الزواج الذاتي. الجهاز الذي يمنع زواج الأقارب هو عدم التوافق الذاتي أو العقم الذاتي. هذه آلية وراثية وتمنع حبوب اللقاح الذاتية (من نفس الزهرة أو زهور أخرى من نفس النبات) من تخصيب البويضات عن طريق تثبيط إنبات حبوب اللقاح أو نمو أنبوب حبوب اللقاح في المدقة. يتم التغلب على عدم التوافق الذاتي عن طريق التلقيح المختلط.

السؤال 5. في الرسم البياني المعطى ، اكتب أسماء الأجزاء الموضحة بالخطوط.

إجابة.

السؤال 6. ما هو تعدد الأجنة وكيف يمكن استغلاله تجاريًا؟
إجابة. كما هو الحال في العديد من أصناف الحمضيات والمانجو ، تبدأ بعض الخلايا النووية المحيطة بكيس الجنين في الانقسام ، وتبرز في كيس الجنين وتتطور إلى الأجنة. في مثل هذه الأنواع ، تحتوي كل بويضة على العديد من الأجنة. يشار إلى حدوث أكثر من جنين في البذرة باسم تعدد الأجنة.
إذا تم تحويل الهجينة إلى أبومكتس ، فلا يوجد فصل بين الشخصيات في السلالة الهجينة. بعد ذلك ، يمكن للمزارعين الاستمرار في استخدام البذور المهجنة لزراعة محصول جديد عامًا بعد عام وليس عليه شراء بذور هجينة كل عام.

السؤال 7. هل بارثينوكاربي و أبوميكسيس ظاهرتان مختلفتان؟ ناقش فوائدها.
إجابة. نعم ، هم مختلفون. يؤدي Parthenocarpy إلى تطوير ثمار بدون بذور.
يؤدي Apomixis إلى تطور الجنين.

السؤال 8. لماذا تبدأ البيضة الملقحة في الانقسام فقط بعد تقسيم خلية السويداء الأولية (PEC)؟
إجابة. تحتاج البيضة الملقحة إلى التغذية أثناء تطورها. نظرًا لأن كيس الأجنة الناضج المخصب يوفر القليل جدًا من الغذاء إلى البيضة الملقحة ، فإن PEC تقسم وتنتج أنسجة السويداء التي تغذي البيضة الملقحة. ومن ثم ، فإن البيضة الملقحة تنقسم دائمًا بعد تقسيم PEC.

السؤال 9. تنقسم الخلية المولدة لحبوب اللقاح ثنائي الخلية في أنبوب حبوب اللقاح ولكن ليس في حبوب اللقاح ثلاثية الخلايا. اعط اسبابا.
إجابة. في حبوب اللقاح المكونة من 3 خلايا ، نظرًا لأن الخلية المولدة قد تم تقسيمها بالفعل وتشكيلها من الأمشاج الذكور ، فلن تنقسم مرة أخرى في أنبوب حبوب اللقاح. ولكن في حبوب اللقاح ثنائية الخلية ، حيث لم تنقسم الخلية المولدة ، فإنها تنقسم في أنبوب حبوب اللقاح.

السؤال 10. في الشكل الموضح أدناه ، قم بتسمية الأجزاء التالية: الأمشاج الذكرية ، وخلية البويضة ، والنواة القطبية ، وأنبوب اللقاح والتآزر

إجابة.

أسئلة نوع الإجابة الطويلة
السؤال رقم 1. بدءًا من البيضة الملقحة ، ارسم المخططات للمراحل المختلفة لتطور الجنين في ديكوت.
إجابة.

السؤال 2. ما هي الأنواع الممكنة للتلقيح في أزهار تشاسموجاموس؟ اعط اسبابا.
إجابة. تسمى الزهرة المخنثين التي تفتح عادة زهرة تشاسموجاموس.
أنواع التلقيح
1. Autogamy: في هذا النوع ، يتم التلقيح داخل نفس الزهرة. نقل حبوب اللقاح من العضو الذكري إلى وصمة الزهرة نفسها. في الزهرة العادية التي تفتح وتكشف عن الأنثرات ووصمة العار ، يكون الزواج الذاتي الكامل نادرًا إلى حد ما.
تنتج غالبية النباتات المزهرة أزهار خنثى ومن المرجح أن تتلامس حبوب اللقاح مع وصمة الزهرة نفسها. يؤدي استمرار التلقيح الذاتي إلى اكتئاب زواج الأقارب. طورت النباتات المزهرة العديد من الأجهزة لتثبيط التلقيح الذاتي وتشجيع التلقيح المتبادل.
2. Geitonogamy: نقل حبوب اللقاح من العضو الآخر إلى وصمة العار لزهرة أخرى من نفس النبات.
3. Xenogamy: نقل حبوب اللقاح من العضو الآخر إلى وصمة العار من نبات مختلف.

السؤال 3. مع رسم تخطيطي أنيق ، وصف أجزاء كيس جنين كاسيات البذور الناضج. اذكر دور التآزر.
إجابة.

جهاز خيطي موجود في الجزء الصغير من التآزرات يوجه دخول أنبوب حبوب اللقاح.

السؤال 4. ارسم مخططًا لميكروبورانجيوم وقم بتسمية طبقات جداره. اكتب بإيجاز عن دور endothecium.
إجابة.

يؤدي Endothecium وظيفة الحماية والمساعدة في تفكيك العضو الآخر لإطلاق حبوب اللقاح.

السؤال 5. تبدو أكياس الأجنة لبعض الأنواع الأبوميكتية طبيعية ولكنها تحتوي على خلايا ثنائية الصبغيات. اقترح شرحًا مناسبًا للحالة.
إجابة. صحيح أن العديد من الأبومكتس يمتلكون أكياسًا جنينية ذات مظهر طبيعي. الاحتمال الوحيد لامتلاك كيس الجنين لخلايا ثنائية الصبغيات يرجع إلى فشل الانقسام الانتصافي في مرحلة الخلية الأم الضخمة. نظرًا لأن الخلية الأم الضخمة تحتوي على نواة ثنائية الصبغيات ، إذا خضعت للانقسام الفتيلي بدلاً من الانقسام الاختزالي ، فستكون جميع النوى والخلايا الناتجة ذات طبيعة ثنائية الصبغيات.


نقاش

تشير نتائجنا إلى التحكم البيئي في علم الفينولوجيا وتخصيص الموارد التفاضلية اعتمادًا على كمية حبوب اللقاح الواردة في cleistogamous R. nudiflora. في ظل الظروف المظللة ، كان إنتاج أزهار الميثان لفترة أقصر وانتهى إنتاج فاكهة الميثان في وقت مبكر ، بينما تسبب الظل في بدء إنتاج فاكهة CL في وقت مبكر. ومع ذلك ، فإن العدد الإجمالي لأزهار الميثان وجميع الفاكهة (CH و CL) لم تتأثر بالظل. فيما يتعلق بتخصيص الكتلة الحيوية للبذور ، فضلت الظروف دون المثالية (المظللة) ، ولكن ليس الظروف غير المظللة ، التخصيص لبذور الميثان التي تتلقى مكملات حبوب اللقاح. تشير هذه النتائج إلى أنه في ظل الظروف دون المثالية ، لا يتم فقط إعادة تخصيص الموارد لإنتاج هياكل CL سابقًا ، ولكن أيضًا تعيد النباتات تخصيص الكتلة الحيوية بشكل أساسي لبذور الميثان التي تطورت من أزهار الميثان التي تتلقى كميات أكبر من حبوب اللقاح. وهكذا ، فإن cleistogamous R. nudiflora يستجيب للظروف دون المستوى الأمثل باستراتيجيتين متناقضتين: الإنتاج المبكر لبذور CL وتخصيص أكبر للكتلة الحيوية لبذور الميثان عالية الجودة المفترض.

على الرغم من أننا لم نجد أي تأثير للظل أو الري على عدد أزهار CH وفاكهة CH وفاكهة CL ، فقد حددنا تأثير الظل على فينولوجيا كل هذه الهياكل ، على الرغم من جوانب مختلفة. كاستجابة للظل ، تم تقصير إنتاج أزهار الميثان وانتهاء إنتاج فاكهة الميثان في وقت مبكر بالنسبة للنباتات الموجودة في قطع الأراضي الفرعية المفتوحة. من ناحية أخرى ، تم إنتاج فاكهة CL (وبالتالي زهور CL) في وقت سابق في النباتات في ظل ظروف مظللة مقارنة بتلك النباتات في قطع الأراضي الفرعية المفتوحة. على عكس الدراسات السابقة التي تشير إلى أن الظروف دون المثالية تزيد من إنتاج أزهار CL بالنسبة إلى أزهار الميثان (Culley and Klooster ، 2007) ، فقد أظهرت نتائجنا أن R. nudiflora تنتج عددًا مشابهًا من أزهار أو فواكه CH و CL بغض النظر عن الظروف البيئية بدلاً من ذلك ، تتأثر الأنماط الزمنية لزهرة CH و CL وإنتاج الفاكهة بشكل متباين بتوافر الضوء. قد يكون الإنتاج المبكر لزهور CL (ثم الفاكهة) وفترة إنتاج أقصر من أزهار الميثان مفيدًا في ظل الظروف المظللة حتى إذا ظل العدد الإجمالي للزهور أو الفاكهة ثابتًا. Ruellia nudiflora يبدأ التكاثر بزهور CL متبوعًا بإنتاج أزهار CH ، وينتج أزهار CL مرة أخرى في نهاية موسم التكاثر. لم يتأثر هذا التسلسل بتوافر الماء أو الضوء ، لذلك فإن الإنتاج المبكر لأزهار وفاكهة CL يمثل في الواقع بداية مبكرة لموسم التكاثر. عادة ما يرتبط الإزهار المبكر بشكل إيجابي بالنجاح التناسلي في النباتات (Munguía-Rosas وآخرون.، 2011) وقد يكون هذا هو الحال بالنسبة لأنواع دراستنا. من ناحية أخرى ، فإن فترة أقصر من إنتاج أزهار الميثان في ظل ظروف مظللة ، ولكن بكمية مماثلة لتلك الموجودة في ظروف أكثر مثالية ، قد تفضل جذب الملقحات ، وبالتالي نجاح التلقيح ، لأنه يتم تقديم عرض أزهار أكبر. كما أظهرت دراستنا ذلك R. nudiflora يخصص المزيد من الموارد للزهور التي تتلقى كميات أكبر من حبوب اللقاح ، وقد ينتج عن ذلك ذرية أكثر نشاطًا وربما أكثر نجاحًا في البيئات دون المثالية. يكشف هذا العمل عن أهمية النظر إلى التغيرات الدقيقة في مقياس الفينولوجيا للزهور والفواكه CH و CL باستخدام طرق كمية مناسبة. حتى الآن ، ركزت الدراسات السابقة التي تبحث في فينولوجيا نباتات cleistogamous فقط على إجمالي إنتاج أزهار CH و CL أو على الأنماط الزمنية النوعية (مثل Jasieniuk و Lechowicz ، 1987 Sigrist and Sazima ، 2002 Imaizumi وآخرون.، 2008) ولم يتمكنوا من اكتشاف التغيرات الصغيرة في الفينولوجيا استجابة للمتغيرات البيئية.

لقد تم اقتراح أن نباتات cleistogamous السنوية والدائمة تختلف في فينولوجيا التكاثر (Oakley وآخرون.، 2007). وفقًا لهؤلاء المؤلفين ، يتم إنتاج هياكل CL أولاً (في بعض الحالات أيضًا في النهاية) ، يليها الإنتاج المتزامن لـ CL و CH. في المقابل ، عادة ما تنتج النباتات المعمرة بشكل تسلسلي بنى CH و CL في بعض الحالات ، يحدث إنتاج هياكل CL بعد CH ولكن لم يحدث ذلك من قبل (أوكلي وآخرون., 2007). Ruellia nudiflora لا يتبع النمط المتوقع للنباتات المعمرة: دائمًا ما يتم إنتاج هياكل CL أولاً ، بغض النظر عن الظروف البيئية. على الرغم من أن بعض الدراسات السابقة أظهرت أن رطوبة التربة تؤثر على إنتاج أزهار CH و CL (مثل Bell and Quinn ، 1987) ، إلا أننا لم نحدد أي تأثير للري على الفينولوجيا أو تخصيص الموارد. أجريت تجربتنا في ظل ظروف ميدانية ، وبالتالي توجد بعض القيود ، مثل عدم القدرة على تجنب أو تقليل هطول الأمطار الطبيعية على قطع أراضي فرعية محددة دون الإخلال بتوافر الضوء. ومع ذلك ، نحن نعلم أن قطع الأراضي الفرعية غير المروية كانت في ظل ظروف دون المستوى الأمثل أو مجهدة لتوافر المياه لفترة زمنية أطول من النباتات الموجودة في قطع الأراضي الفرعية المروية (البيانات التكميلية الشكل S2). ومع ذلك ، لا يمكننا استبعاد احتمال أن تكون الفينولوجيا R. nudiflora قد يستجيب لعجز أكبر في المياه.

لم تؤثر الظروف دون المثالية (المظللة) على فينولوجيا الهياكل التناسلية في R. nudiflora، ولكن أيضًا أنماط تخصيص الموارد بين فاكهة CL وفاكهة CH من الزهور التي تتلقى كميات أكبر من حبوب اللقاح. اقترحت المراجعات السابقة ، بشكل عام ، أن هياكل CL لها الأولوية على هياكل CH في ظل ظروف دون المستوى الأمثل (مثل Oakley وآخرون.، 2007). في ظل ظروف مظللة R. nudiflora خصصت النباتات الموارد في وقت سابق لإنتاج أزهار وفواكه CL ، ومع ذلك ، فإن العدد الإجمالي لهذه الهياكل والكتلة الحيوية المخصصة لبذور CL لم تتأثر بالظل أو الري. ومن المثير للاهتمام ، أن نتائجنا تشير إلى أنه في ظل ظروف دون المستوى الأمثل ، فإن تلك البذور المأخوذة من أزهار CH التي تتلقى حبوب لقاح إضافية قد تكون أيضًا ذات أولوية في نباتات cleistogamous. قد تضمن بذور CL ، كما هو مقترح سابقًا ، التكاثر في ظل ظروف غير مواتية (Campbell وآخرون.، 1983 Culley and Klooster، 2007) ، ولكن أيضًا بذور الميثان عالية الجودة قد تنتج شتلات ذات قدرة تنافسية عالية في ظل ظروف دون المستوى الأمثل. البذور المنزوعة من أحمال حبوب اللقاح الكبيرة ليست أثقل فقط (Richardson and Stephenson ، 1992) ، ولكن حجمها يرتبط أيضًا بشكل إيجابي بالأداء في بعض الأنواع (Richardson and Stephenson ، 1992 Bernard and Toft ، 2007) بما في ذلك بعض الأنواع cleistogamous (مثل Trapp و هندريكس ، 1988 بيرج وريدبو تورستنسون ، 2000). لذلك ، من المحتمل أن يكون الأداء المتفوق للبذور المأخوذة من أزهار الميثان المكملة بحبوب اللقاح في R. nudiflora. كشفت الأبحاث في منطقة الدراسة ذلك R. nudiflora لديها تنوع جيني عالٍ (78٪ من المواقع متعددة الأشكال Ortegón-Campos ، 2010) ومعدل تهجين مرتفع (رم = 0 · 9 Marrufo، UADY، Mérida، México، unpubl. res.) ، مما يشير إلى أن حجم حمل حبوب اللقاح وليس الأصل (أي ذاتيًا مقابل تهجين) هو الذي يؤثر على تخصيص الموارد التفضيلية لزهور CH المكملة بحبوب اللقاح. ربما لم تخصص النباتات المزيد من الموارد لزهور الميثان المكملة بحبوب اللقاح في قطع الأراضي الفرعية المفتوحة لأن هذه النباتات ليست محدودة الموارد ، وبالتالي ، فإن هذه النباتات قادرة على تخصيص الموارد لزهور الميثان بالتساوي بغض النظر عن حجم حمل حبوب اللقاح. من غير المحتمل أن تكون نتائجنا من حيث تخصيص الموارد (أي تخصيص أكبر لأزهار الميثان المكملة بحبوب اللقاح في ظل ظروف مظللة) قطعة أثرية تم تقديمها عن طريق الحد من خدمة الملقحات بسبب قماش الظل. بادئ ذي بدء ، تم وضع القماش على بعد حوالي متر واحد من التربة ، مما سمح للزوار بالتحرك بحرية تحت القماش وكذلك التحليق فوق قطع الأرض الفرعية المفتوحة. ثانيًا ، لم نحدد أي تأثير للظل على وزن كل بذرة كعامل واحد ، أي أن جميع أزهار الميثان غير المعالجة تنتج بذورًا ذات وزن مماثل في قطع فرعية مفتوحة ومظللة (الشكل 2). لقد وثقت الدراسات السابقة أنه عند تطبيقها على مجموعة فرعية من الزهور ، فإن مكملات حبوب اللقاح لا تشير إلى محدودية حبوب اللقاح بدلاً من ذلك ، فمن المفيد تقييم إعادة تخصيص الموارد (Parra-Tabla وآخرون. 1998 نايت وآخرون., 2005, 2006).

في الختام ، تشير دراستنا إلى أن الأنماط الزمنية في إنتاج هياكل CH و CL تتأثر بشكل تفاضلي بهياكل الظل CL التي يتم إنتاجها مسبقًا في ظل ظروف مظللة بينما تم إنتاج هياكل CH لفترات أقصر. ومع ذلك ، بالإضافة إلى الإنتاج السابق لهياكل CL ، R. nudiflora يخصص أيضًا بشكل تفضيلي الموارد لتلك الزهور CH التي تتلقى كميات أكبر من حبوب اللقاح. يمكن أن يكون الإنتاج المبكر لبذور CL وبذور الميثان الأكثر نشاطًا استراتيجية مختلطة لمواجهة البيئات غير المتوقعة إذا كان الإنتاج المبكر لهياكل CL وحجم بذور CH مرتبطين بشكل إيجابي بالنجاح اللاحق للشتلات الناتجة من كل نوع من البذور. إذا كان هذا هو الحال ، فقد يوفر نسل CL ضمانًا إنجابيًا رخيصًا إذا تحسنت الظروف البيئية. بدلاً من ذلك ، قد تكون بذور الميثان المأخوذة من كميات كبيرة من حبوب اللقاح تنافسية للغاية إذا استمرت الظروف دون المستوى الأمثل. حيث R. nudiflora هي حشائش غازية في المكسيك (Villaseñor and Espinosa-García، 2004 Cervera and Parra-Tabla، 2009) ، قد تكون نتائجنا مفيدة أيضًا لفهم استراتيجيات التكاثر التي تسمح للأنواع الغازية باستعمار موائل جديدة (Cheplick، 2006 Imaizumi وآخرون.، 2008). يجب أن تأخذ الدراسات المستقبلية التي تبحث في تأثير البيئة على تخصيص الموارد في أي نبات كليستوجاميوس في الاعتبار أن حجم حمل حبوب اللقاح قد ينتج أنماط تخصيص تفاضلية في بذور CH. لقد تم اقتراح أن cleistogamy تطور كاستجابة لعدم التجانس البيئي (Schoen and Lloyd ، 1984) وبالتالي ، فإن التخصيص للزهور والتخصيص للبذور وأداء النسل قد ينتج أنماطًا مختلفة في ظل الظروف المثلى ودون المثالية.


شاهد الفيديو: معلومات عن نبات الانتران وثكاثرها من اجمل النباتات التي تصبح سياج حدائق جميله واشكال رائعه (ديسمبر 2021).